JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M111674200 on February 19, 2002

J. Biol. Chem., Vol. 277, Issue 18, 16131-16138, May 3, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/18/16131    most recent
M111674200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Köchl, R.
Right arrow Articles by Schülein, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Köchl, R.
Right arrow Articles by Schülein, R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The Signal Peptide of the G Protein-coupled Human Endothelin B Receptor Is Necessary for Translocation of the N-terminal Tail across the Endoplasmic Reticulum Membrane*

Robert KöchlDagger §, Martina AlkenDagger §, Claudia RutzDagger , Gerd KrauseDagger , Alexander OkscheDagger , Walter RosenthalDagger , and Ralf SchüleinDagger ||

From the Dagger  Forschungsinstitut für Molekulare Pharmakologie, Robert-Rössle-Strasse 10, 13125 Berlin and the  Institut für Pharmakologie, Freie Universität Berlin, Thielallee 67-73, 14195 Berlin, Germany

Received for publication, December 7, 2001, and in revised form, February 12, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The initial step of the intracellular transport of G protein-coupled receptors, their insertion into the membrane of the endoplasmic reticulum, follows one of two different pathways. Whereas one group uses the first transmembrane domain of the mature receptor as an uncleaved signal anchor sequence for this process, a second group possesses additional cleavable signal peptides. The reason this second subset requires the additional signal peptide is not known. Here we have assessed the functional significance of the signal peptide of the endothelin B (ETB) receptor in transiently transfected COS.M6 cells. A green fluorescent protein-tagged ETB receptor mutant lacking the signal peptide was nonfunctional and retained in the endoplasmic reticulum, suggesting that it has a folding defect. To determine the defect in more detail, ETB receptor fragments containing the N-terminal tail, first transmembrane domain, and first cytoplasmic loop were constructed. We assessed N tail translocation across the endoplasmic reticulum membrane in the presence and absence of a signal peptide and show that the signal peptide is necessary for N tail translocation. We postulate that signal peptides are necessary for those G protein-coupled receptors for which post-translational translocation of the N terminus is impaired or blocked by the presence of stably folded domains.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The heptahelical GPCRs1 are the largest protein family in vertebrates (1). The receptors play a key role in signal transduction and are important drug targets. Although the derivation of structure/function relationships of GPCRs has been the subject of numerous studies (2), comparatively little is known concerning the transport of GPCRs via the intracellular membrane systems to the cell surface (3).

The first step of the intracellular protein transport is the insertion into the ER membrane. For membrane proteins, this process is mediated by signal sequences contained in the proteins and by a complex targeting/insertion machinery (4). For membrane proteins with an extracellular N terminus like GPCRs, two different types of signal sequences can be distinguished. The members of the first group possess signal peptides for ER targeting/insertion, which are removed by signal peptidases of the ER membrane (type I membrane proteins; classification of Spiess (Ref. 5)). The second group uses the first transmembrane domains of the mature protein as noncleavable signal anchor sequences for this process (type III membrane proteins). It is striking that, in the GPCR family, ER targeting and insertion is established by both types of signal sequences. The vast majority of the receptors have signal anchor sequences; a small group, however, contains additional cleavable signal peptides (6).

The reason one group requires cleavable signal peptides is not known for GPCRs and the other membrane proteins with an extracellular N-terminal tail. The addition of the signal peptide from influenza hemagglutinin to the beta 2 adrenergic receptor, which normally contains only a signal anchor sequence, enhanced translocation of the receptor into the ER membrane (7). Hence, it was suggested that a signal peptide may facilitate the expression of functional receptors. A statistical analysis suggested that the presence of a signal peptide may depend on the nature of the N terminus of the GPCR (6). In particular, the presence of signal peptides correlates with the length of the N-terminal tail and the number of positively charged residues therein (6).

It is also unclear whether signal peptides are in fact essential for all those receptors that contain them. An essential function can be concluded in the case of the rat thyrotropin receptor, where deletion of a sequence containing the putative signal peptide led to nonfunctional receptors (8, 9). However, this may not always be the case: for unrelated membrane proteins such as the human sodium calcium exchanger (10) and the human UDP-glucuronosyltransferase 1A6 (11), it was shown that mutants lacking the signal peptide are processed correctly. It is furthermore unclear how many GPCRs indeed contain signal peptides, because verification of signal peptide cleavage is hampered by low expression levels. The occurrence of a signal peptide by purification and N-terminal sequencing of the mature protein was, however, demonstrated unambiguously for the ETB receptor (12-14).

A hypothesis for the significance of cleavable signal peptides of GPCRs and other membrane proteins may be developed on the basis of the currently known mechanisms of the initial steps of ER targeting and insertion. These mechanisms are more completely established for secretory proteins (which must be translocated across the ER membrane), but it is generally accepted that membrane proteins follow the same pathways (4, 15).

In mammalian cells, proteins are normally translocated across (secretory proteins) or integrated into (membrane proteins) the ER membrane in a cotranslational manner by membrane-bound ribosomes. This process begins in the cytosol with the synthesis of the proteins N-terminal tail. Cytosolic translation continues until the first hydrophobic segment appears, a cleavable signal peptide in the case of a secretory protein, a signal anchor sequence or a cleavable signal peptide in the case of a membrane protein with an extracellular N-terminal tail (membrane proteins with an intracellular N tail invariably use signal anchor sequences). Appearance of the signal in either case leads to the binding of the signal recognition particle (SRP) and consequently to a translation stop ("elongation arrest"). The SRP-nascent chain-ribosome complex is then targeted to the SRP receptor of the ER membrane. The nascent chain is transferred from the SRP to the translocase complex, and translation restarts. Secretory proteins are translocated across the ER membrane (and liberated after cleavage of the signal peptide), whereas membrane proteins are integrated into the bilayer.

For membrane proteins like GPCRs, this mechanism implies major differences in the translocation of the N termini with and without signal peptides. For a membrane protein without a signal peptide (Fig. 1A), the N terminus is completely synthesized in the cytoplasm, because translation is not stopped until the signal anchor sequence (TM1) appears. The N terminus must thus be translocated post-translationally through the translocase complex across the ER membrane. In contrast, for a membrane protein with an additional signal peptide (Fig. 1B), the N terminus is not translated in the cytosol because SRP binding to the preceding signal peptide stops elongation. Here, the N terminus can be translocated cotranslationally through the translocase complex. Taking these considerations into account, it is logical to speculate that signal peptides are necessary for N tail translocation of those membrane proteins for which a posttranslational translocation of the N terminus is impaired.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 1.   Putative ER targeting and insertion mechanisms of GPCRs with (B) and without (A) signal peptide. The respective ER targeting signals (internal signal anchor sequence or cleavable signal peptides) are indicated by black boxes. See the Introduction for details.

GPCRs are ideally suited to address the question why some membrane proteins require additional signal peptides and the other not, because both pathways are established in this large protein family. In this paper we have assessed the functional significance of the signal peptide of the ETB receptor. We show that a mutant lacking the signal peptide is retained in a nonfunctional form in the ER and that the signal peptide is indeed necessary for translocation of the N-terminal tail of the receptor across the ER membrane.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- The transfection reagents LipofectAMINE and TransFast were purchased from Invitrogen (Karlsruhe, Germany) and Promega (Mannheim, Germany), respectively. DNA modifying enzymes and peptide N-glycosidase F (PNGase F) were purchased from New England Biolabs (Schwalbach, Germany). Trypan blue and rhodamine 6G were purchased from Seromed (Berlin, Germany) and Molecular Probes (Leiden, The Netherlands), respectively. 125I-ET1 (2200 Ci/mmol) was from PerkinElmer Life Sciences. Oligonucleotides were from Biotez (Berlin, Germany). All other reagents were from Sigma (München, Germany). Plasmid pEGFP-N1, encoding the red-shifted variant of GFP, was purchased from CLONTECH Laboratories (Heidelberg, Germany). Alkaline phosphatase-conjugated anti-mouse IgG was from Dianova (Hamburg, Germany). The polyclonal anti-GFP antiserum raised against a synthetic peptide was described previously (16).

DNA Manipulations-- Standard DNA manipulations were carried out according to the handbooks of Sambrook et al. (17). The nucleotide sequences of the plasmid constructs were verified using the FS Dye Terminator kit from PerkinElmer Life Sciences (Weiterstadt, Germany). Site-directed mutagenesis was carried out with the QuikChange site-directed mutagenesis kit from Stratagene (Heidelberg, Germany).

Plasmid Construction-- The plasmid encoding the wild-type, full-length ETB receptor with a C-terminal GFP fusion (pETB.GFP) was described previously (18). For the construction of a truncated ETB receptor fragment, the sequence comprising the N-terminal tail, first transmembrane domain and first cytoplasmic loop was PCR-amplified using pETB.GFP as template. The primer sequences used were 5'-CGCAAATGGGCGGTAGGCGTGTACGG-3' (5' primer) and 5'-CAAGATATTGGGATCCTTTCGCATGCAC-3' (3' primer). The 3' primer introduced a novel BamHI site (underlined). The PCR fragment was digested with BamHI and HindIII and inserted into pETB.GFP cleaved with the same enzymes, thereby replacing the BamHI/HindIII fragment encoding the full-length ETB receptor. In the resulting plasmid pETB134.GFP, the GFP moiety is fused to residue Asn-134 of the ETB receptor. For the construction of a corresponding receptor fragment without signal peptide, a similar PCR amplification strategy was used with plasmid pETB.GFP as template. In the 5' primer (5'-GGCCTGTCGCGAAGCTTGGGAatgGAGAGAGGC-3'), the codon of residue Glu-27 was replaced by an ATG start codon (lowercase letters in the primer sequence). An upstream HindIII site (underlined) was also introduced to delete the sequence of the signal peptide. The 3' primer was the same as described above for the construction of pETB134.GFP. The resulting PCR fragment was cut with HindIII and BamHI and cloned into pETB.GFP as described above. In the resulting plasmid pETB134/Delta 26.GFP, the GFP moiety was again fused to residue Asn-134 of the ETB receptor, but the N-terminal 26 amino acid residues containing the signal peptide were deleted. To construct a full-length GFP-tagged ETB receptor lacking a signal peptide, the SnaBI/PpuMI fragment of plasmid pETB.GFP was replaced by the corresponding fragment of the plasmid pETB134/Delta 26.GFP.

Larger truncations (37, 46, and 55 residues) of the N-terminal tail of the GFP-tagged full-length ETB receptor and the receptor fragment described above were constructed directly using the QuikChange site-directed mutagenesis kit. The plasmids pETBDelta 26.GFP and pETB134/Delta 26.GFP were used as templates to construct the full-length receptors and the receptor fragments, respectively. The primer sequences used were 5'-GATCTCGAGCTCAAGCTTGGGAATGCTTTTGCAAACCTCAGCATAATG-3' (Delta 37), 5'-GATCTCGAGCTCAAGCTTGGGAATGCCACCCACTAAGACCTTATGGCCC-3' (Delta 46) and 5'-GATCTCGAGCTCAAGCTTGGGAATGGGTTCCAACGCCAGTCTGGCGCGG3' (Delta 55). The resulting plasmids encoding full-length receptors were designated pETBDelta 37.GFP, pETBDelta 46.GFP, and pETBDelta 55.GFP. The resulting plasmids encoding the corresponding receptor fragments were designated pETB134/Delta 37.GFP, pETB134/Delta 46.GFP, and pETB134/Delta 55.GFP.

Cell Culture and Transfection Methods-- COS.M6 and HEK 293 cells were cultured at 37 °C and 5% (v/v) CO2 in Dulbecco's modified Eagle's medium containing 10% (v/v) heat-inactivated fetal calf serum, penicillin (100 units/ml), and streptomycin (100 µg/ml). The isolation of crude membranes for the 125I-ET1 binding assay and the immunoblots proceeded from confluent cells grown on 60-mm diameter dishes. Cells (5 × 105) were transfected with 2.5 µg of plasmid DNA and 7.5 µl of TransFast reagent for the 125I-ET1 binding assays or with 18.75 µl of LipofectAMINE reagent for the immunoblots. The transfection procedure was according to the supplier's recommendations. Cells were further incubated for 48 h (125I-ET1 binding assay) or 24 h (immunoblots) after removal of the transfection reagent. The transfection for laser scanning microscopy was carried out with cells grown on glass coverslips in 35-mm diameter dishes. Cells (1 × 104) were transfected with 1 µg of plasmid DNA and 7.5 µl of LipofectAMINE reagent. Cells were further incubated for 48 h after removal of the transfection reagent.

125I-ET1 Binding Assay-- The 125I-ET1 binding assay was carried out with crude membranes of transiently transfected COS.M6 cells as previously described for stably transfected CHO cells (18).

Visualization of GFP-tagged Receptors; ER and Cell Surface Staining in Living, Transiently Transfected COS.M6 or HEK 293 Cells-- Cells grown on coverslips were washed twice with phosphate-buffered saline, pH 7.0, and transferred immediately into a self-made chamber (details available on request). Cells were covered with 1 ml of phosphate-buffered saline, pH 7.0, and GFP fluorescence was visualized on a Zeiss 410 invert laser scanning microscope (lambda ex = 488 nm, lambda em >515 nm). Subsequently, either the cell surface or the ER of the same cells were stained with trypan blue (0.05%, 1 min) (19) or rhodamine 6G (5 µM, 20 min) (20), respectively. Trypan blue (lambda ex = 543 nm, lambda em = >590 nm) and rhodamine 6G fluorescences (lambda ex = 543 nm, lambda em = >570 nm) were recorded on a second channel, and their overlap with the GFP signals was computed.

Isolation of Crude Membrane Fractions of Transiently Transfected COS.M6 or HEK 293 Cells Containing GFP-tagged Receptor Fragments; PNGase F Digestion, High Salt Treatment, and Immunoblots-- Crude membranes were isolated from confluent cells grown on one 60-mm diameter dish as described previously (21). For the analysis of the glycosylation of the receptor fragments, membranes (150 µg of protein) were treated with PNGase F according to the suppliers recommendations. Membrane proteins were dissolved in Laemmli buffer (60 mM Tris-HCl, 2% SDS, 10% glycerol, 5% beta -mercaptoethanol, 0.1% bromphenol blue, pH 6.8) and subjected to SDS-polyacrylamide gel electrophoresis (PAGE) (12% acrylamide). For the differentiation of integral versus peripheral membrane proteins, high salt washes were performed. Crude membranes (150 µg of protein) were stirred for 1 h at 4 °C in either 0.1 M Na2CO3 or in 4 M urea, centrifuged at 200,000 × g for 1 h, dissolved in Laemmli buffer, and subjected to SDS-PAGE (12% acrylamide). Separated proteins were blotted onto nitrocellulose filters as described (22). Filters were blocked for 1 h with blotting buffer (20 mM Tris-HCl, 150 mM NaCl, 5% low fat milk powder, 1% Triton X-100, pH 7.0) and incubated with polyclonal anti-GFP antibodies (dilution 1:2500 in blotting buffer) for 1 h at room temperature. Filters were washed four times (15 min each) with blotting buffer and incubated with anti-rabbit alkaline phosphatase-conjugated IgG (dilution 1:5000 in blotting buffer) for 1 h at room temperature. Filters were washed four times (10 min each) with blotting buffer, twice (10 min each) with the same buffer lacking milk powder, and once (5 min) with 10 mM Tris-HCl, pH 9.5. Filters were incubated in staining solution (0.56 mM 5-bromo-4-chloro-3-indolyl phosphate, 0.48 mM nitro blue tetrazolium) until bands became visible.

Prediction of Putative Signal Peptides in the Different GPCR Subfamilies-- A data set comprising a total of 877 GPCR sequences was constructed from the tinyGRAP GPCR data base (GPCR families 1a, 1b, and 1c; November 2000 release) (23, 24) and the GPCRDB data base (GPCR families 2 and 3; December 2000 release) (25). Putative signal peptides were monitored with the program SPScan from the Wisconsin GCG package (Genetics Computer Group, Inc., Madison, WI) with a minimum acceptable score of 7.0.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

An ETB Receptor without Signal Peptide Is Nonfunctional and Is Retained in the ER-- If the hypothesis above holds true, the N terminus of a receptor mutant without signal peptide should be translocation-incompetent. The mutant receptor, however, should still be targeted and inserted into the ER membrane, because the TM1 of the mature receptor should assure the signaling properties as a signal anchor sequence when the signal peptide is removed (it was shown previously (26) that almost every transmembrane domain of a GPCR can function as a signal anchor sequence if it is placed in the TM1 position). We constructed a signal peptide mutant of the ETB receptor by deleting the N-terminal 26 residues of the receptor (Fig. 2A, mutant ETBDelta 26.GFP). The receptor mutant was tagged C-terminally with the autofluorescent GFP to allow visualization of the intracellular localization of the mutant. We have previously shown that a GFP moiety at this position does not influence cell surface expression or the pharmacological properties of the ETB receptor (18). We first assessed whether the signal peptide of the ETB receptor has any significance for the establishment of a functional receptor. To this end, we performed 125I-ET1 binding assays with crude membrane preparations of transiently transfected COS.M6 cells containing the wild-type receptor and the signal peptide mutant (Fig. 3). For the wild-type receptor (ETB.GFP), a typical binding curve was obtained with a KD value of 27 pM, in good agreement with previous results (18). For the signal peptide mutant (ETBDelta 26.GFP), significant 125I-ET1 binding was not detected. These results demonstrate that the signal peptide of the ETB receptor is necessary for the establishment of a functional receptor.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 2.   Depiction of the GFP fusions. A, full-length ETB receptors with (ETB.GFP) and without signal peptide (ETBDelta 26.GFP). Removal of the signal peptide was achieved by deleting the N-terminal 26 residues. Both receptors were tagged C-terminally with GFP. B, truncated ETB receptor fragments with (ETB134.GFP) and without signal peptide (ETB134/Delta 26.GFP). The receptor fragments (134 residues) comprise the N-terminal tail, TM1, first cytoplasmic loop, and a C-terminal GFP moiety. Removal of the signal peptide was achieved by deleting the N-terminal 26 residues.


View larger version (9K):
[in this window]
[in a new window]
  		Fig. 3.   125I-ET1 binding profiles of crude membranes from transiently transfected COS.M6 cells expressing GFP-tagged ETB receptors with (ETB.GFP) and without signal peptide (ETBDelta 26.GFP). Specific binding is shown. Data points represent mean values of duplicates, which differed by less than 10%. Unspecific binding contributed up to 30% of total binding. The results are representative of three independent experiments. Shown are binding isotherms (A) and the derived Scatchard transformations (B). The calculated KD and Bmax values are indicated.

To assess the expression and intracellular transport of the signal peptide mutant, the GFP fluorescence signals of ETB.GFP and ETBDelta 26.GFP were localized in living, transiently transfected COS.M6 cells by laser scanning microscopy (Fig. 4A, left panel, in green). The cell surface of the same cells was visualized by the use of trypan blue (Fig. 4A, central panel, in red). Receptors at the plasma membrane were identified by computer overlay (Fig. 4A, right panel, colocalization is indicated by yellow areas). For the wild-type receptor, GFP signals were detected at the cell surface, indicated by their overlap with the trypan blue signal. Additional GFP signals were located inside the cells, presumably representing transport intermediates en route to the cell surface or a receptor population that has become trapped as a consequence of overexpression and saturation of the transport system. In contrast to the wild-type receptor, no overlap of GFP and trypan blue fluorescence was observed for the signal peptide mutant. Instead, diffuse GFP fluorescence filled the interior of the cells with the exception of the nucleus. The signal peptide mutant is thus expressed, but is transport-incompetent.


View larger version (40K):
[in this window]
[in a new window]
  		Fig. 4.   Localization of GFP-tagged ETB receptors with (ETB.GFP) and without signal peptide (ETBDelta 26.GFP) in living, transiently transfected COS.M6. A, colocalization study with the plasma membrane marker trypan blue. After recording the GFP fluorescence signals (left panel in green), the cell surface was stained with trypan blue (central panel in red), and the fluorescence signals were computer-overlaid (right panel; colocalization is indicated by yellow areas). Note that GFP fluorescence is detectable only in the case of transfected cells, whereas trypan blue fluorescence is detectable for every cell present in the field of view. Each photograph shows a representative xy scan. Scale bar, 10 µm. B, colocalization with the ER marker rhodamine 6G. After recording the GFP fluorescence signals (left panel in green), the ER was stained with rhodamine 6G (central panel in red), and the fluorescence signals were computer-overlaid (right panel; colocalization is indicated by yellow areas). Note that GFP fluorescence is detectable only in the case of transfected cells, whereas rhodamine 6G fluorescence is detectable for every cell present in the field of view. Each photograph shows a representative xy scan. Scale bar, 10 µm.

The intracellular retention of the signal peptide mutant may be the consequence of a folding defect that is recognized by the quality control system of the ER, which ensures the export only of correctly folded proteins (27). We thus determined the membrane compartment in which the signal peptide mutant is trapped by the use of a fluorescent ER marker (Fig. 4B). After recording the GFP fluorescence signals of the wild-type receptor and the signal peptide mutant (Fig. 4B, left panel, in green), the ER of the same cells was stained with rhodamine 6G (Fig. 4B, central panel, in red). Colocalization of the signals was visualized by computer overlay (Fig. 4B, right panel, colocalization is indicated by yellow areas). In the case of the wild-type receptor, the GFP signal surrounded the ER rhodamine 6G signal. The additional GFP fluorescence signals inside the cells overlapped with the rhodamine 6G signals, indicative of transport intermediates or receptors trapped as a consequence of overexpression (see above). The GFP fluorescence signals of the signal peptide mutant, in contrast, overlapped almost exclusively with the rhodamine 6G fluorescence signals. These results indicate that the signal peptide mutant is retained in the ER. Corresponding experiments with transiently transfected HEK 293 cells rather than COS.M6 cells yielded similar results (data not shown).

The Signal Peptide of the ETB Receptor Is Necessary for N Tail Translocation across the ER Membrane-- Retention of the signal peptide mutant of the ETB receptor in the ER suggests that this mutant has a strong folding defect. If it is assumed that a lack of N tail translocation may cause such a defect, these results are consistent with the hypothesis that the signal peptide is necessary for this process. Translocation of a protein domain across the ER membrane can be monitored directly by the introduction of N-glycosylation tags because this posttranslational modification is only possible in the ER lumen. In the case of the N terminus of the ETB receptor, such an approach is simplified by the presence of a consensus N-glycosylation site at position Asn-59. Previous results suggest that N tail translocation of the ETB receptor leads to only a minor increase in the apparent molecular mass by a few kilodaltons (18). This difference is difficult to resolve when full-length receptors are analyzed. To assess glycosylation of the N terminus, we have constructed truncated receptor fragments comprising only the N terminus, TM1, and the first cytoplasmic loop (134 residues, Fig. 2B). The signal peptide was present in one construct (ETB134.GFP), but deleted from the other (pETB134/Delta 26.GFP). The use of truncated receptor fragments not only improves glycosylation detectability, but also guarantees that the N-terminal tail is the only domain to be translocated and analyzed for the influence of the signal peptide. Both receptor fragments were C-terminally tagged with the GFP moiety to allow their immunodetection. COS.M6 cells were then transiently transfected with the constructs, and crude membranes were isolated and treated with PNGase F to remove N-glycosylations. The GFP fusions were detected by immunoblotting using an anti-GFP antiserum (Fig. 5A).


View larger version (29K):
[in this window]
[in a new window]
  		Fig. 5.   Analysis of N-glycosylation and membrane integration of GFP-tagged ETB receptor fragments with (ETB134.GFP) and without signal peptide (ETB134/Delta 26.GFP) expressed in transiently transfected COS.M6 cells. A, glycosylation state analysis. Crude membranes (100 µg of protein) were treated with PNGase F to remove N-glycosylations or left untreated (-). Immunoreactive proteins were detected with a polyclonal anti-GFP antiserum and alkaline phosphatase-conjugated anti-rabbit IgG. Untransfected COS.M6 cells (control) were used as a control. The immunoblots are representative of three independent experiments. B, salt and urea extractions. Crude membranes (100 µg of protein) were washed with 0.1 M Na2CO3 or 4 M urea to remove peripheral membrane proteins or left untreated (-). Immunoreactive proteins were detected with a polyclonal anti-GFP antiserum and alkaline phosphatase-conjugated anti-rabbit IgG. Untransfected COS.M6 cells (control) were used as a control for antibody specificity. The immunoblots are representative of three independent experiments.

For the receptor fragment with signal peptide (ETB134.GFP), a 43-kDa immunoreactive protein band was detected in the untreated membranes, which was reduced to 39 kDa upon PNGase F treatment. The 43-kDa band thus represents the glycosylated, and the 39-kDa band the unglycosylated, form of the fusion protein. The apparent molecular mass of 39 kDa is in agreement with the calculated size of ETB134.GFP without signal peptide (receptor portion = 12 kDa, GFP moiety = 27 kDa), indicating that the signal peptide is cleaved after insertion into the ER membrane. Signal peptide cleavage is further confirmed by the fact that the mutant receptor fragment without signal peptide has an identical apparent molecular mass (see below). The detection of glycosylated forms of ETB134.GFP demonstrates that the N terminus is translocated across the ER membrane when a signal peptide is present. For the receptor fragment without signal peptide (ETB134/Delta 26.GFP) in contrast, only the 39-kDa form was detected in both PNGase F-treated and untreated membranes. The failure to detect glycosylated forms of ETB134/Delta 26.GFP indicates that N tail translocation across the ER membrane does not occur in the absence of a signal peptide. The other immunoreactive protein bands, which are detectable for ETB134/Delta 26.GFP (apparent molecular masses = 37 and 35 kDa), may represent degradation products that are produced only if the N terminus is oriented toward the cytoplasm.

The presence of ETB134/Delta 26.GFP in the membrane fraction strongly suggests that TM1 can indeed function as a signal anchor sequence and mediate membrane integration. We have, however, not rigorously excluded the possibility that ETB134/Delta 26.GFP becomes membrane associated solely because of the hydrophobicity of TM1. This would also prevent N tail glycosylation. To exclude this possibility, we performed salt (100 mM Na2CO3) and urea (4 M) extractions with the membranes prior to immunoblotting (Fig. 5B). For the receptor fragments with and without signal peptide, the same respective glycosylated (43 kDa) and unglycosylated fragments (39 kDa) were detected in the untreated membranes as described above. Both proteins were resistant to salt and urea treatment, demonstrating that ETB134/Delta 26.GFP is an integral membrane protein, too. Corresponding experiments with transiently transfected HEK 293 cells rather than COS.M6 cells yielded similar results (data not shown).

The Ligand Binding Functions of the Signal Peptide Mutant of the ETB Receptor Can Be Rescued by Deleting a Larger Portion (55 Residues) of the N-terminal Tail-- Our results indicate that the signal peptide requirement of the ETB receptor is the result of the presence of a domain in the N-terminal tail, which cannot be posttranslationally translocated across the ER membrane. If so, deletion of this domain should lead to an N tail, which can be translocated independently of the signal peptide. Furthermore, if this domain is not absolutely required for receptor function, its deletion may also lead to functional rescue of the receptor. To assess this possibility, the N-terminal tail of the signal peptide mutant was further truncated. GFP-tagged mutants were constructed, which lacked 37 (ETBDelta 37.GFP), 46 (ETBDelta 46.GFP), and 55 (ETBDelta 55.GFP) amino acid residues (Fig. 6A). 125I-ET1 binding assays with crude membrane preparations of transiently transfected COS.M6 cells expressing the mutant receptors were performed (Fig. 6B). The signal peptide mutant ETBDelta 26.GFP, which was used as a negative control, was again binding-defective. Deletion of 37 and 46 amino acid residues of the ETB receptor led to receptors for which specific binding was only barely detectable. Deletion of 55 amino acid residues, however, led to a typical binding curve. The KD value of the mutant receptor was similar to that of the wild-type receptor shown in Fig. 3 (38 versus 27 pM, respectively). These results demonstrate that the binding functions of the ETB receptor can be rescued when the truncation of the N-terminal tail is extended up to 55 amino acid residues. They indicate that N tail translocation is possible without signal peptide in this case. This rescue, however, seems not to include the whole receptor population because the Bmax value of the mutant receptor was reduced about 10-fold (0.3 pmol/mg versus the 3.2 pmol/mg of the wild-type shown in Fig. 3). To confirm that the functional rescue of the truncation mutant is indeed accompanied by a rescue of N tail translocation, we used our C-terminally truncated receptor fragments containing only the N terminus, TM1, and first cytoplasmic loop (see above). Here, truncation of the N terminus should lead to the rescue of N tail glycosylation. HEK 293 cells were transiently transfected with the wild-type receptor fragment ETB134.GFP and the constructs ETB134/Delta 46.GFP (glycosylated forms should still be absent) and ETB134/Delta 55.GFP (glycosylated forms should again be detectable). Crude membranes were assessed by PNGase F treatment and immunoblotting for the presence of glycosylated receptor fragments (Fig. 6C). For the wild-type receptor fragment ETB134.GFP, the same 43-kDa PNGase-sensitive protein band was detected as described above (see Fig. 5). For the receptor fragment ETB134/Delta 46.GFP, only unglycosylated forms were found, as expected. For receptor fragment ETB134/Delta 55.GFP, however, a faint PNGase F-sensitive glycosylated protein band (marked with *) was detectable, thus demonstrating the rescue of N tail translocation consistent with the binding assay. The simultaneous presence of a strong PNGase F-resistant unglycosylated protein band indicates that this rescue is incomplete, which is again in agreement with the binding assay. Corresponding experiments with transiently transfected COS.M6 cells rather than HEK 293 cells yielded similar results (data not shown).


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   Rescue of the N tail translocation of the signal peptide mutant by an extended N-terminal truncation. A, depiction of the N tail sequence of the ETB receptor and construction of the truncation mutants ETBDelta 26.GFP (signal peptide mutant), ETBDelta 37.GFP, ETBDelta 46.GFP, and ETBDelta 55.GFP. Charged amino acid residues are indicated (see "Discussion"). B, 125I-ET1 binding profiles of crude membranes from transiently transfected COS.M6 cells expressing the ETB receptor mutants with truncated N tails. Specific binding is shown. Data points represent mean values of three independent experiments ± S.D. Unspecific binding contributed up to 30% of total binding. The calculated KD and Bmax values for receptor mutant ETBDelta 55.GFP are indicated. C, glycosylation state analysis of the receptor fragments ETB134.GFP (WT), ETB134/Delta 46.GFP, and ETB134/Delta 55.GFP. Crude membranes of transiently transfected HEK 293 cells (100 µg of protein) were treated with PNGase F to remove N-glycosylations or left untreated (-). Immunoreactive proteins were detected with a polyclonal anti-GFP antiserum and alkaline phosphatase-conjugated anti-rabbit IgG. The glycosylated protein band of ETB134/Delta 55.GFP is indicated by an asterisk. The immunoblots are representative of three independent experiments.

If there had been a strict correlation between the glycosylation of receptor fragment ETB134/Delta 55.GFP and the number of rescued ligand binding sites of ETBDelta 55.GFP (Bmax value = 10% of that of the wild type, see above) the glycosylated protein band of ETB134/Delta 55.GFP should represent up to 10% of the total protein. The detectable amount, however, was significantly lower. This discrepancy may be explained by the N-terminal deletion (55 amino acid residues), which places the glycosylated asparagine residue (Asn-59) very close to the amino terminus of the protein. Glycosylation at this position may not be as efficient as in the original wild-type location.

In summary, the results obtained with N-terminal truncation mutants are consistent with the hypothesis that a domain is present in the N-terminal tail of the ETB receptor, which requires a signal peptide for its translocation.

Signal Peptides Are Present Preferentially in Those GPCRs That Are Expected to Have Stably Folded Domains in Their N-terminal Tails-- Because of its size, the GPCR protein family should be ideally suited to delineate the N tail properties of membrane proteins that require signal peptides. The possession of a signal peptide, however, has been verified experimentally for only a few GPCRs. In a previous statistical study using a new neuronal network algorithm, 40 receptors among a total of 364 GPCRs were predicted to contain a signal peptide (6). In view of the rapidly growing number of GPCRs documented, we again monitored the protein family for the presence of signal peptides (Fig. 7) using the program SPScan and the tinyGRAP and GPCRDB data bases (see "Experimental Procedures" for details). In addition we assessed the distribution of putative signal peptides throughout the GPCR subfamilies (classification according to Bockaert and Pin (Ref. 1)). Among a total of 877 GPCRs, 136 (= 16%) were predicted to possess signal peptides. Our computer analysis reveals that signal peptides are not distributed equally throughout the GPCR subfamilies. Whereas the vast majority of the receptors of family 1c (glycoprotein hormone receptors), family 2 (calcitonin receptor group = receptors for higher molecular weight hormones), and family 3 (metabotropic glutamate receptor group) contain putative signal peptides, they are rare in the large GPCR families 1a (rhodopsin family) and 1b (peptide receptors). To avoid distortion of the results by species repetition of specific receptor sequences in the data base, the signal peptide scan was also performed with human sequences alone. The values obtained by this approach correlated well with those derived from the complete list of sequences (Fig. 7). It is noteworthy that the putative signal peptides are preferentially found in those GPCR families for which a contribution of the N tails to the ligand binding domain has been demonstrated or proposed and which would thus be expected to contain stably folded domains (see "Discussion").


View larger version (28K):
[in this window]
[in a new window]
  		Fig. 7.   Distribution of putative signal peptides in the GPCR subfamilies. The data set was constructed from the tinyGRAP (GPCR families 1a, 1b, and 1c) and GPCRDB data bases (GPCR families 2 and 3). Putative signal peptides were identified with the program SPScan. The percentage of receptors containing a putative signal peptide within each GPCR subfamily is shown in the upper part. The black columns represent values derived from all receptor sequences in the data base. The white columns represent values derived only from human sequences avoiding species repetitions for a specific receptor sequence. The different GPCR families and the number of sequences (total and human) analyzed in each group are depicted below. Ligands lying in their putative binding sites are illustrated schematically in black. The classification of the GPCR subfamilies follows that of Bockaert and Pin (1) and of the GPCR data bases: family 1a = rhodopsin family; family 1b = peptide receptors; family 1c = glycoprotein hormone receptors; family 2 = calcitonin receptor family; family 3 = metabotropic glutamate receptors.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have shown here that the signal peptide of the ETB receptor is essential for receptor function by mediating N tail translocation across the ER membrane. The translation of a protein that is destined for the ER membrane stops in the cytosol when the first hydrophobic segment appears. This elongation arrest enables GPCRs that possess a signal peptide to translocate their N termini cotranslationally (in contrast to GPCRs without a signal peptide, which are dependent on the post-translational mechanism; see Fig. 1). Signal peptides seem to be necessary for those GPCRs for which a post-translational translocation of the N terminus is either impaired or impossible. What might prevent efficient post-translational translocation of the N terminus in these cases? At least three N tail properties may be important: (i) the presence and number of positively charged residues, (ii) the length, and (iii) the presence of rapidly and stably folded domains.

(i) For eucaryotic membrane proteins, the "charge difference" rule postulates that the orientation of a transmembrane domain is determined by charge differences between its flanking N- and C-terminal domains, with the more positive portion facing the cytosol (28-30). Positively charged residues thus impair translocation of a domain, whereas negatively charged residues facilitate it. A statistical study demonstrated that positively charged residues are more frequent in the N termini of GPCRs containing a signal peptide than in those without one (6). A signal peptide may thus be necessary to translocate the N termini of GPCRs, which are enriched in positively charged residues. However, it is not clear whether positively charged residues block translocation effectively over the entire length of a protein domain in eucaryotes. Previous statistical data suggest that charged residues might be most effective only within a distance of 10-15 residues of the transmembrane domain (28). This region is still present in the truncation mutant ETBDelta 55.GFP, yet the N tail of this mutant receptor can be translocated without signal peptide (see Fig. 6). Furthermore, the N tail region of the ETB receptor, which requires the signal peptide, i.e. in the sequence N-terminal of amino acid residue 55, contains more negatively than positively charged residues (4 negatively versus 3 positively charged residues; see Fig. 6A). Thus, at least for the ETB receptor, a significance of positively charged extracellular residues for the necessity of a signal peptide seems to be unlikely.

(ii) It is conceivable that the longer an N tail, the less easily it is translocated post-translationally and the more it may depend on a signal peptide. The statistical study of Wallin and von Heijne (6) indeed demonstrated that the N termini of GPCRs with signal peptides are significantly longer (average length = 200 residues) than those without signal peptides (average length = 40 residues). However, experimental data obtained for the unrelated dihydrofolate reductase suggest that the size of a protein domain per se does not represent a translocation limiting factor (31). Furthermore, the human ETB receptor studied here has a relatively short N terminus (75 residues) and GPCRs with even longer N termini were predicted to have no signal peptide in the study of Wallin and von Heijne (6) (e.g. the human 5-hydroxytryptamine 7 receptor = 81 residues, the tachykinin-like peptide receptor 86C = 84 residues, and the cannabinoid receptor 1C = 116 residues). In the case of the ETB receptor, it is thus also unlikely that the length of the N terminus alone is responsible for the signal peptide requirement.

(iii) Stably folded domains cannot be translocated across the ER membrane. This seems to be clear not only from the dimensions of the translocation channel but also from experiments demonstrating the development of a translocation block by the introduction of a small zinc finger domain into an otherwise translocation competent sequence (31). For GPCRs without a signal peptide, the elongation arrest mediated by the appearance of the first hydrophobic segment implies a complete cytoplasmic synthesis of the N termini, whereas the N termini of GPCRs with a signal peptide are synthesized at the translocation channel and processed directly into the ER lumen (see Fig. 1). It is obvious that only the latter mechanism would tolerate the presence of stable and rapidly folded domains in the N terminus. The deducible hypothesis that GPCRs with folded domains in their N tails might be dependent on a signal peptide is further supported when the different locations of the ligand binding domain within the GPCR families (reviewed in Ref. 1) are considered: the receptors for the glycoprotein hormones thyroid-stimulating hormone, follicle-stimulating hormone, and luteinizing hormone/human chorionic gonadotropin (family 1c) possess putative signal peptides. For these receptors it is known that the ligand binding pocket, and consequently complexly folded domains, are contained within their N tails. Signal peptides are also common in family 2 and family 3 GPCRs, whose N termini also contribute to ligand binding. The vast majority of class 1a and class 1b GPCRs, however, whose ligand binding pockets are not located in the N tails but within the TMs (family 1a) or in a cavity formed between the superior parts of the TMs and the extracellular loops (family 1b) rarely possess putative signal peptides. It is thus reasonable to speculate that signal peptides are present in those GPCRs that possess folded domains within their N tails.

For the ETB receptor studied here, however, such a folded domain does not seem to be part of the ligand binding pocket because the receptor belongs to the family 1b (see above). Indeed, we have shown that at least the sequence up to residue Lys-56 is not essential for ligand binding (see Fig. 6). This is in agreement with a previous report, which demonstrated that even the sequence up to residue Arg-64 is not essential for a functional ligand binding pocket (32). The ETB receptor may, however, contain another folded domain within its N tail. Interestingly, the putative folded region of the ETB receptor requiring the signal peptide appears to be removed from the intact receptor by proteolytic cleavage at residue Arg-64 (12, 14). Neither the mechanism nor functional significance of this proteolysis is known, but it can be speculated that the liberated domain may have a functional significance independent of the remaining part of the receptor.

We have shown here that the signal peptide of the ETB receptor is essential for N tail translocation across the ER membrane. It must be noted, however, that this does not necessarily mean that all GPCRs containing a signal peptide are dependent on it for their function. At least some unrelated membrane proteins, including the human sodium calcium exchanger (10) and human UDP-glucuronosyltransferase 1A6 (11), were processed correctly in the absence of their signal peptides, and this may also be true for some GPCRs. Chaperones may prevent N tail folding in the cytoplasm in these cases, thereby holding sequences in an unfolded, translocation-competent state. Furthermore, our data do not allow the conclusion that GPCRs without signal peptides must necessarily have unfolded N tails. The recently published crystal structure of rhodopsin (the archetypal family 1a GPCR) (33) indeed revealed that folded domains are present in the N terminus; thus, chaperones also seem to be effective in this instance. Signal peptides may, however, become a necessity in cases when folding is particularly rapid and stable or when a critical number of folded domains is exceeded.

    ACKNOWLEDGEMENTS

We thank John Dickson for critical reading of the manuscript and Burkhard Wiesner for useful discussions. We also thank Gisela Papsdorf and Renate Loose from the cell culture facilities and Erhard Klauschenz and Barbara Mohs from the DNA sequencing service group for their contributions. Brunhilde Oczko provided excellent technical assistance at the laser scanning microscope.

    FOOTNOTES

* This work was supported by Deutsche Forschungsgemeinschaft Grant SFB 366 and a grant from the Fonds der Chemischen Industrie.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We dedicate this work to our colleague and friend, John Dickson, who died unexpectedly November 30, 2001.

§ These authors contributed equally to this work.

|| To whom correspondence should be addressed. Tel.: 49-30-94793255; Fax: 49-30-94793109; E-mail: schuelein@fmp-berlin.de.

Published, JBC Papers in Press, February 19, 2002, DOI 10.1074/jbc.M111674200

    ABBREVIATIONS

The abbreviations used are: GPCR, G protein-coupled receptor; 125I-ET1, 125I-labeled endothelin 1; COS.M6 cell, African green monkey kidney cell; ER, endoplasmic reticulum; ETB receptor, endothelin B receptor; GFP, green fluorescent protein; HEK 293 cell, human embryonal kidney cell; PNGase F, peptide N-glycosidase F; SRP, signal recognition particle; TM, transmembrane domain.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Bockaert, J., and Pin, J. P. (1999) EMBO J. 18, 1723-1729[CrossRef][Medline] [Order article via Infotrieve]
2. Schöneberg, T., Schultz, G., and Gudermann, T. (1999) Mol. Cell. Endocrinol. 151, 181-193[CrossRef][Medline] [Order article via Infotrieve]
3. Edwards, S. W., Tan, C. M., and Limbird, L. E. (2000) Trends Pharmacol. Sci. 21, 304-308[CrossRef][Medline] [Order article via Infotrieve]
4. Hedge, R. S., and Lingappa, V. R. (1997) Cell 91, 575-582[CrossRef][Medline] [Order article via Infotrieve]
5. Spiess, M. (1995) FEBS Lett. 369, 76-79[CrossRef][Medline] [Order article via Infotrieve]
6. Wallin, E., and von Heijne, G. (1995) Protein Eng. 8, 693-698[Abstract/Free Full Text]
7. Guan, X. M., Kobilka, T. S., and Kobilka, B. K. (1992) J. Biol. Chem. 267, 21995-21998[Abstract/Free Full Text]
8. Akamizu, T., Kosugi, S., and Kohn, L. D. (1990) Biochem. Biophys. Res. Commun. 169, 947-952[CrossRef][Medline] [Order article via Infotrieve]
9. Ban, T., Kosugi, S., and Kohn, L. D. (1992) Endocrinology 131, 815-829[Abstract]
10. Loo, T. W., Ho, C., and Clarke, D. M. (1995) J. Biol. Chem. 270, 19345-19350[Abstract/Free Full Text]
11. Ouzzine, M., Magdalou, J., Burchell, B., and Fournel-Gigleux, S. (1999) J. Biol. Chem. 274, 31401-31409[Abstract/Free Full Text]
12. Wada, K., Tabuchi, H., Ohba, R., Satoh, M., Tachibana, Y., Akiyama, N., Hiraoka, O., Asakura, A., Miyamoto, C., and Furuichi, Y. (1990) Biochem. Biophys. Res. Commun. 167, 251-257[CrossRef][Medline] [Order article via Infotrieve]
13. Saito, Y., Mizuno, T., Itakura, M., Suzuki, Y., Ito, T., Hagiwara, H., and Hirose, S. (1991) J. Biol. Chem. 266, 23433-23437[Abstract/Free Full Text]
14. Satoh, M., Miyamoto, C., Terashima, H., Tachibana, Y., Wada, K., Watanabe, T., Hayes, A. E., Gentz, R., and Furuichi, Y. (1997) Eur. J. Biochem. 249, 803-811[Medline] [Order article via Infotrieve]
15. Brodsky, J. L. (1998) Int. Rev. Cytol. 178, 277-328[Medline] [Order article via Infotrieve]
16. Krause, G., Hermosilla, R., Oksche, A., Rutz, C., Rosenthal, W., and Schülein, R. (2000) Mol. Pharmacol. 57, 232-242[Abstract/Free Full Text]
17. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed. , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
18. Oksche, A., Boese, G., Horstmeyer, A., Furkert, J., Beyermann, M., Bienert, M., and Rosenthal, W. (2000) Mol. Pharmacol. 57, 1104-1113[Abstract/Free Full Text]
19. Schülein, R., Hermosilla, R., Oksche, A., Dehe, M., Wiesner, B., Krause, G., and Rosenthal, W. (1998) Mol. Pharmacol. 54, 525-535[Abstract/Free Full Text]
20. Terasaki, M., and Reese, T. S. (1992) J. Cell Sci. 101, 315-322[Abstract/Free Full Text]
21. Schülein, R., Rutz, C., and Rosenthal, W. (1996) J. Biol. Chem. 271, 28844-28852[Abstract/Free Full Text]
22. Khyse-Andersen, J. (1984) J. Biochem. Biophys. Methods 10, 203-209[CrossRef][Medline] [Order article via Infotrieve]
23. Kristiansen, K., Dahl, S. G., and Edvardsen, Ø. (1996) Proteins Struct. Funct. Genet. 26, 81-94[CrossRef][Medline] [Order article via Infotrieve]
24. Edvardsen, Ø., and Kristiansen, K. (1997) 7TM J. 6, 1-6
25. Horn, F., Weare, J., Beukers, M. W., Horsch, S., Bairoch, A., Chen, W., Edvardsen, O., Campagne, F., and Vriend, G. (1998) Nucleic Acids Res. 26, 275-279[Abstract/Free Full Text]
26. Audigier, Y., Friedlander, M., and Blobel, G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5783-5787[Abstract/Free Full Text]
27. Hammond, C., and Helenius, A. (1995) Curr. Opin. Cell Biol. 7, 523-529[CrossRef][Medline] [Order article via Infotrieve]
28. Hartmann, E., Rapoport, T. A., and Lodish, H. F. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5786-5790[Abstract/Free Full Text]
29. Harley, C. A., and Tipper, D. J. (1996) J. Biol. Chem. 271, 24625-24633[Abstract/Free Full Text]
30. Harley, C. A., Holt, J. A., Turner, R., and Tipper, D. J. (1998) J. Biol. Chem. 273, 24963-24971[Abstract/Free Full Text]
31. Denzer, A., Nabholz, C. E, and Spiess, M. (1995) EMBO J. 14, 6311-6317[Medline] [Order article via Infotrieve]
32. Wada, K., Hashido, K., Terashima, H., Adachi, M., Fujii, Y., Hiraoka, O., Furuichi, Y., and Miyamoto, C. (1995) Protein Exp. Purif. 6, 228-236[CrossRef][Medline] [Order article via Infotrieve]
33. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Motoshima, H., Fox, B. A., Le, Trong, I., Teller, D. C., Okada, T., Stenkamp, R. E., Yamamoto, M., and Miyano, M. (2000) Science 289, 739-745[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
C. Rutz, A. Renner, M. Alken, K. Schulz, M. Beyermann, B. Wiesner, W. Rosenthal, and R. Schulein
The Corticotropin-releasing Factor Receptor Type 2a Contains an N-terminal Pseudo Signal Peptide
J. Biol. Chem., August 25, 2006; 281(34): 24910 - 24921.
[Abstract] [Full Text] [PDF]

Home page
 Exp. Biol. Med.Home page
E. Grantcharova, H. P. Reusch, M. Beyermann, W. Rosenthal, and A. Oksche
Endothelin A and Endothelin B Receptors Differ in Their Ability to Stimulate ERK1/2 Activation.
Experimental Biology and Medicine, June 1, 2006; 231(6): 757 - 760.
[Abstract] [Full Text] [PDF]