Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M109365200 on February 25, 2002

J. Biol. Chem., Vol. 277, Issue 18, 15629-15637, May 3, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/18/15629    most recent
M109365200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doi, J.
Right arrow Articles by Okamoto, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, J.
Right arrow Articles by Okamoto, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Salt-inducible Kinase Represses cAMP-dependent Protein Kinase-mediated Activation of Human Cholesterol Side Chain Cleavage Cytochrome P450 Promoter through the CREB Basic Leucine Zipper Domain*

Junko DoiDagger §, Hiroshi TakemoriDagger , Xing-zi LinDagger , Nanao HorikeDagger , Yoshiko KatohDagger , and Mitsuhiro OkamotoDagger ||

From the Dagger  Department of Molecular Physiological Chemistry, Osaka University Medical School H-1, 2-2, Yamadaoka, Suita, Osaka, 565-0871, Japan and the § Department of Life Science, Kinran College, 5-25-1, Fujishirodai, Suita, Osaka 565-0873, Japan

Received for publication, September 27, 2001, and in revised form, January 28, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Salt-inducible kinase (SIK), one of the serine/threonine protein kinases, was transiently expressed in Y1 cells during the early phase of the ACTH/cAMP-dependent protein kinase (PKA)-mediated signal transduction. The overexpression of SIK(N), the SIK's N-terminal kinase domain, repressed the expression of the side chain cleavage cytochrome P450 (CYP11A) gene. To elucidate the mechanism of the repression by SIK, several CYP11A promoter constructs were tested for the promoter activities in the presence of PKA and/or SIK(N). A cAMP-response element (CRE)-like sequence present in the promoter was shown to be responsible not only for the PKA-mediated promoter activation but also for the SIK(N)-mediated repression. When the Gal4 DNA binding domain-linked full-length CRE-binding protein (CREB) construct was cotransfected with Gal4 reporter gene, SIK(N) repressed the PKA-induced reporter gene expression. However, SIK(N) could not repress the PKA-induced reporter activity conferred by Gal4 DNA binding domain-linked basic leucine zipper (bZIP)-less CREB or bZIP-disrupted CREB. On the other hand, SIK(N) could repress the kinase-inducible domain-disrupted CREB-dependent reporter gene expression in the presence of PKA. The in vitro kinase reaction studies showed that SIK(N) could not phosphorylate CREB, and PKA failed to phosphorylate SIK(N). Taken together, these results suggest that SIK(N), cooperating with PKA, may act on the CREB's bZIP domain and repress the CREB-mediated transcriptional activation of the CYP11A gene.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Adrenocorticotropic hormone (ACTH)1 binds to its receptors on the plasma membranes of adrenocortical cells and initiates a chain of well documented cellular events: the coupling of the ACTH receptor with GTP-binding protein, the activation of adenylate cyclase, the elevation of intracellular cAMP level, and the activation of cAMP-dependent protein kinase (PKA) (1, 2). The activated PKA then stimulates steroidogenesis by accelerating the transcription and translation of genes for steroidogenic proteins, such as steroidogenic acute regulatory protein, the protein that transfers cholesterol from the outer mitochondrial membrane to the inner mitochondrial membrane (3-5), and side chain cleavage cytochrome P450 (CYP11A), the enzyme that catalyzes the conversion of cholesterol to pregnenolone (6-10). The PKA is also known to stimulate the transcription of other steroidogenic genes (11-13).

A cDNA encoding salt-inducible kinase SIK was recently identified in the adrenal glands of rats fed a high salt diet (14). SIK belongs to a family of AMP-activated protein kinase, a serine/threonine protein kinase that plays important roles in regulating metabolism of cells under the stress (15-18). The levels of SIK's mRNA, protein, and kinase activity in Y1 mouse adrenocortical tumor cells were elevated within 30 min after the ACTH stimulation and returned to the initial levels after a few hours. The initiation of transcription of the steroidogenic acute regulatory protein gene and the CYP11A gene appeared to coincide with the decline of the SIK levels (19). Besides, the transcription of the CYP11A gene failed to occur in ACTH-treated SIK-overexpressing Y1 cells. Moreover, the cAMP-dependent activation of a 2.3-kb-long human CYP11A gene promoter was abolished by the coexpression of SIK (19). These results suggested that SIK, induced during the early phase of the ACTH stimulation, acted as a negative regulator for the initiation of CYP11A gene transcription.

A cAMP-responsive region of the human CYP11A promoter, located at -1.8 to -1.6 kb, contains a cAMP-response element (CRE)-like sequence and a functional Ad4 (SF-1) element, which synergistically confer a full cAMP response upon adrenocortical cells (20-23). A consensus CRE sequence, TGACGTCA, found in promoter regions of a variety of genes, is one of the major target sites of PKA action (24-27). The CRE is bound by a homo- or heterodimer composed of basic leucine zipper (bZIP)-containing nuclear factors, such as CRE-binding protein (CREB) (28), CRE modulator (CREM) (29), and activating transcription factor (ATF) (30, 31). CREB is then phosphorylated by PKA at Ser133 in its kinase-inducible domain (KID), and the phosphorylated CREB becomes capable of binding a coactivator CREB-binding protein (CBP) and ultimately activating the gene transcription (32, 33).

In the present study, we investigate the mechanism by which SIK represses the PKA-dependent activation of the CYP11A promoter. The results of reporter assays using several promoter construct-linked reporter genes demonstrated that the site responsible for the repression by SIK was the CRE-like element, the same element acting in the PKA-mediated promoter activation. Further detailed examination suggested that SIK did not phosphorylate CREB during the ACTH stimulation of the cells or in the in vitro kinase assays but inhibited the PKA-dependently activated transcription by acting on the CREB's bZIP domain. Thus, the bZIP domain seemed to play a hitherto unreported role in the transcriptional regulation of the gene.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmids and Reagents-- CYP11A reporter plasmids, pS2.3H Luc and 3×[S-RR]SV-CAT (21), were generous gifts from K. Morohashi (National Institute for Basic Biology, Okazaki, Japan). The following plasmids were obtained from commercial sources: pIRES1neo, pTAL, and pTAL-CRE from CLONTECH (Palo Alto, CA); pM and FR-Luc from Stratagene (La Jolla, CA); pGL3 and pRL-SV40 from Promega (Madison, WI); and pGEX-6P1 from Amersham Biosciences.

The reporters containing human CYP11A promoters were constructed by polymerase chain reaction (PCR) using a luciferase vector pS2.3H Luc as a template. To prepare the -1.8 and -1.5 kb promoter fragments, the -2.3 kb fragment was subjected to PCR by using the following sets of primers: for the -1.8 kb fragment, sense (KpnI -1.8 kb) 5'-AAAGGTACCTCCTTCTGAGGGAGGAATGT and antisense (HindIII) 5'-CCCAAGCTTCTGTGACTGTACCTGCTCCAC; and for the -1.5 kb fragment, sense (KpnI -1.5 kb) 5'-AAAGGTACCGGTTCAACAGTATTGGAGTCT and antisense (HindIII). The amplified products were digested with KpnI and HindIII and introduced into the KpnI/HindIII site of pGL3.

A BglII fragment containing three copies of the cAMP-responsive region (-1.8 to -1.6 kb) of the human CYP11A promoter was prepared from 3×[S-RR]SV-CAT and introduced into the BglII site of pTAL. To construct pTAL-3× hCYP11A CRE, an oligonucleotide composed of three copies of CRE, -1653 to -1646, in the CYP11A promoter fragment, 5'-CGCGTTGGCTGATGTCATTCCATTGGCTGATGTCATTCCATTGGCTGATGTCATTCCA/5'GATCTGGAATGACATCAGCCAATGGAATGACATCAGCCAATGGAATGACATCAGCCAA, was annealed and introduced into the MluI/BglII site of pTAL. For pTAL-3× hCYP11A Ad4, an oligonucleotide composed of three copies of Ad4, -1635 to -1630, in the promoter, 5'-CGCGGGCTCAAGGTCATCATGGGCTCAAGGTCATCATGGGCTCAAGGTCATCATG/5'-GATCCATGATGACCTTGAGCCCATGATGACCTTGAGCCCATGATGACCTTGAGCC, was introduced into the MluI/BglII site. A BamHI/XbaI fragment containing five copies of Gal4 elements of FR-Luc was ligated into the BglII/NheI site of pTAL, and the resultant reporter was named pTAL-5× GAL-4. A five-nucleotide substitution at the CRE-like element of the human CYP11A promoter was created by site-directed mutagenesis using a mutagenic primer (5'-CACTGCCTTCCTTGGCTCTAGACATTCCAGGCTCAAGGTC), a pS2.3H Luc template, and a site-directed mutagenesis kit, GeneEditor (Promega).

A cDNA fragment of human CREB was amplified by PCR using the primers F primer (5'-GGGAATTCATGGAATCTGGAGCCGAGAAC) and R primer (5'-CCGGATCCCCATTTTCCACCTTAACAGGTGA) from a brain-derived cDNA pool (Multiple ChoiceTM; OriGene Technologies Inc., Rockville, MD). The PCR product was digested by EcoRI/BamHI and ligated into the EcoRI/BamHI site of pM, and the resultant plasmid, that had the Gal4 DNA binding domain (DB) at the N terminus of CREB, was named pM-CREB(F). To prepare a C-terminal truncated CREB vector pM-CREB(S), an XhoI (amino acid residue 297)/SalI (in the 3'-cloning site of pM) fragment encoding the bZIP domain was removed. To prepare the CREB construct having the Gal4 DB at the C-terminal side, a Gal4 DB coding region containing EcoRI and SalI sites was amplified by PCR with a NheI-EcoRI-SalI-linked primer (5'-TAAGCTAGCGAATTCGTCGACATGAAGCTACTGTCTTCTATC) and a HindIII-linked primer (5'-TTTAAGCTTCGGCGATACAGTCAACTGTCT) using pM as a template. The amplified product was digested by NheI/HindIII, and the resultant NheI-EcoRI-SalI/HindIII fragment was replaced with a NheI/HindIII fragment derived from the original pM vector. Into the resultant pM vector a CREB cDNA fragment having no stop codon, prepared by PCR with F primer and R2 primer (5'- GGGTCGACATCTGATTTGTGGCAGTAAAG), was introduced. Mutagenic primers used for the construction of four mutant CREB (K303Q, L311A/L318A, S133A, and DIEDML) vectors were 5'-GAGTGTCGTAGACAGAAGAAAGAATATGTG, 5'-GAATATGTGAAATGTGCAGAAAACAGAGTGGCAGTGGCTGAAAATCAAAATCAAAAC, 5'-GGGAAATTCTTTCAAGGAGGCCTGCCTACAGGAAAATTTTGAATGAC, and 5'-CGAAGGGAAATTCTTTCAGATATCGAGGATATGCTGAAAATTTTGAATGAC, respectively.

To express CREB protein in Escherichia coli, a EcoRI/HindIII fragment of pM-CREB(F) was ligated into the EcoRI/HindIII site of a GST fusion vector, pGEX-6P1, and the resultant plasmid was named pGEX-CREB. A bacterial strain BL21 (codon plus) (Stratagene, La Jolla, CA) was transformed by pGEX-CREB, and the expressed CREB was purified as described before with some modifications (19).

The following reagents were obtained from commercial sources: forskolin, fetal calf serum, dithiothreitol (DTT), and phenylmethylsulfonyl fluoride from Sigma; geneticin and trypsin-EDTA from Invitrogen; anti-phospho-Ser133 CREB IgG and anti-CREB IgG for Western blotting from New England Biolabs (Beverly, NJ); anti-CREB IgG for immunoprecipitation from Rockland Inc. (Gilbertsville, PA); and ACTH (Cortrosyn) from Daiichi Seiyaku Co. (Tokyo, Japan).

Cell Culture and Reporter Assay-- Y1 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal calf serum and antibiotics at 37 °C under an atmosphere of 5% CO2-95% air. The method for the reporter assay was described previously (19). To introduce DNAs into Y1 cells, LipofectAMINE 2000 (Invitrogen) was used in this study.

Electrophoretic Mobility Shift Analyses-- Nuclear extracts were prepared as described previously (34). The following oligonucleotides were used as probes: CRE-like element of the human CYP11A promoter, CYP11A CRE (5'-gTTGGCTGATGTCATTCCA/5'-gTGGAATGACATCAGCCAA) (21); a mutated CRE, CYP11A mCRE (5'-gTTGGCTCTAGACATTCCA/5'-gTGGAATGTCTAGAGCCAA); and a CRE of the human alpha CG promoter, alpha CG CRE (5'-gCAAATTGACGTCATGGTAA/5'-gTTACCATGACGTCAATTTG) (35). The CYP11A CRE was 3'-end-labeled with [alpha -32P]dCTP using Klenow fragment in the presence of cold dATP, dTTP, and dGTP. For each binding assay, the unlabeled competitor oligonucleotide (50-fold excess), anti-CREB IgG (6 µl), or anti-SIK IgG (6 µl) was mixed with 10 µg of nuclear extracts in 20 µl of binding buffer composed of 10 mM HEPES (pH 7.5), 16 mM KCl, 0.5 mM MgCl2, 1 mM DTT, 0.4 mM EDTA, and 1 µg of poly(dI-dC)-poly(dI-dC). The radiolabeled duplex oligonucleotide (50,000 cpm) was added to the mixture, and the reaction mixture was incubated at room temperature for 15 min. The samples were immediately subjected to SDS-PAGE in 5% polyacrylamide gels, and autoradiography was performed by using an intensifying screen.

Immunoprecipitation and Immunoblot Analysis-- These analytical methods were described previously (19). Lysis buffer (50 mM Tris-HCl (pH 8.0), 5 mM EDTA, 5 mM EGTA, 2 mM DTT, 50 mM glycerol 3-phosphate, 50 mM NaF, 1 mM NaVO4, 0.5% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 14 µg/ml aprotinin) and 3 × SDS sample buffer (150 mM Tris-HCl (pH 6.8), 6% SDS, 30% glycerol, and 0.1% bromphenol blue) were used in this study.

In Vivo Phosphorylation of CREB-- Y1 cells (5 × 105 in a 25-cm2 flask) were incubated with 0.1 mCi (3.7 MBq) of 32PO4 in a phosphate-free medium for 2 h, and then the cells were treated with or without 10-6 M ACTH for 15 min, washed with 1 ml of PBS, and lysed in 900 µl of lysis buffer containing 300 mM NaCl. The cell lysates were preincubated with 100 µl of protein A-Sepharose (Amersham Biosciences) for 1 h to eliminate the nonspecific binding. The soluble fractions were separated by centrifugation at 12,000 rpm for 10 min and incubated with 10 µl of anti-CREB IgG and 30 µl of protein A-Sepharose for 2 h. After washing the Sepharose beads with 1 ml of lysis buffer four times, proteins bound to IgG-protein A-Sepharose complex were solubilized with 30 µl of 3× SDS sample buffer, separated in 15% polyacrylamide gels, and visualized by an autoradiography. Similar experiments were performed for the nonradiolabeled cells to examine total CREB protein level by Western blotting.

In Vitro Kinase Assay-- The catalytic subunit of PKA from bovine heart was purchased from Sigma. GST-SIK(N), GST-SIK(N)K56M and GST-Syntide2 were described previously (19). PKA (0.5 units) was mixed with 1.0 µCi (37 kBq) of [gamma -32P]ATP and substrates (0.1 µg of CREB, GST-SIK(N)K56M, or GST-Syntide2) in 20 µl of PKA reaction buffer (50 mM Tris-HCl (pH 7.4), 1 mM DTT, and 5 mM MgCl2). Reactions were performed at 25 °C for 20 min and stopped by the addition of 10 µl of 3× SDS sample buffer. The reaction mixture was boiled for 5 min, and proteins in 10-µl aliquots were subjected to SDS-PAGE in 15% gel. The gel was dried and exposed to an x-ray film at room temperature for 1 h. To examine the kinase activity of HA-SIK, 30 µl of the samples were mixed with 10 µl of SIK reaction buffer (50 mM Tris-HCl (pH 7.4), 1 mM DTT, and 10 mM MnCl2) containing 20 µg of GST-Syntide2 and 1.0 µCi (37 kBq) of [gamma -32P]ATP, and the mixture was incubated at 30 °C for 1 h. After the addition of 15 µl of 3× SDS sample buffer, the reaction mixture was heated at 100 °C for 5 min, and an aliquot (10 µl) was subjected to SDS-PAGE followed by autoradiography as described previously (19).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

SIK Represses PKA-induced CYP11A Promoter Activity by Acting on CRE-- To identify an element(s) in the CYP11A promoter region that may serve as the target of the SIK's repressive effect, the 2.3-kb promoter fragment and its truncated derivatives were linked to the luciferase reporter gene. The respective promoter-reporter constructs were introduced into Y1 cells together with PKA expression and/or SIK expression vectors. Because the N-terminal 343-amino acid peptide, the kinase portion, of SIK, SIK(N), produced more prominent repression than the full-length SIK in the cotransfection assays (19), SIK(N) was used for the coexpression experiments. When the 2.3- or 1.8-kb fragment-linked reporter gene was expressed in the cells, the coexpression of PKA elevated the reporter activity by about 3-4-fold. This PKA-dependent elevation was completely abrogated by coexpressing SIK(N) (Fig. 1). In contrast, the 1.5-kb fragment's promoter activity was elevated by only 20% by the addition of PKA, and this PKA-dependently elevated activity was little affected by the coexpression of SIK(N). These results not only confirmed the previous report that the -1.8 to -1.5 kb region contained the cAMP-responsive enhancer composed of a CRE-like element and an Ad4 (SF-1) element (20, 21, 23) but also suggested that the region might also contain the major target site of the SIK's repressive effect. (It has been noted that the coexpression of SIK(N) alone seemed to produce about 20-30% inhibition in the basal promoter activity, but this issue will be further investigated elsewhere.)


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 1.   A region -1.8 to -1.5 kb (k) of the human CYP11A promoter is important for PKA-mediated transcription as well as its repression by SIK. Y1 cells, cultured at 1 × 105/well in 12-well plates for 48 h, were transformed with 0.25 µg of reporter constructs containing the -2.3, -1.8, and -1.5 kb human CYP11A promoters or pGL3. SIK expression vectors (pIRES(HA)-SIK(N) or pIRES(HA)) (0.25 µg), PKA expression vectors (pIRES-PKAc or pIRES) (0.1 µg), and pRL-SV40 internal control (0.03 µg) were cotransfected as indicated. After the 12-h incubation, cells were harvested, and homogenates were measured for luciferase activities in the Dual-Luciferase Reporter Assay System. Transformation efficiencies were corrected by Renilla luciferase activities. The specific promoter activities of CYP11A were expressed as -fold expression of the reporter activity of the empty vector pGL3. Means from duplicate experiments are shown.

To determine precisely which element within the enhancer is important for the SIK-mediated repression of promoter activity, three chimeric luciferase reporter genes, each of which had three tandemly repeated promoter sequences of the enhancer, CRE-like element, or Ad4 (SF-1) element, respectively, were constructed (Fig. 2A). The reporter gene containing the enhancers or CRE-like elements was clearly activated by PKA. And the PKA-dependently elevated reporter activity was completely abrogated by the coexpression of SIK(N). The reporter gene containing the Ad4 (SF-1) elements, however, was not influenced by the coexpression of PKA, SIK(N), or PKA and SIK(N) together. These results suggested that the CRE-like sequence in the enhancer might be the major target site upon which SIK exerted its repressive effect.


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 2.   CRE is responsible for the SIK-mediated repression. A, pTAL luciferase vectors having three copies each of the cAMP-responsive region (pTAL-3· hCYP11A cAMP), the CRE-like element (pTAL-3× hCYP11A CRE), and Ad4 (pTAL-3× hCYP11A Ad4) were used as reporters. Transformation and luciferase assay were performed as described in the legend to Fig. 1. TATA indicates a TATA box of the thymidine kinase promoter. B, the CRE-like element TGATGTCA in the -2.3 kb CYP11A promoter was mutated to TctagaCA. Twelve hours after transformation, Y1 cells were treated with or without 50 µM forskolin for 12 h, and the cell homogenates were measured for luciferase activities. Means and S.E. from triplicate experiments are shown. WT, wild type.

To further confirm the above point, the CRE-like element in the 2.3-kb fragment was mutated, and the promoter activity of the mutated fragment was compared with that of the wild-type fragment (Fig. 2B). The addition of forskolin activated the wild-type promoter by about 2-fold, and this activation was completely abrogated by the coexpression of SIK(N). On the other hand, the extent of activation by forskolin of the mutated promoter was only 20%, and this slight activation was not significantly affected by the coexpression of SIK(N). These results supported the notion that SIK might repress the ACTH/cAMP/PKA-induced CYP11A promoter activity by acting on the CRE-like element, the same element that was responsible for the transcriptional activation.

CREB Is a Major Factor That Binds to the CRE in CYP11A Promoter-- To gain further insight into the target site of PKA's, as well as SIK's, action, nuclear factors that possibly bound to the CRE-like element during the transcriptional activation of the CYP11A gene were characterized. To do that, a radiolabeled oligonucleotide containing the CRE-like sequence was mixed with nuclear extracts prepared from Y1 cells or SIK-overexpressing Y1 cells, and electrophoretic mobility shift analyses were performed. Several radioactive bands appeared in the lanes of both Y1 extracts and SIK-overexpressing Y1 extracts, indicating the complex formation between the nuclear proteins and the oligonucleotide (Fig. 3A). The addition of a nonradiolabeled self-oligonucleotide or a human chorionic gonadotropin gene-derived CRE completely inhibited the complex formation, but the addition of a mutated CYP11A-CRE did not. It should be noted that the pattern of radioactive bands produced from the Y1 extracts was similar to that from the SIK-overexpressing Y1 extracts. Because we have evidence that SIK protein was present both in the nucleus and in the cytosol of Y1 cells,2 these results suggest that the presence of SIK protein in the nuclear extracts could not influence the DNA-protein complex formation.


View larger version (65K):
[in this window]
[in a new window]
  		Fig. 3.   CREB is the major factor that binds to the CRE-like element. A, 32P-labeled CRE-like element probe (gTTGGCTGATGTCATTCCA) (5 × 104 cpm) was incubated with or without (-) 10 µg of nuclear extracts prepared from normal Y1 cells (Y) or SIK-overexpressing Y1 cells (S), and then the incubation mixtures were subjected to electrophoretic mobility shift analyses as described under "Experimental Procedures." For competition assays, a 50-fold excess of an unlabeled oligonucleotide, CYP11A CRE, mutant CRE CYP11A mCRE, or a alpha CG CRE was added to the reaction mixture. B, supershift analysis of nuclear factors. Anti-CREB IgG or anti-SIK IgG was added to the incubation mixture of the nuclear extracts and the radiolabeled probe. The IgG-CREB-DNA complexes were indicated by an arrow, CREB (shifted). C, nuclear extracts were prepared from Y1 and SIK(N)-overexpressing Y1 cells that had been treated without (-) or with 10-6 M ACTH for 1 h (+) and subjected to the electrophoretic mobility shift analysis. Ab, antibody.

Based on the above results and the previous reports (36-39), we surmised that the major nuclear factor involved in the DNA-protein complex formation might be CREB. To confirm this, an antibody against CREB was added to the incubation mixtures, and the mixtures were analyzed by electrophoresis. As shown in Fig. 3B, the presence of the antibody shifted the major band of DNA-protein complex to the upper position. Again, no difference was seen between the Y1 and the SIK-overexpressing Y1 extracts. On the other hand, the addition of an antibody against SIK protein little influenced the positions of DNA-protein complexes. Next, nuclear extracts were prepared from the cells that had been treated with, or without, ACTH. The electrophoretic mobility shift pattern of the extracts from ACTH-treated cells resembled that from the control cells, and no difference was seen between the Y1 and the SIK-overexpressing Y1 extracts (Fig. 3C). Taken together, these results indicate that CREB may be the major nuclear factor in Y1 cells that binds to the CRE-like element in the CYP11A promoter, and SIK may not directly interact with the CRE·CREB complex.

Phosphorylation Level of CREB-- CREB-mediated transcription is regulated by PKA-dependent phosphorylation of Ser133 in the KID domain of CREB (40). The question was asked whether or not SIK could phosphorylate CREB and influence its transcriptional activity. GST-SIK(N) was incubated with a recombinant CREB expressed in E. coli or GST-Syntide2, a SIK synthetic peptide substrate, in the presence of [gamma -32P]ATP. As shown in Fig. 4A, the results of autoradiographic as well as immunoblot analyses of the incubation mixture indicated that GST-SIK(N) could not phosphorylate CREB, although the same dose of GST-SIK(N) could well phosphorylate GST-Syntide2. On the other hand, in the incubation mixture of PKA with CREB the Ser133-phosphorylated CREB was detected as expected. Although GST-Syntide2 does not have the consensus phosphorylation motif for PKA, the peptide appeared to be a good substrate of PKA.


View larger version (49K):
[in this window]
[in a new window]
  		Fig. 4.   SIK does not phosphorylate CREB. A, CREB (0.1 µg) was incubated with 1.0 µCi of [gamma -32P]ATP in the absence (-) or presence of PKA (0.5 units) or GST-SIK(N) (0.1 µg) at 25 °C for 20 min. The reaction was stopped by the addition of 3× SDS sample buffer. Phosphorylated CREB (pCREB) was separated by SDS-PAGE in 15% gel and visualized on an x-ray film (upper panel). Similar experiments were conducted by using cold ATP (1 mM). After electrophoresis, the proteins were transferred onto a polyvinylidene difluoride membrane, and CREB was detected with anti-phospho-Ser133 CREB (pCREB(pS133)) IgG or anti-CREB (CREB) IgG (middle panel). GST-Syntide2 (1.0 µg) was used as a substrate for the phosphorylation reactions (bottom panel). B, Y1 cells (Y) and SIK-overexpressing Y1 cells (S) (5 × 105 in a 25-cm2 flask), preincubated with 32PO4 in the phosphate-free medium for 2 h, were treated with (+) or without (-) 10-6 M ACTH for 15 min. The cell lysates were immunoprecipitated using anti-CREB antibody (alpha CREB). Phosphoproteins and total CREB were visualized by autoradiography (upper panel) and Western blotting (lower panel), respectively. C, levels of phospho-Ser133 CREB in the ACTH-treated Y1 or SIK(N)-overexpressing Y1 cells were examined. The cells, cultured at 5 × 105/well in six-well plates for 24 h, were treated with 10-6 M ACTH for the indicated periods. The cells were lysed with 100 µl of SDS sample buffer, and the lysates (15 µl) were subjected to SDS-PAGE followed by immunoblot analyses using anti-phospho-Ser133 CREB IgG or anti-CREB IgG. CREB, phospho-CREB, and phospho-ATF-1 are indicated by arrows. M, size marker (47.5 and 32.5 kDa). The experiments were conducted in duplicate, and one of the results is shown. IP, immunoprecipitation; WB, Western blot.

Next, CREB's phosphorylation levels in the normal, or ACTH-stimulated, Y1 cells and SIK-overexpressing Y1 cells were examined (Fig. 4B). Y1 cells prelabeled with 32PO4 were incubated with ACTH for 15 min, and then CREB in the cell lysates was analyzed after the immnoprecipitation. A radiolabeled 42-kDa protein (pCREB) was specifically precipitated by anti-CREB antibody, and its radioactivity was elevated by the ACTH treatment. The levels of phosphorylation of pCREB in the SIK-overexpressing Y1 cells were apparently the same as those in the normal Y1 cells. It should be mentioned here that during the immunoprecipitation experiments we could detect no evidence suggesting direct interaction between SIK and CREB.

Last, by using anti-phospho-CREB antibody, the extents of Ser133 phosphorylation in the ACTH-treated Y1 cells and SIK-overexpressing Y1 cells were examined (Fig. 4C). The antibody used in this experiment could also detect the phosphorylated form of CREB-related transcriptional factor ATF-1. In the ACTH-treated Y1 cells, the levels of phospho-CREB and phospho-ATF-1 elevated within 7.5 min, remained at the maximal levels for 30 min, and then gradually declined. A similar change in levels of phosphorylated transcription factors was seen in the ACTH-treated SIK-overexpressing Y1 cells. These results suggest that SIK may not influence the level of phosphorylation of CREB during the ACTH-mediated signal transduction.

bZIP Domain of CREB Is Essential for the Transcriptional Repression by SIK-- To further explore how SIK exerts its repressive effect on the CREB-mediated transcriptional activation, we designed experiments in which the transcriptional activity of mutated CREBs could be evaluated. Thus, a chimeric transcription factor GAL4DB-linked CREB and a 5×Gal4-linked luciferase reporter were expressed in Y1 cells, and the CREB's transcriptional activity was tested in the presence or absence of PKA and SIK(N). When a GAL4DB/full-length CREB vector pM-CREB(F) was introduced into Y1 cells, the reporter activity was elevated by about 2.5-fold by the addition of PKA, with the activation being repressed by the coexpression of SIK(N) (Fig. 5A). The coexpression of SIK(N)K56M, a kinase activity-disrupted SIK, could not repress the pM-CREB(F) activation (Fig. 5B). In contrast, when a GAL4DB/bZIP-less CREB vector pM-CREB(S) was tested, the PKA-dependent activation was about 1.8-fold, with the activation not being repressed by the coexpression of SIK(N). When the CREBs having GAL4DB at the C-terminal sides were tested (Fig. 5C), the bZIP-less CREB also was not repressed by SIK(N). These results suggest that the bZIP domain of CREB appears to be important for SIK to exert its repressive effect on the CREB-mediated transcriptional activation. To confirm this, several mutations were introduced in the leucine zipper and basic region of CREB, and the mutated CREBs were tested for their transcriptional activities under similar experimental conditions (Fig. 6). Whereas the mutated CREBs, such as L311A/L318A-CREB and K303Q-CREB, could well activate reporter gene expression in response to the addition of PKA, the PKA-dependent activation of L311A/L318A-CREB was not repressed, and that of K303Q-CREB was repressed a little by SIK(N). Thus, it seemed that an intact bZIP domain structure was required for SIK's repressive effect on the CREB-mediated transcriptional activation.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 5.   bZIP domain of CREB is important for SIK's action. A, the transactivation activity of CREB was examined by using Gal4 DNA binding domain-linked CREBs. Y1 cells (1 × 105/well) were transformed with 0.15 µg of Gal4 DNA binding domain-linked CREB expression vectors (full-length CREB (pM-CREB(F)), bZIP-less CREB (pM-CREB (S)), or empty vector (pM)). SIK(N) expression vectors (0.15 µg) and PKA expression vector (0.1 µg) were used for cotransfection, as indicated. Gal4-linked luciferase reporter pTAL-5× GAL-4 (0.15 µg) and pRL-SV40 (internal control, 0.03 µg) were used as the reporters. Luciferase activities were measured by the Dual-Luciferase Reporter Assay System. The specific transcriptional activities of CREB were expressed as -fold expression of the empty Gal4 vector, pM. B, kinase-defective SIK, SIK(N)K56M, was used for the Gal4-based CREB activation assay. C, the Gal4 DB was linked at the C terminus of full-length CREB (CREB(F)-pM) or bZIP-less CREB (CREB(S)-pM).


View larger version (46K):
[in this window]
[in a new window]
  		Fig. 6.   bZIP domain of CREB is a target of SIK's action. Mutations (K303Q or L311A/L318A) were introduced in the bZIP domain of Gal4-CREB(F). Transformation and luciferase assay were performed as described above. Means and S.E. from triplicate experiments are shown. WT, wild type.

Mutation of KID Domain of CREB Does Not Affect SIK's Repressive Effect-- Next, the roles played by the KID domain of CREB in the PKA-mediated transcriptional activation as well as its repression by SIK were examined. The PKA-dependent phosphorylation of Ser133 is essential for the transcriptional activation. Therefore, when the transcriptional activity of S133A-CREB, the dominant negative CREB, was tested, the coexpression of PKA little increased the reporter activity (Fig. 7). Unexpectedly, however, the coexpression of both SIK(N) and PKA in this system lowered the level of reporter gene expression substantially, the level being even lower than that in the presence of SIK(N) alone.


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 7.   Mutations in KID domain of CREB do not affect SIK's action. Gal4 DNA binding domain was linked to dominant negative CREB (S133A) or constitutively active CREB (DIEDML). Transformation and luciferase assay were performed as described in the legend to Fig. 5. Means and S.E. from triplicate experiments are shown. WT, wild type.

A constitutively active CREB was constructed in which a six-amino acid peptide around Ser133, RRPSYR, which is required for binding to CBP after the serine phosphorylation (41), was replaced by a peptide DIEDML, the peptide in a CBP/p300-binding region of SREBP-1a (42). When the constitutively active CREB was tested for the chimeric CREB-dependent reporter assays, the basal level of reporter activity was about 2 times as high as the wild-type CREB, and the level was further elevated by the coexpression of PKA, in good agreement with the previous report (42). It should be noted, however, that the coexpression of both SIK(N) and PKA again significantly lowered the reporter activity than the coexpression of SIK(N) alone. These results suggest that in order for SIK to exert its repressive effect on the CRE/CREB-dependent transcription activity, PKA must be present in the system although CREB's PKA-dependent phosphorylation site was disrupted.

The possibility was considered that PKA might phosphorylate SIK(N) and affect the SIK's enzyme, as well as protein, properties. Thr268 of SIK, located in a PKA phosphorylation motif, (R/K)(R/K)X(S/T), would be a candidate residue for the PKA-dependent phosphorylation (43). To design the following experimental protocol, SIK(N)K56M was used as the possible substrate of PKA lest the autophosphorylation activity of SIK(N) should disturb the interpretation of phosphorylation results (19), and GST-Syntide2 was used as a positive control substrate of PKA. The purity of the substrates used for this experiment was verified in Fig. 8A. PKA was incubated with GST-SIK(N)K56M or GST-Syntide2 in the presence of [gamma -32P]ATP, and the reaction mixture was subjected to SDS-PAGE followed by autoradiography (Fig. 8B). The results clearly showed that PKA could phosphorylate GST-Syntide2, but not GST-SIK(N)K56M, under the in vitro assay conditions.


View larger version (69K):
[in this window]
[in a new window]
  		Fig. 8.   PKA does not phosphorylate SIK(N). A, appraisal of the purity of the substrates used for PKA-dependent phosphorylation. GST fusion proteins were expressed in E. coli, and 5 µg each of GST, GST-Syntide2, or GST-SIK(N)K56M were separated by SDS-PAGE in 15% gel and stained with Coomassie Brilliant Blue R-250 (C.B.B.). M, size marker (175, 83, 62, 47.5, 32.5, and 25 kDa). B, PKA, 0.5 units, was incubated with 0.1 µg each of the substrates in the presence of 1.0 µCi of [gamma -32P]ATP at 25 °C for 20 min. The reaction was stopped by the addition of 3× SDS sample buffer. The radiolabeled proteins were visualized on an x-ray film after the SDS-PAGE. C, a mutation, T268A, was introduced in the kinase domain of full-length SIK. The mutant SIK plasmid pIRES(HA)-SIK(F)T268A or the wild-type SIK plasmid pIRES(HA)-SIK(F) was introduced into Y1 cells, and the cells were treated with or without ACTH (10-6 M) for 1 h. The SIKs were recovered from the cell homogenates, and their protein kinase activity was measured in the in vitro kinase assay system as given under "Experimental Procedures." The results shown are representative of triplicate experiments. D, the effect of the mutant SIK, SIK(N)T268A, on the CRE-mediated transcription activity was examined. Y1 cells (1 × 105/well) were transformed with 0.25 µg of reporter constructs (pTAL-CRE or pTAL), 0.25 µg of SIK expression vectors (pIRES(HA)-SIK(N) WT or pIRES(HA)-SIK(N)T268A), 0.1 µg of PKA expression vector pIRES-PKAc, and 0.03 µg of pRL-SV40 (internal control), as indicated. Means and S.E. from triplicate experiments are shown. IP, immunoprecipitation; WB, Western blot.

A possibility still remains that in the ACTH-stimulated Y1 cells PKA might phosphorylate Thr268 of SIK, and the phosphorylated SIK might have an altered kinase activity and regulate the gene transcription. Thus, a SIK having Ala268 in place of Thr was prepared, and the wild-type and mutated enzymes were expressed in Y1 cells as HA-tagged proteins. (The full-length SIK, which is much more stable than SIK(N) in Y1 cells (19), was used in this experiment.) The Y1 cells were incubated with or without 10-6 M ACTH for 30 min, and the HA-SIK proteins were purified from the cell homogenates. The purified enzymes were incubated with GST-Syntide2 in the presence of [gamma -32P]ATP, and the reaction mixtures were subjected to SDS-PAGE. As shown in the autoradiograms of Fig. 8C, the autophosphorylation activity and Syntide2 phosphorylation activity of the wild-type SIK were not altered in the cells under ACTH stimulation. Moreover, the kinase activities of the mutant T268A-SIK were similar to those of the wild-type SIK whether or not the cells were incubated with ACTH. Thus, the possibility that in the ACTH-stimulated Y1 cells PKA might phosphorylate Thr268 of SIK and alter SIK's kinase activity could be ruled out. That the transcriptional repression activity of SIK(N) T268A was similar to that of the wild-type SIK(N) was shown in Fig. 8D. In the CRE-luciferase reporter assay systems, when SIK(N)K56M instead of SIK(N)T268A was used, SIK-mediated transcriptional repression did not occur, as expected (data not shown). In this experiment, a commercially available CRE-luciferase reporter pTAL-CRE was used for the assays, because this reporter produced more prominent activation by PKA than the human CYP11A CRE-luciferase reporter, and the PKA-dependent activation was more completely repressed by the coexpression of SIK(N). It should be mentioned that essentially similar results were obtained with the CYP11A CRE-luciferase reporter. Taken together, these results suggest that the phosphorylation of Ser133 in the KID domain of CREB by PKA may not affect the SIK-mediated repression of transcription activation, but, for the SIK's repressive effect, the presence of PKA may be necessary without phosphorylating SIK.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The results presented herein demonstrated that SIK repressed CREB-mediated transcriptional activity mainly by acting on the CRE·CREB complex formed in the promoter region of the CYP11A gene. Although CREB might not be a SIK substrate (Fig. 4), our previous report showed that SIK's kinase activity was essential for inhibiting the forskolin-dependent transcriptional activation of the CYP11A promoter (19). A region in the CREB where SIK exerted its repressive action was examined by the assays using Gal4-based chimeric CREBs. The results suggested that the bZIP domain of CREB, not the KID domain having phosphorylation sites, was important for the SIK's action. The bZIP domain of CREB has been attributed to the domain essential for the nuclear import, DNA binding, and dimerization but not the domain directly involved in transcriptional regulation (44, 45). However, it is possible that the bZIP domain, through its regular array of leucine residues inside the coiled coil structure, interacts with a hydrophobic, sticky domain of another transcriptional regulatory protein (45-47), and SIK might phosphorylate this protein, not CREB, with the result of indirectly influencing the CREB's transcriptional activation potential.

Leucine zipper protein kinase (ZPK) (48), also called dual leucine zipper-bearing kinase (49) or mitogen-activated protein kinase upstream kinase (50), is expressed in a variety of cells, belongs to a family of mitogen-activated protein kinase kinase kinase, and has two leucine zipper-like motifs near its C terminus. Like SIK, ZPK, when overexpressed in NTera-2 human teratocarcinoma cells, inhibited the PKA-induced transcriptional activation of CREB (51). The direct binding of ZPK and CREB was demonstrated, but sites of the interaction were not identified; nor was requirement of the leucine zipper of CREB demonstrated (51). A possibility that ZPK might influence the CREB-mediated transcriptional activation in Y1 cells could be ruled out, because the overexpression of ZPK in Y1 cells did not influence the PKA-dependent activation of CYP11A promoter or CRE-Luc reporter.3 Besides, the SIK-mediated repressive effect was not influenced by the addition of ZPK (data not shown). We could therefore conclude that SIK inhibited the transcriptional activation by CREB by acting on the CREB's leucine zipper but not through the ZPK-dependent mechanisms.

The homodimeric structure of CREB is modulated by the phosphorylation of Ser142 in the KID (52). When Ser142 is phosphorylated by calmodulin kinase II (53), the CREB homodimer dissociates without affecting its DNA binding ability. Because the monomeric CREB, whether or not it is phosphorylated at Ser133, could not recruit CBP (52), the Ser142-phosphorylated CREB would act in a dominant negative fashion on the transcriptional activation by CREB. To test possible involvement of the Ser142 phosphorylation by calmodulin kinase II in the SIK's action, a Gal4-CREB mutant having Ala142 in place of Ser was prepared. The PKA-induced transcriptional activation through the S142A-CREB in Y1 cells was repressed by the coexpression of SIK to a similar extent as in the case using the wild-type CREB (data not shown). Therefore, the possibility that the calmodulin kinase II-mediated phosphorylation of Ser142 may somehow be involved in SIK's action in Y1 cells could be ruled out.

S6 kinase pp90RSK (54, 55) and Tat interactive protein of 60 kDa (Tip60) (56) have been reported to modulate CREB's function. The activated pp90RSK, in growth factor-treated PC12 cells, formed a stable complex with CBP and inhibited PKA-activated transcriptional activity of CREB. In this case the kinase activity of pp90RSK was not necessary for the inhibition phenomenon (57). Tip60, a cellular protein bound to human iummunodeficiency virus-1 Tat protein, has histone acetyltransferase activity (56). Tip60 directly bound to CREB and inhibited PKA-induced transcriptional activation through the histone acetyltransferase activity-independent mechanism (58). Since both of these inhibitions were demonstrated in the Gal4-bZIP-less CREB systems, these enzymes possibly modulated the function of CREB by acting on its N-terminal transactivating domain. Therefore, the mechanisms of transcriptional modulation by these two enzymes might differ from those underlying the SIK-mediated transcriptional repression.

The transcription regulatory function of the KID domain-mutated, dominant negative, and constitutively active CREBs should be irrelevant to the presence of PKA in the system. Therefore, it was completely unexpected to find that the transcription mediated by these CREBs was substantially repressed by the presence of both SIK and PKA (Fig. 7). Considering the fact that PKA could not phosphorylate SIK(N) (Fig. 8) and SIK(N) could not phosphorylate CREB (Fig. 4), we at least conclude here that in order for SIK to exert its repressive effect on the CRE/CREB-dependent transcriptional activity, PKA must be present in the system although it would not phosphorylate CREB or SIK. In addition to CREB, another signal transducer, which is an endogenous substrate of PKA or SIK, might be involved in the PKA- and SIK-dependent transcriptional regulation. With respect to the basal transcriptional activity of CREB, the constitutively active domain (CAD) of CREB, corresponding to a glutamine-rich region (Q2), can efficiently recruit a RNA polymerase complex and activate the transcription (59-62). In response to cAMP, however, the CAD acts synergistically with the phosphorylated KID and activates the KID-dependent transcription (32, 63). Given this information, the possibility that SIK might disrupt the cooperative action between the KID and CAD is currently under investigation at our laboratory.

Several nuclear factors, including CREB, CREM, and ATFs, bind to the CRE and, after being phosphorylated by PKA, activate gene expression (24-27). Although CREB was identified here as the major factor in Y1 nuclear extracts that bound to the CRE-like element, it should be noted that significant amounts of non-CREB factors were recognized by the CRE-like element probe in the electrophoretic mobility shift assays (Fig. 3). In CREB-deficient human adrenocortical H295R cells, ATF-1 and CREM are known to act as factors that bind to the CRE and activate the transcription (64). SIK in fact could repress the CRE-mediated transcription in H295R cells in a similar mode as in the case of Y1 cells (data not shown). Given these facts, SIK might be involved in regulating not only the function of CREB but also those of the other CREB-related nuclear factors.

Fig. 9 illustrates our current model to understand the SIK's role in the regulation of the early phase of CREB-mediated steroidogenic gene transcription. After the ACTH stimulation of adrenocortical cells, PKA, activated through ACTH/cAMP signaling, would phosphorylate Ser133 of CREB and stimulate transcription of a CRE-containing gene, such as the CYP11A gene. However, the SIK protein, having been synthesized by ACTH/cAMP signaling (19), would repress the CRE-mediated transcription via the bZIP domain of CREB in a PKA-dependent manner. As a result, the transcription of the CYP11A gene would be suppressed until the level of SIK protein begins to decline (19).


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 9.   Model of SIK-mediated repression of ACTH/PKA-induced activation of CREB in Y1 cells. ACTH-R, ACTH receptor; G, G-protein; AC, adenylate cyclase.


    ACKNOWLEDGEMENTS

We thank Dr. Ken-ichirou Morohashi (National Institute for Basic Biology, Okazaki, Japan) for providing us with pS2.3H Luc/3×[S-RR]SV-CAT plasmids and Y1 cells. We are also grateful to Dr. Shigeo Ohno (Yokohama City University School of Medicine, Yokohama, Japan) for sending us mitogen-activated protein kinase upstream kinase expression vector.

    FOOTNOTES

* This work was supported in part by grants-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology and the Ministry of Health, Labor and Welfare Japan and a grant from the Uehara Memorial Foundation.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

These authors contributed equally to this work.

|| To whom correspondence should be addressed: Dept. of Molecular Physiological Chemistry, Osaka University Medical School H-1, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan. Tel.: 81-6-6879-3280; Fax: 81-6-6879-3289; E-mail: mokamoto@mr-mbio.med.osaka-u.ac.jp.

Published, JBC Papers in Press, February 25, 2002, DOI 10.1074/jbc.M109365200

2 H. Takemori, Y. Katoh, J. Doi, N. Horike, X. Lin, and M. Okamoto, manuscript in preparation.

3 J. Doi, H. Takemori, X. Lin, N. Horike, Y. Katoh, and M. Okamoto, our unpublished results.

    ABBREVIATIONS

The abbreviations used are: ACTH, adrenocorticotropic hormone; PKA, cAMP-dependent protein kinase; CYP11A, cholesterol side chain cleavage cytochrome P450; SIK, salt-inducible kinase; CRE, cAMP-response element; bZIP, basic leucine zipper; CREB, CRE-binding protein; CREM, CRE modulator; ATF, activating transcription factor; KID, kinase-inducible domain; CBP, CREB-binding protein; DTT, dithiothreitol; ZPK, leucine-zipper kinase; Tip60, Tat interactive protein of 60 kDa; GST, glutathione S-transferase; HA, hemagglutinin; GAL4DB, Gal4 DNA binding domain.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kramer, R. E., Rainey, W. E., Funkenstein, B., Dee, A., Simpson, E. R., and Waterman, M. R. (1984) J. Biol. Chem. 259, 707-713[Abstract/Free Full Text]
2. Olson, M. F., Krolczyk, A. J., Gorman, K. B., Steinberg, R. A., and Schimmer, B. P. (1993) Mol. Endocrinol. 7, 477-487[Abstract/Free Full Text]
3. Clark, B. J., Wells, J., King, S. R., and Stocco, D. M. (1994) J. Biol. Chem. 269, 28314-28322[Abstract/Free Full Text]
4. Ariyoshi, N., Kim, Y. C., Artemenko, I., Bhattacharyya, K. K., and Jefcoate, C. R. (1998) J. Biol. Chem. 273, 7610-7619[Abstract/Free Full Text]
5. Stocco, D. M. (2000) Biochim. Biophys. Acta 1486, 184-197[Medline] [Order article via Infotrieve]
6. Rice, D. A., Kirkman, M. S., Aitken, L. D., Mouw, A. R., Schimmer, B. P., and Parker, K. L. (1990) J. Biol. Chem. 265, 11713-11720[Abstract/Free Full Text]
7. Ahlgren, R., Simpson, E. R., Waterman, M. R., and Lund, J. (1990) J. Biol. Chem. 265, 3313-3319[Abstract/Free Full Text]
8. Morohashi, K., Zanger, U. M., Honda, S., Hara, M., Waterman, M. R., and Omura, T. (1993) Mol. Endocrinol. 7, 1196-1204[Abstract/Free Full Text]
9. White, P. C., New, M. I., and Dupont, B. (1987) N. Engl. J. Med. 316, 1519-1524[Medline] [Order article via Infotrieve]
10. Miller, W. L. (1988) Endocr. Rev. 9, 295-318[Abstract/Free Full Text]
11. Kramer, R. E., Simpson, E. R., and Waterman, M. R. (1983) Steroids 41, 207-223[CrossRef][Medline] [Order article via Infotrieve]
12. John, M. E., Simpson, E. R., Waterman, M. R., and Mason, J. I. (1986) Mol. Cell. Endocrinol. 45, 197-204[CrossRef][Medline] [Order article via Infotrieve]
13. Bird, I. M., Mason, J. I., and Rainey, W. E. (1998) J. Clin. Endocrinol. Metab. 83, 1592-1597[Abstract/Free Full Text]
14. Wang, Z., Takemori, H., Halder, S. K., Nonaka, Y., and Okamoto, M. (1999) FEBS Lett. 453, 135-139[CrossRef][Medline] [Order article via Infotrieve]
15. Corton, J. M., Gillespie, J. G., and Hardie, D. G. (1994) Curr. Biol. 4, 315-324[CrossRef][Medline] [Order article via Infotrieve]
16. Hardie, D. G., Carling, D., and Carlson, M. (1998) Annu. Rev. Biochem. 67, 821-855[CrossRef][Medline] [Order article via Infotrieve]
17. Lefebvre, D. L., Bai, Y., Shahmolky, N., Sharma, M., Poon, R., Drucker, D. J., and Rosen, C. F. (2001) Biochem. J. 355, 297-305[CrossRef][Medline] [Order article via Infotrieve]
18. Kim, J., Yoon, M. Y., Choi, S. L., Kang, I., Kim, S. S., Kim, Y. S., Choi, Y. K., and Ha, J. (2001) J. Biol. Chem. 276, 19102-19110[Abstract/Free Full Text]
19. Lin, X., Takemori, H., Katoh, Y., Doi, J., Horike, N., Makino, A., Nonaka, Y., and Okamoto, M. (2001) Mol. Endocrinol. 15, 1264-1276[Abstract/Free Full Text]
20. Inoue, H., Watanabe, N., Higashi, Y., and Fujii-Kuriyama, Y. (1991) Eur. J. Biochem. 195, 563-569[Medline] [Order article via Infotrieve]
21. Takayama, K., Morohashi, K., Honda, S., Hara, N., and Omura, T. (1994) J. Biochem. (Tokyo) 116, 193-203[Abstract/Free Full Text]
22. Guo, I. C., Tsai, H. M., and Chung, B. C. (1994) J. Biol. Chem. 269, 6362-6369[Abstract/Free Full Text]
23. Hu, M. C., Hsu, N. C., Pai, C. I., Wang, C. K., and Chung, B. (2001) Mol. Endocrinol. 15, 812-818[Abstract/Free Full Text]
24. Andrisani, O. M. (1999) Crit. Rev. Eukaryotic Gene Expression 9, 19-32[Medline] [Order article via Infotrieve]
25. Shaywitz, A. J., and Greenberg, M. E. (1999) Annu. Rev. Biochem. 68, 821-861[CrossRef][Medline] [Order article via Infotrieve]
26. De Cesare, D., and Sassone-Corsi, P. (2000) Prog. Nucleic Acids Res. Mol. Biol. 64, 343-369[Medline] [Order article via Infotrieve]
27. Mayr, B., and Montminy, M. (2001) Nat. Rev. Mol. Cell. Biol. 2, 599-609[CrossRef][Medline] [Order article via Infotrieve]
28. Hoeffler, J. P., Meyer, T. E., Yun, Y., Jameson, J. L., and Habener, J. F. (1988) Science 242, 1430-1433[Abstract/Free Full Text]
29. Foulkes, N. S., Borrelli, E., and Sassone-Corsi, P. (1991) Cell 64, 739-749[CrossRef][Medline] [Order article via Infotrieve]
30. Hai, T. W., Liu, F., Coukos, W. J., and Green, M. R. (1989) Genes Dev. 3, 2083-2090[Abstract/Free Full Text]
31. Liu, F., and Green, M. R. (1990) Cell 61, 1217-1224[CrossRef][Medline] [Order article via Infotrieve]
32. Brindle, P., Linke, S., and Montminy, M. (1993) Nature 364, 821-824[CrossRef][Medline] [Order article via Infotrieve]
33. Shaywitz, A. J., Dove, S. L., Kornhauser, J. M., Hochschild, A., and Greenberg, M. E. (2000) Mol. Cell. Biol. 20, 9409-9422[Abstract/Free Full Text]
34. Takemori, H., Doi, J., Katoh, Y., Halder, S. K., Lin, X. Z., Horike, N., Hatano, O., and Okamoto, M. (2001) Eur. J. Biochem. 268, 205-217[Medline] [Order article via Infotrieve]
35. Delegeane, A. M., Ferland, L. H., and Mellon, P. L. (1987) Mol. Cell. Biol. 7, 3994-4002[Abstract/Free Full Text]
36. Watanabe, N., Inoue, H., and Fujii Kuriyama, Y. (1994) Eur. J. Biochem. 222, 825-834[Medline] [Order article via Infotrieve]
37. Chung, B. C., Guo, I. C., and Chou, S. J. (1997) Steroids 62, 37-42[CrossRef][Medline] [Order article via Infotrieve]
38. Chen, C., and Guo, I. C. (2000) Life Sci. 67, 2045-2049[CrossRef][Medline] [Order article via Infotrieve]
39. Bassett, M. H., Zhang, Y., White, P. C., and Rainey, W. E. (2000) Endocr. Res. 26, 941-951[Medline] [Order article via Infotrieve]
40. Gonzalez, G. A., and Montminy, M. R. (1989) Cell 59, 675-680[CrossRef][Medline] [Order article via Infotrieve]
41. Parker, D., Ferreri, K., Nakajima, T., LaMorte, V. J., Evans, R., Koerber, S. C., Hoeger, C., and Montminy, M. R. (1996) Mol. Cell. Biol. 16, 694-703[Abstract]
42. Cardinaux, J. R., Notis, J. C., Zhang, Q., Vo, N., Craig, J. C., Fass, D. M., Brennan, R. G., and Goodman, R. H. (2000) Mol. Cell. Biol. 20, 1546-1552[Abstract/Free Full Text]
43. Pearson, R. B., and Kemp, B. E. (1991) Methods Enzymol. 200, 62-81[Medline] [Order article via Infotrieve]
44. Dwarki, V. J., Montminy, M., and Verma, I. M. (1990) EMBO J. 9, 225-232[Medline] [Order article via Infotrieve]
45. Schumacher, M. A., Goodman, R. H., and Brennan, R. G. (2000) J. Biol. Chem. 275, 35242-35247[Abstract/Free Full Text]
46. Fass, D. M., Craig, J. C., Impey, S., and Goodman, R. H. (2001) J. Biol. Chem. 276, 2992-2997[Abstract/Free Full Text]
47. Hong, S., Park, S. J., Kong, H. J., Shuman, J. D., and Cheong, J. (2001) J. Biol. Chem. 276, 28098-28105[Abstract/Free Full Text]
48. Reddy, U. R., and Pleasure, D. (1994) Biochem. Biophys. Res. Commun. 202, 613-620[CrossRef][Medline] [Order article via Infotrieve]
49. Holzman, L. B., Merritt, S. E., and Fan, G. (1994) J. Biol. Chem. 269, 30808-30817[Abstract/Free Full Text]
50. Hirai, S., Izawa, M., Osada, S., Spyrou, G., and Ohno, S. (1996) Oncogene 12, 641-650[Medline] [Order article via Infotrieve]
51. Reddy, U. R., Basu, A., Bannerman, P., Ikegaki, N., Reddy, C. D., and Pleasure, D. (1999) Oncogene 18, 4474-4484[CrossRef][Medline] [Order article via Infotrieve]
52. Wu, X., and McMurray, C. T. (2001) J. Biol. Chem. 276, 1735-1741[Abstract/Free Full Text]
53. Shimomura, A., Ogawa, Y., Kitani, T., Fujisawa, H., and Hagiwara, M. (1996) J. Biol. Chem. 271, 17957-17960[Abstract/Free Full Text]
54. Sturgill, T. W., Ray, L. B., Erikson, E., and Maller, J. L. (1988) Nature 334, 715-718[CrossRef][Medline] [Order article via Infotrieve]
55. Chen, R. H., Chung, J., and Blenis, J. (1991) Mol. Cell. Biol. 11, 1861-1867[Abstract/Free Full Text]
56. Kamine, J., Elangovan, B., Subramanian, T., Coleman, D., and Chinnadurai, G. (1996) Virology 216, 357-366[CrossRef][Medline] [Order article via Infotrieve]
57. Nakajima, T., Fukamizu, A., Takahashi, J., Gage, F. H., Fisher, T., Blenis, J., and Montminy, M. R. (1996) Cell 86, 465-474[CrossRef][Medline] [Order article via Infotrieve]
58. Gavaravarapu, S., and Kamine, J. (2000) Biochem. Biophys. Res. Commun. 269, 758-766[CrossRef][Medline] [Order article via Infotrieve]
59. Ferreri, K., Gill, G., and Montminy, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1210-1213[Abstract/Free Full Text]
60. Nakajima, T., Uchida, C., Anderson, S. F., Parvin, J. D., and Montminy, M. (1997) Genes Dev. 11, 738-747[Abstract/Free Full Text]
61. Felinski, E. A., and Quinn, P. G. (1999) J. Biol. Chem. 274, 11672-11678[Abstract/Free Full Text]
62. Felinski, E. A., Kim, J., Lu, J., and Quinn, P. G. (2001) Mol. Cell. Biol. 21, 1001-1010[Abstract/Free Full Text]
63. Quinn, P. G. (1993) J. Biol. Chem. 268, 16999-17009[Abstract/Free Full Text]
64. Groussin, L., Massias, J. F., Bertagna, X., and Bertherat, J. (2000) J. Clin. Endocrinol. Metab. 85, 345-354[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
N. Horike, H. Sakoda, A. Kushiyama, H. Ono, M. Fujishiro, H. Kamata, K. Nishiyama, Y. Uchijima, Y. Kurihara, H. Kurihara, et al.
AMP-activated Protein Kinase Activation Increases Phosphorylation of Glycogen Synthase Kinase 3{beta} and Thereby Reduces cAMP-responsive Element Transcriptional Activity and Phosphoenolpyruvate Carboxykinase C Gene Expression in the Liver
J. Biol. Chem., December 5, 2008; 283(49): 33902 - 33910.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
B. L. Yaspan, J. P. Breyer, Q. Cai, Q. Dai, J. B. Elmore, I. Amundson, K. M. Bradley, X.-O. Shu, Y.-T. Gao, W. D. Dupont, et al.
Haplotype Analysis of CYP11A1 Identifies Promoter Variants Associated with Breast Cancer Risk
Cancer Res., June 15, 2007; 67(12): 5673 - 5682.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
N. Sher, N. Yivgi-Ohana, and J. Orly
Transcriptional Regulation of the Cholesterol Side Chain Cleavage Cytochrome P450 Gene (CYP11A1) Revisited: Binding of GATA, Cyclic Adenosine 3',5'-Monophosphate Response Element-Binding Protein and Activating Protein (AP)-1 Proteins to a Distal Novel Cluster of cis-Regulatory Elements Potentiates AP-2 and Steroidogenic Factor-1-Dependent Gene Expression in the Rodent Placenta and Ovary
Mol. Endocrinol., April 1, 2007; 21(4): 948 - 962.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
W. Zheng and C. R. Jefcoate
Steroidogenic Factor-1 Interacts with cAMP Response Element-Binding Protein to Mediate cAMP Stimulation of CYP1B1 via a Far Upstream Enhancer
Mol. Pharmacol., February 1, 2005; 67(2): 499 - 512.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
N. Horike, H. Takemori, Y. Katoh, J. Doi, L. Min, T. Asano, X. J. Sun, H. Yamamoto, S. Kasayama, M. Muraoka, et al.
Adipose-specific Expression, Phosphorylation of Ser794 in Insulin Receptor Substrate-1, and Activation in Diabetic Animals of Salt-inducible Kinase-2
J. Biol. Chem., May 9, 2003; 278(20): 18440 - 18447.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Takemori, Y. Katoh, N. Horike, J. Doi, and M. Okamoto
ACTH-induced Nucleocytoplasmic Translocation of Salt-inducible Kinase. IMPLICATION IN THE PROTEIN KINASE A-ACTIVATED GENE TRANSCRIPTION IN MOUSE ADRENOCORTICAL TUMOR CELLS
J. Biol. Chem., October 25, 2002; 277(44): 42334 - 42343.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/18/15629    most recent
M109365200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doi, J.
Right arrow Articles by Okamoto, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doi, J.
Right arrow Articles by Okamoto, M.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement