Originally published In Press as doi:10.1074/jbc.M109365200 on February 25, 2002
J. Biol. Chem., Vol. 277, Issue 18, 15629-15637, May 3, 2002
Salt-inducible Kinase Represses cAMP-dependent
Protein Kinase-mediated Activation of Human Cholesterol Side Chain
Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine
Zipper Domain*
Junko
Doi
§¶,
Hiroshi
Takemori
¶,
Xing-zi
Lin
,
Nanao
Horike
,
Yoshiko
Katoh
, and
Mitsuhiro
Okamoto
From the
Department of Molecular Physiological
Chemistry, Osaka University Medical School H-1, 2-2, Yamadaoka, Suita,
Osaka, 565-0871, Japan and the § Department of Life Science,
Kinran College, 5-25-1, Fujishirodai, Suita,
Osaka 565-0873, Japan
Received for publication, September 27, 2001, and in revised form, January 28, 2002
 |
ABSTRACT |
Salt-inducible kinase (SIK), one of the
serine/threonine protein kinases, was transiently expressed in Y1 cells
during the early phase of the ACTH/cAMP-dependent protein
kinase (PKA)-mediated signal transduction. The overexpression of
SIK(N), the SIK's N-terminal kinase domain, repressed the expression
of the side chain cleavage cytochrome P450 (CYP11A) gene. To elucidate
the mechanism of the repression by SIK, several CYP11A promoter
constructs were tested for the promoter activities in the presence of
PKA and/or SIK(N). A cAMP-response element (CRE)-like sequence present
in the promoter was shown to be responsible not only for the
PKA-mediated promoter activation but also for the SIK(N)-mediated
repression. When the Gal4 DNA binding domain-linked full-length
CRE-binding protein (CREB) construct was cotransfected with Gal4
reporter gene, SIK(N) repressed the PKA-induced reporter gene
expression. However, SIK(N) could not repress the PKA-induced reporter
activity conferred by Gal4 DNA binding domain-linked basic leucine
zipper (bZIP)-less CREB or bZIP-disrupted CREB. On the other hand,
SIK(N) could repress the kinase-inducible domain-disrupted
CREB-dependent reporter gene expression in the presence of
PKA. The in vitro kinase reaction studies showed that
SIK(N) could not phosphorylate CREB, and PKA failed to phosphorylate
SIK(N). Taken together, these results suggest that SIK(N), cooperating
with PKA, may act on the CREB's bZIP domain and repress the
CREB-mediated transcriptional activation of the CYP11A gene.
 |
INTRODUCTION |
Adrenocorticotropic hormone
(ACTH)1 binds to its
receptors on the plasma membranes of adrenocortical cells and
initiates a chain of well documented cellular events: the coupling of
the ACTH receptor with GTP-binding protein, the activation of adenylate cyclase, the elevation of intracellular cAMP level, and the activation of cAMP-dependent protein kinase (PKA) (1, 2). The
activated PKA then stimulates steroidogenesis by accelerating the
transcription and translation of genes for steroidogenic proteins, such
as steroidogenic acute regulatory protein, the protein that transfers
cholesterol from the outer mitochondrial membrane to the inner
mitochondrial membrane (3-5), and side chain cleavage cytochrome P450
(CYP11A), the enzyme that catalyzes the conversion of cholesterol to
pregnenolone (6-10). The PKA is also known to stimulate the
transcription of other steroidogenic genes (11-13).
A cDNA encoding salt-inducible kinase SIK was recently identified
in the adrenal glands of rats fed a high salt diet (14). SIK belongs to
a family of AMP-activated protein kinase, a serine/threonine protein kinase that plays important roles in regulating metabolism of
cells under the stress (15-18). The levels of SIK's mRNA,
protein, and kinase activity in Y1 mouse adrenocortical tumor cells
were elevated within 30 min after the ACTH stimulation and returned to
the initial levels after a few hours. The initiation of transcription of the steroidogenic acute regulatory protein gene and the CYP11A gene
appeared to coincide with the decline of the SIK levels (19). Besides,
the transcription of the CYP11A gene failed to occur in ACTH-treated
SIK-overexpressing Y1 cells. Moreover, the cAMP-dependent activation of a 2.3-kb-long human CYP11A gene promoter was abolished by
the coexpression of SIK (19). These results suggested that SIK, induced
during the early phase of the ACTH stimulation, acted as a negative
regulator for the initiation of CYP11A gene transcription.
A cAMP-responsive region of the human CYP11A promoter, located at
1.8
to
1.6 kb, contains a cAMP-response element (CRE)-like sequence and a
functional Ad4 (SF-1) element, which synergistically confer a full cAMP
response upon adrenocortical cells (20-23). A consensus CRE sequence,
TGACGTCA, found in promoter regions of a variety of genes, is one of
the major target sites of PKA action (24-27). The CRE is bound by a
homo- or heterodimer composed of basic leucine zipper (bZIP)-containing
nuclear factors, such as CRE-binding protein (CREB) (28), CRE modulator
(CREM) (29), and activating transcription factor (ATF) (30, 31). CREB
is then phosphorylated by PKA at Ser133 in its
kinase-inducible domain (KID), and the phosphorylated CREB becomes
capable of binding a coactivator CREB-binding protein (CBP) and
ultimately activating the gene transcription (32, 33).
In the present study, we investigate the mechanism by which SIK
represses the PKA-dependent activation of the CYP11A
promoter. The results of reporter assays using several promoter
construct-linked reporter genes demonstrated that the site responsible
for the repression by SIK was the CRE-like element, the same element
acting in the PKA-mediated promoter activation. Further detailed
examination suggested that SIK did not phosphorylate CREB during the
ACTH stimulation of the cells or in the in vitro kinase
assays but inhibited the PKA-dependently activated
transcription by acting on the CREB's bZIP domain. Thus, the
bZIP domain seemed to play a hitherto unreported role in the
transcriptional regulation of the gene.
 |
EXPERIMENTAL PROCEDURES |
Plasmids and Reagents--
CYP11A reporter plasmids, pS2.3H Luc
and 3×[S-RR]SV-CAT (21), were generous gifts from K. Morohashi
(National Institute for Basic Biology, Okazaki, Japan). The following
plasmids were obtained from commercial sources: pIRES1neo, pTAL, and
pTAL-CRE from CLONTECH (Palo Alto, CA); pM and
FR-Luc from Stratagene (La Jolla, CA); pGL3 and pRL-SV40 from
Promega (Madison, WI); and pGEX-6P1 from Amersham Biosciences.
The reporters containing human CYP11A promoters were constructed by
polymerase chain reaction (PCR) using a luciferase vector pS2.3H Luc as
a template. To prepare the
1.8 and
1.5 kb promoter fragments, the
2.3 kb fragment was subjected to PCR by using the following sets of
primers: for the
1.8 kb fragment, sense (KpnI
1.8
kb) 5'-AAAGGTACCTCCTTCTGAGGGAGGAATGT and antisense (HindIII) 5'-CCCAAGCTTCTGTGACTGTACCTGCTCCAC; and for the
1.5 kb fragment, sense (KpnI
1.5 kb)
5'-AAAGGTACCGGTTCAACAGTATTGGAGTCT and antisense (HindIII).
The amplified products were digested with KpnI and
HindIII and introduced into the
KpnI/HindIII site of pGL3.
A BglII fragment containing three copies of the
cAMP-responsive region (
1.8 to
1.6 kb) of the human CYP11A
promoter was prepared from 3×[S-RR]SV-CAT and introduced into the
BglII site of pTAL. To construct pTAL-3× hCYP11A CRE, an
oligonucleotide composed of three copies of CRE,
1653 to
1646, in
the CYP11A promoter fragment,
5'-CGCGTTGGCTGATGTCATTCCATTGGCTGATGTCATTCCATTGGCTGATGTCATTCCA/5'GATCTGGAATGACATCAGCCAATGGAATGACATCAGCCAATGGAATGACATCAGCCAA, was annealed and introduced into the MluI/BglII
site of pTAL. For pTAL-3× hCYP11A Ad4, an oligonucleotide composed of
three copies of Ad4,
1635 to
1630, in the promoter,
5'-CGCGGGCTCAAGGTCATCATGGGCTCAAGGTCATCATGGGCTCAAGGTCATCATG/5'-GATCCATGATGACCTTGAGCCCATGATGACCTTGAGCCCATGATGACCTTGAGCC, was introduced into the MluI/BglII site. A
BamHI/XbaI fragment containing five copies of
Gal4 elements of FR-Luc was ligated into the
BglII/NheI site of pTAL, and the resultant
reporter was named pTAL-5× GAL-4. A five-nucleotide substitution at
the CRE-like element of the human CYP11A promoter was created by
site-directed mutagenesis using a mutagenic primer
(5'-CACTGCCTTCCTTGGCTCTAGACATTCCAGGCTCAAGGTC), a pS2.3H Luc template,
and a site-directed mutagenesis kit, GeneEditor (Promega).
A cDNA fragment of human CREB was amplified by PCR using the
primers F primer (5'-GGGAATTCATGGAATCTGGAGCCGAGAAC) and R primer (5'-CCGGATCCCCATTTTCCACCTTAACAGGTGA) from a brain-derived cDNA pool
(Multiple ChoiceTM; OriGene Technologies Inc., Rockville,
MD). The PCR product was digested by EcoRI/BamHI
and ligated into the EcoRI/BamHI site of pM, and
the resultant plasmid, that had the Gal4 DNA binding domain (DB)
at the N terminus of CREB, was named pM-CREB(F). To prepare a
C-terminal truncated CREB vector pM-CREB(S), an XhoI (amino
acid residue 297)/SalI (in the 3'-cloning site of pM)
fragment encoding the bZIP domain was removed. To prepare the CREB
construct having the Gal4 DB at the C-terminal side, a Gal4 DB coding
region containing EcoRI and SalI sites was
amplified by PCR with a
NheI-EcoRI-SalI-linked primer
(5'-TAAGCTAGCGAATTCGTCGACATGAAGCTACTGTCTTCTATC) and a
HindIII-linked primer (5'-TTTAAGCTTCGGCGATACAGTCAACTGTCT)
using pM as a template. The amplified product was digested by
NheI/HindIII, and the resultant NheI-EcoRI-SalI/HindIII
fragment was replaced with a NheI/HindIII fragment derived from the original pM vector. Into the resultant pM
vector a CREB cDNA fragment having no stop codon, prepared by PCR
with F primer and R2 primer (5'- GGGTCGACATCTGATTTGTGGCAGTAAAG), was
introduced. Mutagenic primers used for the construction of four mutant
CREB (K303Q, L311A/L318A, S133A, and DIEDML) vectors were
5'-GAGTGTCGTAGACAGAAGAAAGAATATGTG,
5'-GAATATGTGAAATGTGCAGAAAACAGAGTGGCAGTGGCTGAAAATCAAAATCAAAAC, 5'-GGGAAATTCTTTCAAGGAGGCCTGCCTACAGGAAAATTTTGAATGAC, and
5'-CGAAGGGAAATTCTTTCAGATATCGAGGATATGCTGAAAATTTTGAATGAC, respectively.
To express CREB protein in Escherichia coli, a
EcoRI/HindIII fragment of pM-CREB(F) was ligated
into the EcoRI/HindIII site of a GST fusion
vector, pGEX-6P1, and the resultant plasmid was named pGEX-CREB. A
bacterial strain BL21 (codon plus) (Stratagene, La Jolla, CA) was
transformed by pGEX-CREB, and the expressed CREB was purified as
described before with some modifications (19).
The following reagents were obtained from commercial sources:
forskolin, fetal calf serum, dithiothreitol (DTT), and
phenylmethylsulfonyl fluoride from Sigma; geneticin and trypsin-EDTA
from Invitrogen; anti-phospho-Ser133 CREB IgG and
anti-CREB IgG for Western blotting from New England Biolabs (Beverly,
NJ); anti-CREB IgG for immunoprecipitation from Rockland Inc.
(Gilbertsville, PA); and ACTH (Cortrosyn) from Daiichi Seiyaku Co.
(Tokyo, Japan).
Cell Culture and Reporter Assay--
Y1 cells were maintained in
Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal
calf serum and antibiotics at 37 °C under an atmosphere of 5%
CO2-95% air. The method for the reporter assay was
described previously (19). To introduce DNAs into Y1 cells,
LipofectAMINE 2000 (Invitrogen) was used in this study.
Electrophoretic Mobility Shift Analyses--
Nuclear extracts
were prepared as described previously (34). The following
oligonucleotides were used as probes: CRE-like element of the human
CYP11A promoter, CYP11A CRE
(5'-gTTGGCTGATGTCATTCCA/5'-gTGGAATGACATCAGCCAA) (21); a mutated CRE,
CYP11A mCRE (5'-gTTGGCTCTAGACATTCCA/5'-gTGGAATGTCTAGAGCCAA); and a CRE
of the human
CG promoter,
CG CRE
(5'-gCAAATTGACGTCATGGTAA/5'-gTTACCATGACGTCAATTTG) (35). The CYP11A CRE
was 3'-end-labeled with [
-32P]dCTP using Klenow
fragment in the presence of cold dATP, dTTP, and dGTP. For each binding
assay, the unlabeled competitor oligonucleotide (50-fold excess),
anti-CREB IgG (6 µl), or anti-SIK IgG (6 µl) was mixed with 10 µg
of nuclear extracts in 20 µl of binding buffer composed of 10 mM HEPES (pH 7.5), 16 mM KCl, 0.5 mM MgCl2, 1 mM DTT, 0.4 mM EDTA, and 1 µg of poly(dI-dC)-poly(dI-dC). The
radiolabeled duplex oligonucleotide (50,000 cpm) was added to the
mixture, and the reaction mixture was incubated at room temperature for 15 min. The samples were immediately subjected to SDS-PAGE in 5%
polyacrylamide gels, and autoradiography was performed by using an
intensifying screen.
Immunoprecipitation and Immunoblot Analysis--
These
analytical methods were described previously (19). Lysis buffer (50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 5 mM EGTA, 2 mM DTT, 50 mM glycerol
3-phosphate, 50 mM NaF, 1 mM NaVO4,
0.5% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 14 µg/ml aprotinin) and 3 × SDS sample
buffer (150 mM Tris-HCl (pH 6.8), 6% SDS, 30% glycerol,
and 0.1% bromphenol blue) were used in this study.
In Vivo Phosphorylation of CREB--
Y1 cells (5 × 105 in a 25-cm2 flask) were incubated with 0.1 mCi (3.7 MBq) of 32PO4 in a phosphate-free
medium for 2 h, and then the cells were treated with or without
10
6 M ACTH for 15 min, washed with 1 ml of
PBS, and lysed in 900 µl of lysis buffer containing 300 mM NaCl. The cell lysates were preincubated with 100 µl
of protein A-Sepharose (Amersham Biosciences) for 1 h to eliminate
the nonspecific binding. The soluble fractions were separated by
centrifugation at 12,000 rpm for 10 min and incubated with 10 µl of
anti-CREB IgG and 30 µl of protein A-Sepharose for 2 h. After
washing the Sepharose beads with 1 ml of lysis buffer four times,
proteins bound to IgG-protein A-Sepharose complex were solubilized with
30 µl of 3× SDS sample buffer, separated in 15% polyacrylamide
gels, and visualized by an autoradiography. Similar experiments were
performed for the nonradiolabeled cells to examine total CREB protein
level by Western blotting.
In Vitro Kinase Assay--
The catalytic subunit of PKA from
bovine heart was purchased from Sigma. GST-SIK(N), GST-SIK(N)K56M and
GST-Syntide2 were described previously (19). PKA (0.5 units) was mixed
with 1.0 µCi (37 kBq) of [
32P]ATP and substrates
(0.1 µg of CREB, GST-SIK(N)K56M, or GST-Syntide2) in 20 µl of PKA
reaction buffer (50 mM Tris-HCl (pH 7.4), 1 mM DTT, and 5 mM MgCl2). Reactions were performed
at 25 °C for 20 min and stopped by the addition of 10 µl of 3×
SDS sample buffer. The reaction mixture was boiled for 5 min, and
proteins in 10-µl aliquots were subjected to SDS-PAGE in 15%
gel. The gel was dried and exposed to an x-ray film at room temperature
for 1 h. To examine the kinase activity of HA-SIK, 30 µl of the
samples were mixed with 10 µl of SIK reaction buffer (50 mM Tris-HCl (pH 7.4), 1 mM DTT, and 10 mM MnCl2) containing 20 µg of GST-Syntide2
and 1.0 µCi (37 kBq) of [
32P]ATP, and the mixture
was incubated at 30 °C for 1 h. After the addition of 15 µl
of 3× SDS sample buffer, the reaction mixture was heated at 100 °C
for 5 min, and an aliquot (10 µl) was subjected to SDS-PAGE followed
by autoradiography as described previously (19).
 |
RESULTS |
SIK Represses PKA-induced CYP11A Promoter Activity by Acting on
CRE--
To identify an element(s) in the CYP11A promoter region that
may serve as the target of the SIK's repressive effect, the 2.3-kb promoter fragment and its truncated derivatives were linked to the
luciferase reporter gene. The respective promoter-reporter constructs
were introduced into Y1 cells together with PKA expression and/or SIK
expression vectors. Because the N-terminal 343-amino acid peptide, the
kinase portion, of SIK, SIK(N), produced more prominent repression than
the full-length SIK in the cotransfection assays (19), SIK(N) was used
for the coexpression experiments. When the 2.3- or 1.8-kb
fragment-linked reporter gene was expressed in the cells, the
coexpression of PKA elevated the reporter activity by about 3-4-fold.
This PKA-dependent elevation was completely abrogated by
coexpressing SIK(N) (Fig. 1). In
contrast, the 1.5-kb fragment's promoter activity was elevated by only
20% by the addition of PKA, and this PKA-dependently
elevated activity was little affected by the coexpression of SIK(N).
These results not only confirmed the previous report that the
1.8 to
1.5 kb region contained the cAMP-responsive enhancer composed of a
CRE-like element and an Ad4 (SF-1) element (20, 21, 23) but also suggested that the region might also contain the major target site of
the SIK's repressive effect. (It has been noted that the coexpression
of SIK(N) alone seemed to produce about 20-30% inhibition in the
basal promoter activity, but this issue will be further investigated
elsewhere.)

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 1.
A region 1.8 to 1.5 kb
(k) of the human CYP11A promoter is
important for PKA-mediated transcription as well as its repression by
SIK. Y1 cells, cultured at 1 × 105/well in
12-well plates for 48 h, were transformed with 0.25 µg of
reporter constructs containing the 2.3, 1.8, and 1.5 kb human
CYP11A promoters or pGL3. SIK expression vectors (pIRES(HA)-SIK(N) or
pIRES(HA)) (0.25 µg), PKA expression vectors (pIRES-PKAc or pIRES)
(0.1 µg), and pRL-SV40 internal control (0.03 µg) were
cotransfected as indicated. After the 12-h incubation, cells were
harvested, and homogenates were measured for luciferase activities in
the Dual-Luciferase Reporter Assay System. Transformation efficiencies
were corrected by Renilla luciferase activities. The
specific promoter activities of CYP11A were expressed as -fold
expression of the reporter activity of the empty vector pGL3. Means
from duplicate experiments are shown.
|
|
To determine precisely which element within the enhancer is important
for the SIK-mediated repression of promoter activity, three chimeric
luciferase reporter genes, each of which had three tandemly repeated
promoter sequences of the enhancer, CRE-like element, or Ad4
(SF-1) element, respectively, were constructed (Fig.
2A). The reporter gene
containing the enhancers or CRE-like elements was clearly activated by
PKA. And the PKA-dependently elevated reporter activity was
completely abrogated by the coexpression of SIK(N). The reporter gene
containing the Ad4 (SF-1) elements, however, was not influenced by the
coexpression of PKA, SIK(N), or PKA and SIK(N) together. These results
suggested that the CRE-like sequence in the enhancer might be the major
target site upon which SIK exerted its repressive effect.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
CRE is responsible for the SIK-mediated
repression. A, pTAL luciferase vectors having three
copies each of the cAMP-responsive region (pTAL-3· hCYP11A cAMP), the
CRE-like element (pTAL-3× hCYP11A CRE), and Ad4 (pTAL-3× hCYP11A Ad4)
were used as reporters. Transformation and luciferase assay were
performed as described in the legend to Fig. 1. TATA indicates a TATA
box of the thymidine kinase promoter. B, the CRE-like
element TGATGTCA in the 2.3 kb CYP11A promoter was mutated to
TctagaCA. Twelve hours after transformation, Y1 cells were treated with
or without 50 µM forskolin for 12 h, and the cell
homogenates were measured for luciferase activities. Means and S.E.
from triplicate experiments are shown. WT, wild type.
|
|
To further confirm the above point, the CRE-like element in the 2.3-kb
fragment was mutated, and the promoter activity of the mutated fragment
was compared with that of the wild-type fragment (Fig. 2B).
The addition of forskolin activated the wild-type promoter by about
2-fold, and this activation was completely abrogated by the
coexpression of SIK(N). On the other hand, the extent of activation by
forskolin of the mutated promoter was only 20%, and this slight
activation was not significantly affected by the coexpression of
SIK(N). These results supported the notion that SIK might repress the
ACTH/cAMP/PKA-induced CYP11A promoter activity by acting on the
CRE-like element, the same element that was responsible for the
transcriptional activation.
CREB Is a Major Factor That Binds to the CRE in CYP11A
Promoter--
To gain further insight into the target site of PKA's,
as well as SIK's, action, nuclear factors that possibly bound to the CRE-like element during the transcriptional activation of the CYP11A
gene were characterized. To do that, a radiolabeled oligonucleotide containing the CRE-like sequence was mixed with nuclear extracts prepared from Y1 cells or SIK-overexpressing Y1 cells, and
electrophoretic mobility shift analyses were performed. Several
radioactive bands appeared in the lanes of both Y1 extracts and
SIK-overexpressing Y1 extracts, indicating the complex formation
between the nuclear proteins and the oligonucleotide (Fig.
3A). The addition of a nonradiolabeled self-oligonucleotide or a human chorionic gonadotropin gene-derived CRE completely inhibited the complex formation, but the
addition of a mutated CYP11A-CRE did not. It should be noted that the
pattern of radioactive bands produced from the Y1 extracts was similar
to that from the SIK-overexpressing Y1 extracts. Because we have
evidence that SIK protein was present both in the nucleus and in the
cytosol of Y1 cells,2 these
results suggest that the presence of SIK protein in the nuclear
extracts could not influence the DNA-protein complex
formation.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 3.
CREB is the major factor that binds to the
CRE-like element. A, 32P-labeled CRE-like
element probe (gTTGGCTGATGTCATTCCA) (5 × 104 cpm) was
incubated with or without ( ) 10 µg of nuclear extracts prepared
from normal Y1 cells (Y) or SIK-overexpressing Y1 cells
(S), and then the incubation mixtures were subjected to
electrophoretic mobility shift analyses as described under
"Experimental Procedures." For competition assays, a 50-fold excess
of an unlabeled oligonucleotide, CYP11A CRE, mutant CRE CYP11A mCRE, or
a CG CRE was added to the reaction mixture. B, supershift
analysis of nuclear factors. Anti-CREB IgG or anti-SIK IgG was added to
the incubation mixture of the nuclear extracts and the radiolabeled
probe. The IgG-CREB-DNA complexes were indicated by an
arrow, CREB (shifted). C,
nuclear extracts were prepared from Y1 and SIK(N)-overexpressing Y1
cells that had been treated without ( ) or with 10 6
M ACTH for 1 h (+) and subjected to the
electrophoretic mobility shift analysis. Ab, antibody.
|
|
Based on the above results and the previous reports (36-39), we
surmised that the major nuclear factor involved in the DNA-protein complex formation might be CREB. To confirm this, an antibody against
CREB was added to the incubation mixtures, and the mixtures were
analyzed by electrophoresis. As shown in Fig. 3B, the
presence of the antibody shifted the major band of DNA-protein complex to the upper position. Again, no difference was seen between the Y1 and
the SIK-overexpressing Y1 extracts. On the other hand, the addition of
an antibody against SIK protein little influenced the positions of
DNA-protein complexes. Next, nuclear extracts were prepared from the
cells that had been treated with, or without, ACTH. The electrophoretic
mobility shift pattern of the extracts from ACTH-treated cells
resembled that from the control cells, and no difference was seen
between the Y1 and the SIK-overexpressing Y1 extracts (Fig.
3C). Taken together, these results indicate that CREB may be
the major nuclear factor in Y1 cells that binds to the CRE-like element
in the CYP11A promoter, and SIK may not directly interact with the
CRE·CREB complex.
Phosphorylation Level of CREB--
CREB-mediated transcription is
regulated by PKA-dependent phosphorylation of
Ser133 in the KID domain of CREB (40). The question was
asked whether or not SIK could phosphorylate CREB and influence its
transcriptional activity. GST-SIK(N) was incubated with a recombinant
CREB expressed in E. coli or GST-Syntide2, a SIK synthetic
peptide substrate, in the presence of [
-32P]ATP. As
shown in Fig. 4A, the results
of autoradiographic as well as immunoblot analyses of the incubation
mixture indicated that GST-SIK(N) could not phosphorylate CREB,
although the same dose of GST-SIK(N) could well phosphorylate
GST-Syntide2. On the other hand, in the incubation mixture of PKA with
CREB the Ser133-phosphorylated CREB was detected as
expected. Although GST-Syntide2 does not have the consensus
phosphorylation motif for PKA, the peptide appeared to be a good
substrate of PKA.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 4.
SIK does not phosphorylate CREB.
A, CREB (0.1 µg) was incubated with 1.0 µCi of
[ 32P]ATP in the absence ( ) or presence of PKA (0.5 units) or GST-SIK(N) (0.1 µg) at 25 °C for 20 min. The reaction
was stopped by the addition of 3× SDS sample buffer. Phosphorylated
CREB (pCREB) was separated by SDS-PAGE in 15% gel and
visualized on an x-ray film (upper panel).
Similar experiments were conducted by using cold ATP (1 mM). After electrophoresis, the proteins were transferred
onto a polyvinylidene difluoride membrane, and CREB was detected with
anti-phospho-Ser133 CREB (pCREB(pS133)) IgG or
anti-CREB (CREB) IgG (middle panel).
GST-Syntide2 (1.0 µg) was used as a substrate for the phosphorylation
reactions (bottom panel). B, Y1 cells
(Y) and SIK-overexpressing Y1 cells (S) (5 × 105 in a 25-cm2 flask), preincubated with
32PO4 in the phosphate-free medium for 2 h, were treated with (+) or without ( ) 10 6
M ACTH for 15 min. The cell lysates were immunoprecipitated
using anti-CREB antibody ( CREB). Phosphoproteins and
total CREB were visualized by autoradiography (upper panel)
and Western blotting (lower panel), respectively.
C, levels of phospho-Ser133 CREB in the
ACTH-treated Y1 or SIK(N)-overexpressing Y1 cells were examined. The
cells, cultured at 5 × 105/well in six-well plates
for 24 h, were treated with 10 6 M ACTH
for the indicated periods. The cells were lysed with 100 µl of SDS
sample buffer, and the lysates (15 µl) were subjected to SDS-PAGE
followed by immunoblot analyses using anti-phospho-Ser133
CREB IgG or anti-CREB IgG. CREB, phospho-CREB, and phospho-ATF-1 are
indicated by arrows. M, size marker (47.5 and
32.5 kDa). The experiments were conducted in duplicate, and one of the
results is shown. IP, immunoprecipitation; WB, Western blot.
|
|
Next, CREB's phosphorylation levels in the normal, or ACTH-stimulated,
Y1 cells and SIK-overexpressing Y1 cells were examined (Fig.
4B). Y1 cells prelabeled with 32PO4
were incubated with ACTH for 15 min, and then CREB in the cell lysates
was analyzed after the immnoprecipitation. A radiolabeled 42-kDa
protein (pCREB) was specifically precipitated by anti-CREB antibody,
and its radioactivity was elevated by the ACTH treatment. The levels of
phosphorylation of pCREB in the SIK-overexpressing Y1 cells were
apparently the same as those in the normal Y1 cells. It should be
mentioned here that during the immunoprecipitation experiments we could
detect no evidence suggesting direct interaction between SIK and
CREB.
Last, by using anti-phospho-CREB antibody, the extents of
Ser133 phosphorylation in the ACTH-treated Y1 cells and
SIK-overexpressing Y1 cells were examined (Fig. 4C). The
antibody used in this experiment could also detect the phosphorylated
form of CREB-related transcriptional factor ATF-1. In the ACTH-treated
Y1 cells, the levels of phospho-CREB and phospho-ATF-1 elevated within
7.5 min, remained at the maximal levels for 30 min, and then gradually
declined. A similar change in levels of phosphorylated transcription
factors was seen in the ACTH-treated SIK-overexpressing Y1 cells. These
results suggest that SIK may not influence the level of phosphorylation
of CREB during the ACTH-mediated signal transduction.
bZIP Domain of CREB Is Essential for the Transcriptional Repression
by SIK--
To further explore how SIK exerts its repressive effect on
the CREB-mediated transcriptional activation, we designed experiments in which the transcriptional activity of mutated CREBs could be evaluated. Thus, a chimeric transcription factor GAL4DB-linked CREB and
a 5×Gal4-linked luciferase reporter were expressed in Y1 cells, and
the CREB's transcriptional activity was tested in the presence or
absence of PKA and SIK(N). When a GAL4DB/full-length CREB vector
pM-CREB(F) was introduced into Y1 cells, the reporter activity was
elevated by about 2.5-fold by the addition of PKA, with the activation
being repressed by the coexpression of SIK(N) (Fig.
5A). The coexpression of
SIK(N)K56M, a kinase activity-disrupted SIK, could not repress the
pM-CREB(F) activation (Fig. 5B). In contrast, when a
GAL4DB/bZIP-less CREB vector pM-CREB(S) was tested, the
PKA-dependent activation was about 1.8-fold, with the
activation not being repressed by the coexpression of SIK(N). When the
CREBs having GAL4DB at the C-terminal sides were tested (Fig.
5C), the bZIP-less CREB also was not repressed by SIK(N).
These results suggest that the bZIP domain of CREB appears to be
important for SIK to exert its repressive effect on the CREB-mediated
transcriptional activation. To confirm this, several mutations were
introduced in the leucine zipper and basic region of CREB, and the
mutated CREBs were tested for their transcriptional activities under
similar experimental conditions (Fig. 6).
Whereas the mutated CREBs, such as L311A/L318A-CREB and K303Q-CREB,
could well activate reporter gene expression in response to the
addition of PKA, the PKA-dependent activation of
L311A/L318A-CREB was not repressed, and that of K303Q-CREB was
repressed a little by SIK(N). Thus, it seemed that an intact bZIP
domain structure was required for SIK's repressive effect on the
CREB-mediated transcriptional activation.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5.
bZIP domain of CREB is important for SIK's
action. A, the transactivation activity of CREB was
examined by using Gal4 DNA binding domain-linked CREBs. Y1 cells
(1 × 105/well) were transformed with 0.15 µg of
Gal4 DNA binding domain-linked CREB expression vectors
(full-length CREB (pM-CREB(F)), bZIP-less CREB (pM-CREB (S)), or
empty vector (pM)). SIK(N) expression vectors (0.15 µg) and PKA
expression vector (0.1 µg) were used for cotransfection, as
indicated. Gal4-linked luciferase reporter pTAL-5× GAL-4 (0.15 µg)
and pRL-SV40 (internal control, 0.03 µg) were used as the reporters.
Luciferase activities were measured by the Dual-Luciferase Reporter
Assay System. The specific transcriptional activities of CREB were
expressed as -fold expression of the empty Gal4 vector, pM.
B, kinase-defective SIK, SIK(N)K56M, was used for the
Gal4-based CREB activation assay. C, the Gal4 DB was linked
at the C terminus of full-length CREB (CREB(F)-pM) or bZIP-less CREB
(CREB(S)-pM).
|
|

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 6.
bZIP domain of CREB is a target of SIK's
action. Mutations (K303Q or L311A/L318A) were introduced in the
bZIP domain of Gal4-CREB(F). Transformation and luciferase assay were
performed as described above. Means and S.E. from triplicate
experiments are shown. WT, wild type.
|
|
Mutation of KID Domain of CREB Does Not Affect SIK's Repressive
Effect--
Next, the roles played by the KID domain of CREB in the
PKA-mediated transcriptional activation as well as its repression by
SIK were examined. The PKA-dependent phosphorylation of
Ser133 is essential for the transcriptional activation.
Therefore, when the transcriptional activity of S133A-CREB, the
dominant negative CREB, was tested, the coexpression of PKA little
increased the reporter activity (Fig. 7).
Unexpectedly, however, the coexpression of both SIK(N) and PKA in this
system lowered the level of reporter gene expression substantially, the
level being even lower than that in the presence of SIK(N) alone.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 7.
Mutations in KID domain of CREB do not affect
SIK's action. Gal4 DNA binding domain was linked to dominant
negative CREB (S133A) or constitutively active CREB (DIEDML).
Transformation and luciferase assay were performed as described in the
legend to Fig. 5. Means and S.E. from triplicate experiments are shown.
WT, wild type.
|
|
A constitutively active CREB was constructed in which a six-amino acid
peptide around Ser133, RRPSYR, which is required for
binding to CBP after the serine phosphorylation (41), was replaced by a
peptide DIEDML, the peptide in a CBP/p300-binding region of SREBP-1a
(42). When the constitutively active CREB was tested for the chimeric
CREB-dependent reporter assays, the basal level of reporter
activity was about 2 times as high as the wild-type CREB, and the level
was further elevated by the coexpression of PKA, in good agreement
with the previous report (42). It should be noted, however, that
the coexpression of both SIK(N) and PKA again significantly lowered the
reporter activity than the coexpression of SIK(N) alone. These results
suggest that in order for SIK to exert its repressive effect on the
CRE/CREB-dependent transcription activity, PKA must be
present in the system although CREB's PKA-dependent
phosphorylation site was disrupted.
The possibility was considered that PKA might phosphorylate SIK(N) and
affect the SIK's enzyme, as well as protein, properties. Thr268 of SIK, located in a PKA phosphorylation motif,
(R/K)(R/K)X(S/T), would be a candidate residue for
the PKA-dependent phosphorylation (43). To design the
following experimental protocol, SIK(N)K56M was used as the possible
substrate of PKA lest the autophosphorylation activity of SIK(N) should
disturb the interpretation of phosphorylation results (19), and
GST-Syntide2 was used as a positive control substrate of PKA. The
purity of the substrates used for this experiment was verified in Fig.
8A. PKA was incubated with
GST-SIK(N)K56M or GST-Syntide2 in the presence of
[
-32P]ATP, and the reaction mixture was subjected to
SDS-PAGE followed by autoradiography (Fig. 8B). The results
clearly showed that PKA could phosphorylate GST-Syntide2, but not
GST-SIK(N)K56M, under the in vitro assay conditions.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 8.
PKA does not phosphorylate SIK(N).
A, appraisal of the purity of the substrates used for
PKA-dependent phosphorylation. GST fusion proteins were
expressed in E. coli, and 5 µg each of GST, GST-Syntide2,
or GST-SIK(N)K56M were separated by SDS-PAGE in 15% gel and stained
with Coomassie Brilliant Blue R-250 (C.B.B.). M,
size marker (175, 83, 62, 47.5, 32.5, and 25 kDa). B, PKA,
0.5 units, was incubated with 0.1 µg each of the substrates in the
presence of 1.0 µCi of [ -32P]ATP at 25 °C for 20 min. The reaction was stopped by the addition of 3× SDS sample buffer.
The radiolabeled proteins were visualized on an x-ray film after the
SDS-PAGE. C, a mutation, T268A, was introduced in the kinase
domain of full-length SIK. The mutant SIK plasmid pIRES(HA)-SIK(F)T268A
or the wild-type SIK plasmid pIRES(HA)-SIK(F) was introduced into Y1
cells, and the cells were treated with or without ACTH
(10 6 M) for 1 h. The SIKs were recovered from the
cell homogenates, and their protein kinase activity was measured in the
in vitro kinase assay system as given under "Experimental
Procedures." The results shown are representative of triplicate
experiments. D, the effect of the mutant SIK, SIK(N)T268A,
on the CRE-mediated transcription activity was examined. Y1 cells
(1 × 105/well) were transformed with 0.25 µg of
reporter constructs (pTAL-CRE or pTAL), 0.25 µg of SIK expression
vectors (pIRES(HA)-SIK(N) WT or pIRES(HA)-SIK(N)T268A), 0.1 µg of PKA expression vector pIRES-PKAc, and 0.03 µg of pRL-SV40
(internal control), as indicated. Means and S.E. from triplicate
experiments are shown. IP, immunoprecipitation;
WB, Western blot.
|
|
A possibility still remains that in the ACTH-stimulated Y1 cells PKA
might phosphorylate Thr268 of SIK, and the phosphorylated
SIK might have an altered kinase activity and regulate the gene
transcription. Thus, a SIK having Ala268 in place of Thr
was prepared, and the wild-type and mutated enzymes were expressed in
Y1 cells as HA-tagged proteins. (The full-length SIK, which is much
more stable than SIK(N) in Y1 cells (19), was used in this experiment.)
The Y1 cells were incubated with or without 10
6
M ACTH for 30 min, and the HA-SIK proteins were purified
from the cell homogenates. The purified enzymes were incubated with GST-Syntide2 in the presence of [
-32P]ATP, and the
reaction mixtures were subjected to SDS-PAGE. As shown in the
autoradiograms of Fig. 8C, the autophosphorylation activity
and Syntide2 phosphorylation activity of the wild-type SIK were not
altered in the cells under ACTH stimulation. Moreover, the kinase
activities of the mutant T268A-SIK were similar to those of the
wild-type SIK whether or not the cells were incubated with ACTH. Thus,
the possibility that in the ACTH-stimulated Y1 cells PKA might
phosphorylate Thr268 of SIK and alter SIK's kinase
activity could be ruled out. That the transcriptional repression
activity of SIK(N) T268A was similar to that of the wild-type SIK(N)
was shown in Fig. 8D. In the CRE-luciferase reporter assay
systems, when SIK(N)K56M instead of SIK(N)T268A was used, SIK-mediated
transcriptional repression did not occur, as expected (data not shown).
In this experiment, a commercially available CRE-luciferase reporter
pTAL-CRE was used for the assays, because this reporter produced more
prominent activation by PKA than the human CYP11A CRE-luciferase
reporter, and the PKA-dependent activation was more
completely repressed by the coexpression of SIK(N). It should be
mentioned that essentially similar results were obtained with the
CYP11A CRE-luciferase reporter. Taken together, these results suggest
that the phosphorylation of Ser133 in the KID domain of
CREB by PKA may not affect the SIK-mediated repression of transcription
activation, but, for the SIK's repressive effect, the presence of PKA
may be necessary without phosphorylating SIK.
 |
DISCUSSION |
The results presented herein demonstrated that SIK repressed
CREB-mediated transcriptional activity mainly by acting on the CRE·CREB complex formed in the promoter region of the CYP11A gene. Although CREB might not be a SIK substrate (Fig. 4), our previous report showed that SIK's kinase activity was essential for inhibiting the forskolin-dependent transcriptional activation of the
CYP11A promoter (19). A region in the CREB where SIK exerted its
repressive action was examined by the assays using Gal4-based chimeric
CREBs. The results suggested that the bZIP domain of CREB, not the KID domain having phosphorylation sites, was important for the SIK's action. The bZIP domain of CREB has been attributed to the domain essential for the nuclear import, DNA binding, and dimerization but not
the domain directly involved in transcriptional regulation (44, 45).
However, it is possible that the bZIP domain, through its regular array
of leucine residues inside the coiled coil structure, interacts with a
hydrophobic, sticky domain of another transcriptional regulatory
protein (45-47), and SIK might phosphorylate this protein, not CREB,
with the result of indirectly influencing the CREB's transcriptional
activation potential.
Leucine zipper protein kinase (ZPK) (48), also called dual leucine
zipper-bearing kinase (49) or mitogen-activated protein kinase upstream
kinase (50), is expressed in a variety of cells, belongs to a family of
mitogen-activated protein kinase kinase kinase, and has two leucine
zipper-like motifs near its C terminus. Like SIK, ZPK, when
overexpressed in NTera-2 human teratocarcinoma cells, inhibited the
PKA-induced transcriptional activation of CREB (51). The direct
binding of ZPK and CREB was demonstrated, but sites of the interaction
were not identified; nor was requirement of the leucine zipper of CREB
demonstrated (51). A possibility that ZPK might influence the
CREB-mediated transcriptional activation in Y1 cells could be ruled
out, because the overexpression of ZPK in Y1 cells did not influence
the PKA-dependent activation of CYP11A promoter or CRE-Luc
reporter.3 Besides, the
SIK-mediated repressive effect was not influenced by the addition of
ZPK (data not shown). We could therefore conclude that SIK inhibited
the transcriptional activation by CREB by acting on the CREB's leucine
zipper but not through the ZPK-dependent mechanisms.
The homodimeric structure of CREB is modulated by the phosphorylation
of Ser142 in the KID (52). When Ser142 is
phosphorylated by calmodulin kinase II (53), the CREB homodimer dissociates without affecting its DNA binding ability. Because the
monomeric CREB, whether or not it is phosphorylated at
Ser133, could not recruit CBP (52), the
Ser142-phosphorylated CREB would act in a dominant negative
fashion on the transcriptional activation by CREB. To test possible
involvement of the Ser142 phosphorylation by calmodulin
kinase II in the SIK's action, a Gal4-CREB mutant having
Ala142 in place of Ser was prepared. The PKA-induced
transcriptional activation through the S142A-CREB in Y1 cells was
repressed by the coexpression of SIK to a similar extent as in
the case using the wild-type CREB (data not shown). Therefore, the
possibility that the calmodulin kinase II-mediated phosphorylation of
Ser142 may somehow be involved in SIK's action in Y1 cells
could be ruled out.
S6 kinase pp90RSK (54, 55) and Tat interactive protein of
60 kDa (Tip60) (56) have been reported to modulate CREB's function. The activated pp90RSK, in growth factor-treated PC12 cells,
formed a stable complex with CBP and inhibited PKA-activated
transcriptional activity of CREB. In this case the kinase activity of
pp90RSK was not necessary for the inhibition phenomenon
(57). Tip60, a cellular protein bound to human iummunodeficiency
virus-1 Tat protein, has histone acetyltransferase activity (56). Tip60 directly bound to CREB and inhibited PKA-induced transcriptional activation through the histone acetyltransferase activity-independent mechanism (58). Since both of these inhibitions were demonstrated in
the Gal4-bZIP-less CREB systems, these enzymes possibly modulated the
function of CREB by acting on its N-terminal transactivating domain.
Therefore, the mechanisms of transcriptional modulation by these two
enzymes might differ from those underlying the SIK-mediated transcriptional repression.
The transcription regulatory function of the KID domain-mutated,
dominant negative, and constitutively active CREBs should be
irrelevant to the presence of PKA in the system. Therefore, it was
completely unexpected to find that the transcription mediated by these
CREBs was substantially repressed by the presence of both SIK and PKA
(Fig. 7). Considering the fact that PKA could not phosphorylate SIK(N)
(Fig. 8) and SIK(N) could not phosphorylate CREB (Fig. 4), we at least
conclude here that in order for SIK to exert its repressive effect on
the CRE/CREB-dependent transcriptional activity, PKA must
be present in the system although it would not phosphorylate CREB or
SIK. In addition to CREB, another signal transducer, which is an
endogenous substrate of PKA or SIK, might be involved in the PKA- and
SIK-dependent transcriptional regulation. With respect to
the basal transcriptional activity of CREB, the constitutively active
domain (CAD) of CREB, corresponding to a glutamine-rich region (Q2),
can efficiently recruit a RNA polymerase complex and activate the
transcription (59-62). In response to cAMP, however, the CAD acts
synergistically with the phosphorylated KID and activates the
KID-dependent transcription (32, 63). Given this
information, the possibility that SIK might disrupt the cooperative
action between the KID and CAD is currently under investigation at our laboratory.
Several nuclear factors, including CREB, CREM, and ATFs, bind to the
CRE and, after being phosphorylated by PKA, activate gene expression
(24-27). Although CREB was identified here as the major factor in Y1
nuclear extracts that bound to the CRE-like element, it should be noted
that significant amounts of non-CREB factors were recognized by the
CRE-like element probe in the electrophoretic mobility shift assays
(Fig. 3). In CREB-deficient human adrenocortical H295R cells, ATF-1 and
CREM are known to act as factors that bind to the CRE and activate the
transcription (64). SIK in fact could repress the CRE-mediated
transcription in H295R cells in a similar mode as in the case of
Y1 cells (data not shown). Given these facts, SIK might be involved in
regulating not only the function of CREB but also those of the other
CREB-related nuclear factors.
Fig. 9 illustrates our
current model to understand the SIK's role in the regulation of the
early phase of CREB-mediated steroidogenic gene
transcription. After the ACTH stimulation of adrenocortical cells, PKA,
activated through ACTH/cAMP signaling, would phosphorylate Ser133 of CREB and stimulate transcription of a
CRE-containing gene, such as the CYP11A gene. However, the SIK protein,
having been synthesized by ACTH/cAMP signaling (19), would repress the
CRE-mediated transcription via the bZIP domain of CREB in a
PKA-dependent manner. As a result, the transcription of the
CYP11A gene would be suppressed until the level of SIK protein begins
to decline (19).

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 9.
Model of SIK-mediated repression of
ACTH/PKA-induced activation of CREB in Y1 cells.
ACTH-R, ACTH receptor; G, G-protein;
AC, adenylate cyclase.
|
|
 |
ACKNOWLEDGEMENTS |
We thank Dr. Ken-ichirou Morohashi (National
Institute for Basic Biology, Okazaki, Japan) for providing us with
pS2.3H Luc/3×[S-RR]SV-CAT plasmids and Y1 cells. We are also
grateful to Dr. Shigeo Ohno (Yokohama City University School of
Medicine, Yokohama, Japan) for sending us mitogen-activated protein
kinase upstream kinase expression vector.
 |
FOOTNOTES |
*
This work was supported in part by grants-in-aid for
Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology and the Ministry of Health, Labor and Welfare Japan and a grant from the Uehara Memorial Foundation.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
These authors contributed equally to this work.
To whom correspondence should be addressed: Dept. of Molecular
Physiological Chemistry, Osaka University Medical School H-1, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan. Tel.: 81-6-6879-3280; Fax:
81-6-6879-3289; E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp.
Published, JBC Papers in Press, February 25, 2002, DOI 10.1074/jbc.M109365200
2
H. Takemori, Y. Katoh, J. Doi, N. Horike, X. Lin, and M. Okamoto, manuscript in preparation.
3
J. Doi, H. Takemori, X. Lin, N. Horike, Y. Katoh, and M. Okamoto, our unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
ACTH, adrenocorticotropic hormone;
PKA, cAMP-dependent protein
kinase;
CYP11A, cholesterol side chain cleavage cytochrome P450;
SIK, salt-inducible kinase;
CRE, cAMP-response element;
bZIP, basic leucine
zipper;
CREB, CRE-binding protein;
CREM, CRE modulator;
ATF, activating
transcription factor;
KID, kinase-inducible domain;
CBP, CREB-binding
protein;
DTT, dithiothreitol;
ZPK, leucine-zipper kinase;
Tip60, Tat
interactive protein of 60 kDa;
GST, glutathione
S-transferase;
HA, hemagglutinin;
GAL4DB, Gal4 DNA binding
domain.
 |
REFERENCES |
| 1.
|
Kramer, R. E.,
Rainey, W. E.,
Funkenstein, B.,
Dee, A.,
Simpson, E. R.,
and Waterman, M. R.
(1984)
J. Biol. Chem.
259,
707-713[Abstract/Free Full Text]
|
| 2.
|
Olson, M. F.,
Krolczyk, A. J.,
Gorman, K. B.,
Steinberg, R. A.,
and Schimmer, B. P.
(1993)
Mol. Endocrinol.
7,
477-487[Abstract]
|
| 3.
|
Clark, B. J.,
Wells, J.,
King, S. R.,
and Stocco, D. M.
(1994)
J. Biol. Chem.
269,
28314-28322[Abstract/Free Full Text]
|
| 4.
|
Ariyoshi, N.,
Kim, Y. C.,
Artemenko, I.,
Bhattacharyya, K. K.,
and Jefcoate, C. R.
(1998)
J. Biol. Chem.
273,
7610-7619[Abstract/Free Full Text]
|
| 5.
|
Stocco, D. M.
(2000)
Biochim. Biophys. Acta
1486,
184-197[Medline]
[Order article via Infotrieve]
|
| 6.
|
Rice, D. A.,
Kirkman, M. S.,
Aitken, L. D.,
Mouw, A. R.,
Schimmer, B. P.,
and Parker, K. L.
(1990)
J. Biol. Chem.
265,
11713-11720[Abstract/Free Full Text]
|
| 7.
|
Ahlgren, R.,
Simpson, E. R.,
Waterman, M. R.,
and Lund, J.
(1990)
J. Biol. Chem.
265,
3313-3319[Abstract/Free Full Text]
|
| 8.
|
Morohashi, K.,
Zanger, U. M.,
Honda, S.,
Hara, M.,
Waterman, M. R.,
and Omura, T.
(1993)
Mol. Endocrinol.
7,
1196-1204[Abstract]
|
| 9.
|
White, P. C.,
New, M. I.,
and Dupont, B.
(1987)
N. Engl. J. Med.
316,
1519-1524[Medline]
[Order article via Infotrieve]
|
| 10.
|
Miller, W. L.
(1988)
Endocr. Rev.
9,
295-318[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Kramer, R. E.,
Simpson, E. R.,
and Waterman, M. R.
(1983)
Steroids
41,
207-223[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
John, M. E.,
Simpson, E. R.,
Waterman, M. R.,
and Mason, J. I.
(1986)
Mol. Cell. Endocrinol.
45,
197-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Bird, I. M.,
Mason, J. I.,
and Rainey, W. E.
(1998)
J. Clin. Endocrinol. Metab.
83,
1592-1597[Abstract/Free Full Text]
|
| 14.
|
Wang, Z.,
Takemori, H.,
Halder, S. K.,
Nonaka, Y.,
and Okamoto, M.
(1999)
FEBS Lett.
453,
135-139[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Corton, J. M.,
Gillespie, J. G.,
and Hardie, D. G.
(1994)
Curr. Biol.
4,
315-324[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Hardie, D. G.,
Carling, D.,
and Carlson, M.
(1998)
Annu. Rev. Biochem.
67,
821-855[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Lefebvre, D. L.,
Bai, Y.,
Shahmolky, N.,
Sharma, M.,
Poon, R.,
Drucker, D. J.,
and Rosen, C. F.
(2001)
Biochem. J.
355,
297-305[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Kim, J.,
Yoon, M. Y.,
Choi, S. L.,
Kang, I.,
Kim, S. S.,
Kim, Y. S.,
Choi, Y. K.,
and Ha, J.
(2001)
J. Biol. Chem.
276,
19102-19110[Abstract/Free Full Text]
|
| 19.
|
Lin, X.,
Takemori, H.,
Katoh, Y.,
Doi, J.,
Horike, N.,
Makino, A.,
Nonaka, Y.,
and Okamoto, M.
(2001)
Mol. Endocrinol.
15,
1264-1276[Abstract/Free Full Text]
|
| 20.
|
Inoue, H.,
Watanabe, N.,
Higashi, Y.,
and Fujii-Kuriyama, Y.
(1991)
Eur. J. Biochem.
195,
563-569[Medline]
[Order article via Infotrieve]
|
| 21.
|
Takayama, K.,
Morohashi, K.,
Honda, S.,
Hara, N.,
and Omura, T.
(1994)
J. Biochem. (Tokyo)
116,
193-203[Abstract/Free Full Text]
|
| 22.
|
Guo, I. C.,
Tsai, H. M.,
and Chung, B. C.
(1994)
J. Biol. Chem.
269,
6362-6369[Abstract/Free Full Text]
|
| 23.
|
Hu, M. C.,
Hsu, N. C.,
Pai, C. I.,
Wang, C. K.,
and Chung, B.
(2001)
Mol. Endocrinol.
15,
812-818[Abstract/Free Full Text]
|
| 24.
|
Andrisani, O. M.
(1999)
Crit. Rev. Eukaryotic Gene Expression
9,
19-32[Medline]
[Order article via Infotrieve]
|
| 25.
|
Shaywitz, A. J.,
and Greenberg, M. E.
(1999)
Annu. Rev. Biochem.
68,
821-861[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
De Cesare, D.,
and Sassone-Corsi, P.
(2000)
Prog. Nucleic Acids Res. Mol. Biol.
64,
343-369[Medline]
[Order article via Infotrieve]
|
| 27.
|
Mayr, B.,
and Montminy, M.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
599-609[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Hoeffler, J. P.,
Meyer, T. E.,
Yun, Y.,
Jameson, J. L.,
and Habener, J. F.
(1988)
Science
242,
1430-1433[Abstract/Free Full Text]
|
| 29.
|
Foulkes, N. S.,
Borrelli, E.,
and Sassone-Corsi, P.
(1991)
Cell
64,
739-749[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Hai, T. W.,
Liu, F.,
Coukos, W. J.,
and Green, M. R.
(1989)
Genes Dev.
3,
2083-2090[Abstract/Free Full Text]
|
| 31.
|
Liu, F.,
and Green, M. R.
(1990)
Cell
61,
1217-1224[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Brindle, P.,
Linke, S.,
and Montminy, M.
(1993)
Nature
364,
821-824[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Shaywitz, A. J.,
Dove, S. L.,
Kornhauser, J. M.,
Hochschild, A.,
and Greenberg, M. E.
(2000)
Mol. Cell. Biol.
20,
9409-9422[Abstract/Free Full Text]
|
| 34.
|
Takemori, H.,
Doi, J.,
Katoh, Y.,
Halder, S. K.,
Lin, X. Z.,
Horike, N.,
Hatano, O.,
and Okamoto, M.
(2001)
Eur. J. Biochem.
268,
205-217[Medline]
[Order article via Infotrieve]
|
| 35.
|
Delegeane, A. M.,
Ferland, L. H.,
and Mellon, P. L.
(1987)
Mol. Cell. Biol.
7,
3994-4002[Abstract/Free Full Text]
|
| 36.
|
Watanabe, N.,
Inoue, H.,
and Fujii Kuriyama, Y.
(1994)
Eur. J. Biochem.
222,
825-834[Medline]
[Order article via Infotrieve]
|
| 37.
|
Chung, B. C.,
Guo, I. C.,
and Chou, S. J.
(1997)
Steroids
62,
37-42[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Chen, C.,
and Guo, I. C.
(2000)
Life Sci.
67,
2045-2049[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Bassett, M. H.,
Zhang, Y.,
White, P. C.,
and Rainey, W. E.
(2000)
Endocr. Res.
26,
941-951[Medline]
[Order article via Infotrieve]
|
| 40.
|
Gonzalez, G. A.,
and Montminy, M. R.
(1989)
Cell
59,
675-680[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Parker, D.,
Ferreri, K.,
Nakajima, T.,
LaMorte, V. J.,
Evans, R.,
Koerber, S. C.,
Hoeger, C.,
and Montminy, M. R.
(1996)
Mol. Cell. Biol.
16,
694-703[Abstract]
|
| 42.
|
Cardinaux, J. R.,
Notis, J. C.,
Zhang, Q., Vo, N.,
Craig, J. C.,
Fass, D. M.,
Brennan, R. G.,
and Goodman, R. H.
(2000)
Mol. Cell. Biol.
20,
1546-1552[Abstract/Free Full Text]
|
| 43.
|
Pearson, R. B.,
and Kemp, B. E.
(1991)
Methods Enzymol.
200,
62-81[Medline]
[Order article via Infotrieve]
|
| 44.
|
Dwarki, V. J.,
Montminy, M.,
and Verma, I. M.
(1990)
EMBO J.
9,
225-232[Medline]
[Order article via Infotrieve]
|
| 45.
|
Schumacher, M. A.,
Goodman, R. H.,
and Brennan, R. G.
(2000)
J. Biol. Chem.
275,
35242-35247[Abstract/Free Full Text]
|
| 46.
|
Fass, D. M.,
Craig, J. C.,
Impey, S.,
and Goodman, R. H.
(2001)
J. Biol. Chem.
276,
2992-2997[Abstract/Free Full Text]
|
| 47.
|
Hong, S.,
Park, S. J.,
Kong, H. J.,
Shuman, J. D.,
and Cheong, J.
(2001)
J. Biol. Chem.
276,
28098-28105 |