|
Originally published In Press as doi:10.1074/jbc.M201377200 on February 20, 2002
J. Biol. Chem., Vol. 277, Issue 18, 16139-16146, May 3, 2002
AUF1 Is a bcl-2 A + U-rich Element-binding
Protein Involved in bcl-2 mRNA
Destabilization during Apoptosis*
Andrea
Lapucci §¶,
Martino
Donnini §,
Laura
Papucci ,
Ewa
Witort ,
Alessio
Tempestini ,
Anna
Bevilacqua ,
Angelo
Nicolin ,
Gary
Brewer**,
Nicola
Schiavone  , and
Sergio
Capaccioli 
From the Department of Experimental Pathology and
Oncology, School of Medicine, University of Florence, 50134 Florence,
Italy, Department of Pharmacology, School of Medicine,
University of Milan, 20129 Milan, Italy, and ** Department of
Molecular Genetics and Microbiology, University of Medicine and
Dentistry of New Jersey, Robert Wood Johnson Medical School,
Piscataway, New Jersey 08854
Received for publication, February 11, 2002
 |
ABSTRACT |
We previously identified a conserved A + U-rich
element (ARE) in the 3'-untranslated region of bcl-2
mRNA. We have also recently demonstrated that the bcl-2
ARE interacts with a number of ARE-binding proteins (AUBPs) whose
pattern changes during apoptosis in association with bcl-2
mRNA half-life reduction. Here we show that the AUBP AUF1 binds
in vitro to bcl-2 mRNA. The results
obtained in a yeast RNA three-hybrid system have demonstrated that the
1-257-amino acid portion of p37 AUF1 (conserved in all isoforms),
containing the two RNA recognition motifs, also binds to the
bcl-2 ARE in vivo. UVC irradiation-induced
apoptosis results in an increase of AUF1. Inhibition of apoptosis by a
general caspase inhibitor reduces this increase by 2-3-fold.
These results indicate involvement of AUF1 in the
ARE/AUBP-mediated modulation of bcl-2 mRNA decay during apoptosis.
 |
INTRODUCTION |
The bcl-2 gene encodes the multifunctional Bcl-2
protein known to be involved in cell growth, differentiation control,
and prevention of apoptosis (1). Down-regulation of bcl-2
expression is a general response of the cell to apoptotic stimuli (2, 3). The mechanisms by which Bcl-2 exerts a protective activity against
apoptosis are still unclear, but the mechanism by which bcl-2 expression is regulated has recently been partially
elucidated. A large amount of evidence indicates that up- and
down-regulation of bcl-2 expression is modulated both at
transcriptional and posttranscriptional levels, the latter of which
includes mRNA stability and protein activity control. Expression of
the bcl-2 gene was known to be regulated transcriptionally
by a negative regulatory element (4). Two estrogen-responsive elements
within the coding region involved in transcriptional regulation of
bcl-2 have also been characterized recently in a breast
cancer cell line (5). One of the posttranscriptional control mechanisms
of bcl-2 expression has been described to be mediated by
phosphorylation of Bcl-2 protein at different amino acid positions (6,
7). Another posttranscriptional mechanism of bcl-2
regulation has been identified in our laboratory. This mechanism modulates bcl-2 mRNA stability and involves a
cis-acting A + U-rich element
(ARE)1 located in the 3'-UTR
of bcl-2 mRNA (8) that binds to a number of ARE-binding
proteins (AUBPs) whose pattern undergoes modifications during apoptosis
in association with bcl-2 mRNA decay (9).
AREs represent a class of cis-acting elements that modulate mRNA
stability (10). They are present in a variety of mRNAs of genes
required to be rapidly and finely modulated under particular conditions, such as response to growth factors, serum starvation, and
apoptosis (8, 11-13). GM-CSF and c-fos mRNAs
were the first to be studied in detail (14, 15). Compared with the AREs
of these genes (16), the bcl-2 ARE possesses a moderate,
constitutive, destabilizing activity that is dramatically enhanced upon
application of apoptotic stimuli (8, 9).
The mechanism of action of ARE-mediated mRNA decay is under
investigation by many laboratories. A number of AUBPs acting as trans-acting factors are known. In particular, some AUBPs belonging to
the heterogeneous nuclear ribonucleoprotein family are involved in
mRNA localization and stability control (17, 18). Among them, AUF1
and the embryonic lethal abnormal vision-like protein HuR are
able to enhance or inhibit mRNA degradation, respectively. For
example, there is evidence for binding and stabilization of c-fos, plasminogen activator inhibitor 2, and vascular
endothelial growth factor mRNAs by HuR (19-23). This
protein has also been implicated in the increase of p53-induced
p21waf1 mRNA after apoptotic stimuli (24). AUF1 was
first identified as an mRNA-binding protein with selective affinity
for AREs located within mRNAs such as c-myc,
c-fos, and GM-CSF (25, 26). Although its
destabilizing function is well documented, some studies suggest that
AUF1 may have a role in the stabilizing complex on the -globin mRNA (27) and, more recently, as a parathyroid hormone
mRNA-binding protein that modulates mRNA stability (28). AUF1
is comprised of four isoforms of 37, 40, 42, and 45 kDa (25, 29, 30). Although the role of each isoform has yet to be fully characterized, a
direct correlation has been observed between each AUF1 isoform's binding affinity and its RNA-destabilizing activity toward different AREs, with isoforms p37 and p42 being the most effective (31).
Here, we demonstrate that AUF1 is a bcl-2 mRNA-binding
protein and that potentially all its isoforms are able to form
complexes with the bcl-2 ARE. At doses able to induce
apoptosis, UVC irradiation induced an increase of cytoplasmic levels
of the p45 AUF1 isoform, which was paralleled by
enhancement of a bcl-2 mRNA-AUF1 complex and mediated by
a mechanism that requires caspase activation. These results indicate
that ARE-mediated bcl-2 mRNA down-regulation during
apoptosis involves AUF1 and suggest different roles for its four isoforms.
 |
EXPERIMENTAL PROCEDURES |
Plasmids Used for in Vitro Transcription and
Transfection--
The schematic diagram of bcl-2 mRNA
and the sequences of ARE segments used for either in vitro
transcription or cell transfection are shown in Fig. 1. A 396-bp
segment encoding the human bcl-2 mRNA located in the
3'-UTR from nucleotide 752-1147, named bcl-2 ARE+
(GenBankTM accession number M14745; Ref. 32), was obtained
by PCR amplification using the plasmid pBS-SK-H-Bcl-2 (33) as template,
with 5'- AGTCAACATGCCTGC-3' forward (FW1) and 5'- GTGATCCGGCCAACAAC-3' reverse (RV2) primers. The bcl-2 ARE+ was cloned in the TA
cloning site of the pCRII plasmid according to the TA Cloning Kit
specifications (Invitrogen), yielding pCRII/bcl-2 ARE+, and
used to synthesize the bcl-2 ARE+ riboprobe. A 289-bp
segment of the human bcl-2 mRNA located in the 3'-UTR
from nucleotide 752-1147, named bcl-2 ARE, was obtained
by nested deletion of the cDNA from nucleotide 944-1050 (32) using
the plasmid pBS-SK-H-Bcl-2 (33) as template. Two partially overlapping
PCR products were synthesized for this purpose. The first PCR product
was amplified with FW1, as described above, and
5'-TTCGACGTTTTGCCTGAAGACT-3' reverse (RV1) primers. The
second PCR product was amplified with 5'-
CAAAACGTCGAACGACCACTAATTGCCAAGC -3' (FW2) and RV2 primers.
The 12 overlapping nucleotides are underlined in RV1 and FW2
primers. The segment bcl-2 ARE was cloned in plasmid
pCRII as described above, yielding pCRII/bcl-2 ARE, and
used for the synthesis of bcl-2 ARE riboprobe. A
107-bp segment of human bcl-2 mRNA located in the 3'-UTR
from nucleotide 944-1050 (a short region with the highest evolutionary
conservation containing AUUUA pentamers and UUAUUUAUU nonamer
particularly rich in A + U motifs and therefore considered the ARE
core), named bcl-2 ARE (32), was obtained by PCR
amplification using the plasmid pBS-SK-H-Bcl-2 (33) as template, with
5'-TCAGCTATTTACTGCCAAAG-3' forward and 5'-GATTTCCAAAGACAGGAG-3' reverse
primers. The bcl-2 ARE product was cloned in pCRII as
described above, yielding pCRII/bcl-2 ARE to synthesize the
bcl-2 ARE riboprobe. The remaining polylinkers of
pCRII/bcl-2 ARE+, pCRII/bcl-2 ARE, and
pCRII/bcl-2 ARE were removed by ApaI digestion
and religation. Plasmids pBBB4 (obtained by Dr. Ann-Bin Shyu,
University of Texas, Houston Health Science Center, Houston, TX) and
pBBB-U1 have been described previously (8). Plasmid pBBB-U2 was
obtained by cloning the BglII/BamHI segment of
pCRII/bcl-2 ARE into the unique BglII site of
plasmid pBBB4. Plasmids pBBB4, pBBB-U1, and pBBB-U2, used for RNase
protection analysis of mRNA stability, contain the rabbit
-globin gene transcriptionally driven by the serum-inducible
c-fos promoter (pBBB4) with inserted the bcl-2
ARE (pBBB-U1) or bcl-2 ARE (pBBB-U2).
Cell Lines and Transfections--
The Jurkat T-cell leukemia
line (clone E61; European Collection of Animal Cell Cultures)
was cultured in RPMI 1640 medium supplemented with 10% fetal calf
serum, 2 mM glutamine, 50 IU/ml penicillin, and 50 µg/ml
streptomycin in a humidified atmosphere, 5% CO2, at
37 °C. The two mouse fibroblast NIH 3T3 polyclonal cell lines
transfected with plasmids pBBB4 or pBBB-U1 have been described
previously (8). The third NIH 3T3 polyclonal cell line was obtained
upon transfection with plasmid pBBB-U2 described above. All NIH 3T3
cell lines were maintained in Dulbecco's modified Eagle's medium
supplemented as described above for RPMI 1640 medium.
RNase Protection Assays--
Reporter -globin mRNA
stability was determined by the serum-inducible transcriptional pulse
system reported previously (8).
In VitroTranscription--
The plasmids pCRII/bcl-2
ARE+, pCRII/bcl-2 ARE, and pCRII/bcl-2 ARE
were linearized with SmaI and used for in vitro
run-off transcription from the T7 promoter using an RNA labeling Kit
(Amersham Biosciences) in the presence of [ -32P]UTP
(800 Ci/mmol; Amersham Biosciences) to obtain three radiolabeled bcl-2 ARE riboprobes (Fig. 1).
In VitroTranslation--
The isoforms of AUF1 were prepared
from 1 µg of each of four different pcDNA-AUF1 plasmids (p45,
p42, p40, and p37). Templates p45 and p42 were prepared by
NotI digestion, whereas templates of p37 and p40 were
prepared by ApaI digestion. The cDNAs were in
vitro-transcribed/translated in the presence or absence of [35S]methionine (Amersham Biosciences) with the
TnT-coupled reticulocyte lysate system (Promega, Madison, WI)
according to the manufacturer's instructions.
RNA Electrophoretic Mobility Shift Assay (REMSA) and
REMSA/Supershift--
Cells (107) induced to apoptosis by
irradiation with UVC (15 J/m2, 254 nm), with or without a
2-h pretreatment with 100 µM Z-VAD-fmk (Bachem
AG), were collected at various time points, washed with ice-cold
phosphate-buffered saline, and lysed in 100 µl of lysis buffer (10 mM HEPES, pH 7.9, 40 mM KCl, 3 mM
MgCl2, 1 mM dithiothreitol, 5% glycerol, 0.2%
Nonidet P-40, 1 µg/ml leupeptin, 1 µg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride) for 10 min on ice. Nuclei were pelleted by centrifugation at 14,000 rpm for 30 s in a
microcentrifuge, and extracts were processed immediately or stored at
70 °C. REMSAs were performed by incubating the radiolabeled
bcl-2 ARE+, bcl-2 ARE, and bcl-2
ARE riboprobes (5 × 105 cpm) with cytoplasmic protein
extracts (30 µg, determined by BCA reagent; Pierce) or with in
vitro synthesized AUF1 isoforms in a reaction mixture (20 µl)
containing 10 mM Tris, pH 7.5, 0.1 M potassium
acetate, 5 mM magnesium acetate, 2 mM
dithiothreitol, 15 units of RNasin (Promega), and 50 µg of heparin
for 20 min at room temperature, followed by digestion for 20 min at
room temperature with 5 units of RNase T1 (La Roche Ltd.), which cuts RNA downstream to guanosine residues in a number of fragments. Samples
were separated on a native polyacrylamide gel (6%
polyacrylamide:bisacrylamide, 60:1). In REMSA/supershift experiments,
RNase T1 was added after incubation of samples with 50 µg/ml
polyclonal rabbit anti-AUF1 antibody (Ab) or with nonspecific control
anti-transketolase (TK) polyclonal Ab, a kind gift of Prof. F. Paoletti
(University of Florence), for 20 min at room temperature,
electrophoresed as described above, and exposed to Hyperfilm MP
(Amersham Biosciences).
Western Blot Analysis--
Cytoplasmic proteins (50 µg,
prepared as described above) were separated by 12.5% SDS-PAGE,
electroblotted (Miniprotean apparatus; Bio-Rad) onto Hybond-C membrane
(Amersham Biosciences), and detected with ECL Western blotting analysis
system (Amersham Biosciences) with 300 ng/ml anti-AUF1 Ab. Each isoform
was identified on the basis of molecular mass markers
(Bio-Rad).
UV-Cross-linking Assay and Immunoprecipitation--
Aliquots of
cytoplasmic proteins (50 µg, prepared as described above) were
incubated with the 32P-labeled bcl-2 ARE
riboprobe (109 cpm/µg, 5 × 105 cpm) in
the presence of 0.5 mg/ml heparan sulfate and 2 µg of tRNA in a
microplate (total volume, 10 µl) at room temperature for 10 min.
RNA-protein complexes were cross-linked on ice by exposure to UVC for 5 min with 3000 µW/cm2 in a Stratalinker 1800 (Stratagene).
Samples were incubated with RNase A (1 µl, 1 mg/ml) for 30 min at
37 °C to digest unbound RNA. Proteins were immunoprecipitated by a
1-h incubation with polyclonal anti-AUF1 rabbit Ab (10 µg/ml),
followed by overnight incubation with protein A-agarose (Sigma) at
4 °C. The immunoprecipitates were separated by 12.5% SDS-PAGE,
autoradiographed, and analyzed by a Storm PhosphorImager (Molecular
Dynamics). The molecular mass of each complex was evaluated
on the basis of the in vitro-synthesized radiolabeled
isoforms used as external standards and molecular mass markers
(Bio-Rad).
The RNA Three-hybrid System (THS)--
The yeast strain L40-coat
and plasmids pIIIA/MS2-1, pIIIA/IRE-MS2, pAD-IRP1, and pACT2 (34) were
gifts from Dr. M. Wickens (University of Wisconsin). The plasmid pRevR2
(35) was a gift from Dr. U. Putz (University of Hamburg, Hamburg,
Germany). The hybrid RNA vector pIIIA/MS2-B2ARE harbors the
107-nucleotide sequence of the bcl-2 ARE region. The
sequence was PCR-amplified from pBS-SK-H-Bcl-2, with
5'-GACCCGGGTCAGCTATTTACTGCCAAAG-3' forward and
5'-GACCCGGGGATTTCCAAAGACAGGAG-3' reverse primers, subcloned in pCRII
vector (Invitrogen), and inserted into the SmaI site of
plasmid pIIIA/MS2-1. The resulting plasmid, pIIIA/MS2-bcl2, was
transformed into L40-coat, and the chimeric RNA levels were assayed by
Northern analysis (data not shown). To prevent transcription
termination due to an RNA polymerase III termination signal in
the poly-U stretch, a mutation at nucleotide 981 was introduced by PCR.
The mispaired primers 5'-CATTTATTTgTTACATTATTAAG-3' (forward)
and 5'-CTTAATAATGTAAcAAATAAATG (reverse) were used to insert a
single-base substitution (T G, as indicated by lowercase letters), and the resulting segment was cloned into the
pIIIA/MS2-1 plasmid as described previously. The AUF1 cDNA
corresponding to the first 257 amino acids of p37 was amplified from
pBAD/HISB-p37AUF1 (36) with the
5'-GAGGATCCGAATGTCGGAGGAGCAG-3' forward and
5'-GACTCGAGTCTTCCTGCAAATCCTCC-3' reverse primers to test the
interaction between AUF1 and bcl-2 ARE. The PCR product was
digested and inserted into the BamHI/XhoI sites
of pACT2, in-frame with the GAL4 activation domain.
 |
RESULTS |
AUF1 Is a bcl-2 ARE-binding Protein Related to bcl-2 mRNA
Half-life Regulation--
In previous work (9), we demonstrated that
the mRNA-destabilizing ARE of bcl-2 binds specifically
to cytoplasmic AUBPs, whose pattern undergoes modifications during
apoptosis. The observation that proteins ranging from 30-50 kDa
underwent the most noticeable increase led us to hypothesize that AUF1
could be a bcl-2 ARE-binding protein. To examine this
possibility, REMSA supershift analysis of cytoplasmic protein complexes
with bcl-2 ARE radiolabeled riboprobes (Fig.
1) has been carried out using an
anti-AUF1 Ab and a nonspecific control anti-TK Ab (Fig.
2). When bcl-2 ARE+ or
bcl-2 ARE riboprobes are used, the anti-AUF1 Ab (lane
3 of each panel), but not the nonspecific anti-TK Ab (lane
4 of each panel), is able to produce a supershifted complex,
indicating AUF1 binding. By contrast, when the bcl-2 ARE
riboprobe (in which the 107-nt ARE core was deleted) was used,
supershift did not occur, indicating no AUF1 binding. Other REMSA
experiments have been carried out with each AUF1 isoform (p37, p40,
p42, and p45) synthesized in vitro. As shown in Fig.
3, all AUF1 isoforms shift
bcl-2 ARE+ and bcl-2 ARE riboprobes but not the
bcl-2 ARE riboprobe, indicating that binding of the
bcl-2 mRNA to AUF1 requires the ARE core.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic diagram of bcl-2
mRNA and sequences of ARE segments used for either in
vitro transcription or cell transfection. bcl-2
ARE+, a 396-nt segment of bcl-2 3'-UTR ranging from
nucleotide 752-1147 of the bcl-2 cDNA sequence
(GenBankTM accession number M14745) and containing the ARE.
bcl-2 ARE, an 107-nt ARE that is a segment of
bcl-2 3'-UTR ranging from nucleotide 944-1050 of the
bcl-2 evolutionary conserved cDNA sequence and harboring
A + U-rich motifs. bcl-2 ARE, a 289-nt segment
of bcl-2 3'-UTR ranging from nucleotide 752-1147 of the
bcl-2 cDNA sequence (GenBankTM accession
number M14745) carrying a deletion of 107 bp from nucleotide 944-1050
corresponding to the ARE core.
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Detection of AUF1 binding to the
bcl-2 ARE by REMSA/supershift. Left
panel, REMSA/supershifts with bcl-2 ARE+.
Lane 1, bcl-2 ARE+ riboprobe; lane
2, bcl-2 ARE+ riboprobe incubated with cytoplasmic
extracts; lane 3, bcl-2 ARE+ riboprobe
incubated with cytoplasmic extracts and anti-AUF1 Ab; lane
4, bcl-2 ARE+ riboprobe incubated with cytoplasmic
extracts and anti-TK Ab. Center panel,
REMSA/supershifts with bcl-2 ARE. Lane 1,
bcl-2 ARE riboprobe; lane 2,
bcl-2 ARE riboprobe incubated with cytoplasmic extracts;
lane 3, bcl-2 ARE riboprobe incubated with
cytoplasmic extracts and anti-AUF1 Ab; lane 4,
bcl-2 ARE riboprobe incubated with cytoplasmic extracts and
anti-TK Ab. Right panel, REMSA/supershifts with
bcl-2 ARE. Lane 1, bcl-2
ARE riboprobe; lane 2, bcl-2 ARE
riboprobe incubated with cytoplasmic extracts; lane 3,
bcl-2 ARE riboprobe incubated with cytoplasmic extracts
and anti-AUF1 Ab; lane 4, bcl-2 ARE
riboprobe incubated with cytoplasmic extracts and anti-TK Ab.
Lane 1 indicates free RNA digested with RNase T1. Complexes
and supershifts are indicated.
|
|

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 3.
Binding of all AUF1 isoforms to the
bcl-2 ARE. All AUF1 isoforms synthesized in
vitro were assayed in REMSA experiments for RNA binding activity
with the three ARE riboprobes. Left panel, the
bcl-2 ARE+ riboprobe incubated with each AUF1 isoform.
Center panel, the bcl-2 ARE riboprobe
incubated with each AUF1 isoform. Right panel, the
bcl-2 ARE riboprobe incubated with each AUF1 isoform.
FR represents free RNA digested with RNase T1. p37,
p40, p42, and p45 indicate each AUF1 isoform used in
shift experiments. Complexes are indicated.
|
|
To evaluate the possibility that mRNA destabilizing activity and
AUF1 binding of the bcl-2 ARE are two related events,
analysis of mRNA half-life in cells expressing a reporter gene with
or without the bcl-2 ARE was performed. For this purpose,
three NIH 3T3 cell lines stably expressing a rabbit -globin gene
transcriptionally driven by the c-fos serum-inducible
promoter with either bcl-2 ARE+ (pBBB-U1) or the ARE-deleted
bcl-2 ARE (pBBB-U2) or without insert (pBBB4) were used.
Following serum addition to induce a pulse of transcription of each
reporter gene, total RNA was extracted at various times, and -globin
mRNA levels were quantitated by RNase protection using
glyceraldehyde-3-phosphate dehydrogenase as an internal standard (Fig.
4). With respect to the -globin transcript without insert (BBB4), the insertion of bcl-2
ARE+ (BBB-U1), which binds AUF1, reduces the half-life of reporter mRNA by 6-fold (from >12 h to 2 h). The insertion of
bcl-2 ARE (BBB-U2), which does not bind AUF1, does not
affect the half-life of -globin mRNA.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
Decay of
-globin mRNAs containing bcl-2
3'-UTR sequences. NIH 3T3 cells were stably transfected with
the chimeric constructs pBBB4 (rabbit -globin gene), pBBB-U1
(bcl-2 ARE+ in rabbit -globin 3'-UTR), and pBBB-U2
(bcl-2 ARE in rabbit -globin 3'-UTR). After serum
starvation, 15% fetal calf serum was added to induce a pulse of
transcription, and total RNA was extracted at the indicated time
points. Autoradiograms show the representative PAGE analysis after
RNase protection assays using two probes containing a 188-nt segment of
the rabbit -globin mRNA or a 120-nt segment of the murine
glyceraldehyde-3-phosphate dehydrogenase mRNA, respectively.
Phosphorimager-derived values of the rabbit -globin protected
segments have been normalized for the relevant values of the endogenous
glyceraldehyde-3-phosphate dehydrogenase protected segment. Results
shown on the graph are the means ± S.E. of three independent
experiments.
|
|
All these results clearly indicate that the 107 nt of the ARE of
bcl-2 (shared by bcl-2 ARE and bcl-2
ARE+), but not its flanking regions (bcl-2 ARE), contain
the binding site for AUF1 and are also required for mRNA
destabilizing activity. Thus, we have used the bcl-2 ARE as
a riboprobe in further experiments.
We assumed that the smallest isoform, p37, was the prototype of AUF1
because its entire sequence, harboring two RNA recognition motifs, is
contained in the other three isoforms. The yeast RNA THS was used to
demonstrate that recombinant p37 binds to the ARE of bcl-2 in
vivo (Fig. 5). The reporter gene
activation of the host yeast was tested in parallel with the indicated
positive and negative controls. The 1-257-amino acid segment of p37
containing the two RNA recognition motifs of AUF1 elicited the
activation of both LacZ and HIS3 genes, clearly demonstrating that
binding of AUF1 to the bcl-2 ARE also occurs in
vivo (Fig. 5).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5.
Detection in vivo of p37
AUF1-ARE interaction by RNA THS. The RNA THS was used to
study the interaction of AUF1 with the bcl-2 ARE in
vivo. We tested the indirect interaction between GAL4 activating
domain (AD) fused to 1-257 amino acids of p37 AUF1
(p37) and LexA binding domain (LexA) fused to MS2
coat protein (MS2) by means of a bridging chimeric RNA
containing the bcl-2 ARE (B2ARE) and MS2
consensus sequence (MS2cs). The interaction is documented by
transcription of the reporter genes LacZ and HIS3. The two components
present in each chimeric factor of the system are depicted in the
proper polarity, either N-terminal to C-terminal or 5' to 3'. Fusion
proteins are depicted in boxes (black and
gray boxes for hybrid protein 1 and hybrid protein 2, respectively), with each box corresponding to a single domain. p37 AUF1
(a, row 2) is able to activate LacZ gene
(light blue-stained colonies; b, row
2) or HIS3 gene transcription (growth on Leu, His medium
containing 3 mM 3-aminotriazole; c,
sector 2) when the B2ARE-containing transcript is expressed,
but not in the presence of transcript lacking the B2ARE (a
and b, row 6; c, sector 6).
Iron response protein 1 (IRP1) is a positive control when
assayed for binding to iron-responsive element (IRE)
(a and b, row 1; panel c,
sector 1) or a negative one when assayed for binding to
B2ARE (a and b, row 5; c,
sector 5). HIV-1 Rev is a RNA regulatory element-interacting
protein used as a negative control when assayed for binding to B2ARE
(a and b, row 4; panel c,
sector 4). AD alone provided an additional negative control
(a and b, row 3; panel c,
sector 3). Furthermore, the utilized yeast strain (L40-coat)
is ade2. Consequently, it accumulates a metabolite, resulting in
pink-stained colonies. The plasmid coding the bridging RNA
harbors the ADE2 gene that restores the white phenotype. This allows
for selection of transformants where plasmid coding the bridging RNA is
necessary for reporter transcription.
|
|
An Increase of AUF1 and the bcl-2 mRNA-AUF1 Complex Are
Associated with UVC-induced Apoptosis and Are Partially Prevented by
the Caspase Inhibitor Z-VAD-fmk--
The possibility that enhanced
decay of bcl-2 mRNA during apoptosis (8, 9) is
associated with changes of AUF1 levels was evaluated. Jurkat cells were
irradiated with UVC at a dose previously established to commit cells to
apoptosis (data not shown). REMSA experiments demonstrated an increase
of the supershifted AUF1-bcl-2 ARE complex at 8 h
compared with no UVC (Fig. 6, compare lane 3 with lane 4). To establish the involvement
of the AUF1 isoforms in the increase of supershifted complex, we
carried out time course Western blot analyses and immunoprecipitation
experiments of UV-cross-linked complexes with anti-AUF1 Ab (Fig.
7, a and b,
respectively). Each AUF1 isoform was identified by immunodetection and
comparison with standard molecular mass markers. During the time course
(0-10 h) after apoptotic stimulation (Fig. 7a), the cytoplasmic p45 isoform markedly increased within 2 h after UVC irradiation, peaking at 10 h. Pretreatment with Z-VAD-fmk
attenuated this increase by 2-3-fold. The increase of p37 and
p40/p42 isoforms after UVC irradiation was very low and was not
affected by Z-VAD-fmk pretreatment. To determine whether the AUF1
variations observed during apoptosis are accompanied by an increase of
some isoform-specific ARE binding activity, immunoprecipitation
analyses of UV-cross-linked complexes were performed (Fig.
7b). Standard molecular mass markers and labeled AUF1
isoforms translated in vitro and run in the same gel were
used for comparison. During the time course, the AUF1 isoform-bcl-2 ARE complex with an apparent molecular mass of
about 45 kDa underwent a marked increase, which paralleled the increase of p45 AUF1 (Fig. 7a) in Western analysis and,
analogously, is attenuated by pretreatment with Z-VAD-fmk. Another
complex with lower molecular mass (about 37 kDa) was detected as a very faint band. No other complexes have been detected within the molecular mass range of the AUF1 isoforms. The additional bands with higher molecular masses observed in the immunoprecipitate (indicated by
double-headed arrows) may represent AUF1 isoform dimers or multimers stabilized by UV-cross-linking. From all described results, we conclude that AUF1 is a bcl-2 AUBP and that an
isoform-specific mechanism is involved in ARE-mediated bcl-2
mRNA decay during apoptosis. Furthermore, our results suggest that
the p45 AUF1 isoform is the most likely candidate to play a pivotal
role in this mechanism.

View larger version (65K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of UVC irradiation on AUF1
(REMSA/supershift). Lane 1, bcl-2 ARE
riboprobe; lane 2, bcl-2 ARE riboprobe
incubated with cytoplasmic extracts; lane 3,
bcl-2 ARE riboprobe incubated with cytoplasmic extracts and
anti-AUF1 Ab; lane 4, bcl-2 ARE riboprobe
incubated with cytoplasmic extracts from UVC-treated cells irradiated
for 8 h and anti-AUF1 Ab. Lane 1 indicates free RNA
digested with RNase T1. Complexes and supershifts are indicated.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of UVC irradiation on AUF1 levels and
bcl-2 ARE/AUF1 binding. Western blots
(a) and immunoprecipitations (b) were carried out
with cytoplasmic extracts from Jurkat cells obtained at various time
points after UVC irradiation that had been pretreated or not pretreated
with Z-VAD-fmk, as indicated. In Western blot analysis, immunodetection
and molecular mass markers run in the same gel were used to identify
each AUF1 isoform. In immunoprecipitation experiments, the extracts
were cross-linked with the bcl-2 ARE riboprobe before
incubation with the anti-AUF1 Ab. The molecular mass of the complexes
was evaluated on the basis of labeled, in vitro-synthesized
AUF1 isoforms and molecular mass markers run in the same gel.
Double-headed arrows in b indicate other
complexes with higher molecular masses than the 45-kDa complex.
Quantitations of Western blots and immunoprecipitations are shown to
the right in each panel.
|
|
 |
DISCUSSION |
bcl-2 is one of the most studied apoptosis-related
genes and is also implicated in cell cycle progression and cell
differentiation. The expression of bcl-2 can be finely tuned
by a variety of environmental or endogenous stimuli and regulated at
both transcriptional (5, 33) and posttranscriptional levels (8). The
diverse modes of regulation of bcl-2 expression probably
reflect different requirements for down- or up-regulation in different
physiological conditions or in pathological processes.
We described a posttranscriptional level of regulation of
bcl-2 expression that is mediated by an ARE in the 3'-UTR of
bcl-2 mRNA. Under normal conditions, this element has a
moderate destabilizing activity toward the bcl-2 transcript.
This activity increases following apoptotic stimuli, leading to
enhanced bcl-2 mRNA degradation (8). The
bcl-2 mRNA ARE binds to a number of AUBPs whose
electrophoretic pattern changes after induction of apoptosis (9). A
number of AUBPs that modulated mRNA stability have been described
for other ARE-containing mRNAs such as VEGF (37, 38),
GM-CSF (39, 40), and c-fos (15, 41, 42). We first
demonstrated that AUF1 is a bcl-2 AUBP involved in
bcl-2 down-regulation during apoptosis. AUF1 is a
heterogeneous nuclear ribonucleoprotein protein implicated in mRNA
stability regulation, and it shuttles dynamically between the nucleus
and cytoplasm (43). Although the four isoforms of AUF1, namely, p45,
p42, p40, and p37 (29, 30), are present in both the nucleus and
cytoplasm of Jurkat cells (data not shown), all our experiments have
been carried out using cytoplasmic extracts because the cytoplasm is
the compartment of mRNA degradation. The binding of AUF1 to the ARE
of bcl-2 was demonstrated in vitro by means of
supershift REMSA experiments. The cytoplasmic extracts were incubated
simultaneously with bcl-2 ARE radiolabeled riboprobes and
either anti-AUF1 or anti-TK Ab. In these experiments, only the specific
anti-AUF1 Ab was able to supershift the bcl-2 ARE-protein complex. All AUF1 isoforms (p37, p40, p42, and p45) have the potential to bind to the bcl-2 mRNA, as indicated in
vitro by results obtained in REMSA experiments carried out with
each single in vitro-synthesized isoform. Using p37,
considered as the AUF1 prototype, in the yeast RNA THS we demonstrated
that the AUF1 RNA binding motifs common to all four isoforms are also
able to bind to the bcl-2 ARE in vivo.
Deletion of the evolutionary conserved ARE segment particularly rich in
AU motifs (and therefore considered as the ARE core) not only abolishes
the ability of the bcl-2 ARE to bind AUF1 but also abolishes
its mRNA destabilizing activity. This indicates that the deleted
segment harbors the binding site for AUF1 and that AUF1 is required as
a trans-acting factor for functional activity of the bcl-2
ARE.
The implication of AUF1 as a trans-acting factor involved in
ARE-mediated, bcl-2 mRNA degradation during apoptosis
was further demonstrated by results obtained in supershift REMSA
experiments carried out after UVC irradiation of cultured cells.
Furthermore, we found that the level of the p45 isoform, as evaluated
by Western blot, increased markedly until 10 h after UVC
irradiation. In the same extracts, the level of one
AUF1-bcl-2 ARE complex paralleled the increased level of p45
AUF1, and its molecular mass was also about 45 kDa. This complex was
also the only one to undergo a clear decrease in Z-VAD-fmk-treated
cells compared with untreated cells. This decrease also parallels the
decrease in the 45-kDa isoform observed by Western blot of extracts
from cells pretreated with Z-VAD-fmk with respect to untreated cells.
Whereas these data are suggestive, the specific AUF1 isoform(s)
involved in bcl-2 ARE binding and mRNA degradation
during apoptosis could not be precisely identified on the basis of its
molecular mass. Nevertheless, our results indicate that at least one
AUF1 isoform is a candidate to play a pivotal role in this regulatory mechanism.
Arao et al. (43) found that p45 and p42 are predominantly
nuclear proteins and that, consequently, the observed increase, if
actually attributable to one of these isoforms, could be explained by
nuclear to cytoplasm shuttling. This possibility is supported by our
previous observation that the apoptotic stimulus by cycloeximide (50 µM), utilized to block protein synthesis, resulted in
an analogous increase in bcl-2 ARE-bound, cytoplasmic AUBPs
(9). In our model, the relative balance of the AUF1 isoforms seems to
determine the fate of the bcl-2 mRNA in response to
apoptotic stimuli. We speculate that this balance could be affected in
response to other types of endogenous and environmental stimuli.
Results obtained from Western blot as well as immunoprecipitation
assays suggest that binding of AUF1 isoforms to bcl-2
mRNA in cellular extracts could also depend on the other amino acid
sequence motifs by which the isoforms differ.
We also speculate that the scarce signal of the relatively low
molecular mass complex (about 37 kDa), the absence of other complexes
in the range of the AUF1 molecular masses, and the presence of higher
molecular mass complexes in immunoprecipitates could result from the
AUF1 isoform ability to multimerize as reported by Wilson et
al. (44). Our results also strengthen the hypothesis that the
various isoforms of AUF1 may reflect the need of cells to
differentially modulate ARE-containing mRNAs during apoptosis. Furthermore, mRNA turnover of ARE-containing genes has already been
demonstrated to be a finely tuned process. For example, Wang et
al. (24) demonstrated that the ARE-containing mRNA of
p21waf1, a p53-inducible gene responsible for cell
cycle inhibition upon UVC irradiation, was stabilized by the AUBP HuR.
This would account for the arrest of cell growth that occurs at the
first stages of apoptosis. Other conditions, such as hemin-induced
erythroid differentiation, are able to impair ARE activity by
sequestration of AUF1 into a complex of proteins (45).
 |
ACKNOWLEDGEMENTS |
We thank Drs. A.-B. Shyu, M. Wickens, and U. Putz for plasmids, Prof. F. Paoletti for transketolase polyclonal
antibody, and Marco Cutrì for technical support.
 |
FOOTNOTES |
*
This work was supported by grants from the Associazione
Italiana Ricerca sul Cancro, Ministero dell'Università e Ricerca Scientifica e Tecnologica, and Ente Cassa di Risparmio di Firenze (to
S. C.) and National Institutes of Health Grant CA 52443 (to G. B.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this work.
¶
Recipient of a fellowship from the Federazione Italiana
Ricerca Cancro.

To whom correspondence may be addressed: Dept. of Experimental
Pathology and Oncology, School of Medicine, University of Florence, Viale G.B. Morgagni 50, 50134 Florence, Italy. Tel.: 390-55-4282309; Fax: 390-55-4282333; E-mail: sergio@unifi.it (S. C.) or
nicola{at}unifi.it (N. S.).
Published, JBC Papers in Press, February 20, 2002, DOI 10.1074/jbc.M201377200
 |
ABBREVIATIONS |
The abbreviations used are:
ARE, A + U-rich
element;
AUBP, ARE-binding protein;
THS, three-hybrid system;
REMSA, RNA electrophoretic mobility shift assay;
Ab, antibody;
UTR, untranslated region;
TK, transketolase;
nt, nucleotide(s);
Z-VAD-fmk, benzyloxycarbonylVal-Ala-Asp(OMe)-fluoromethylketone.
 |
REFERENCES |
| 1.
|
Tsujimoto, Y.,
and Shimizu, S.
(2000)
FEBS Lett.
466,
6-10[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Suzuki, A.,
Matsuzawa, A.,
and Igushi, T.
(1996)
Oncogene
13,
31-37[Medline]
[Order article via Infotrieve]
|
| 3.
|
Miyashita, T.,
Krajewski, S.,
Krajewska, M.,
Wand, H.-G.,
Lin, H.-K.,
Hoffman, B.,
Lieberman, D.,
and Reed, J. C.
(1994)
Oncogene
9,
1799-1805[Medline]
[Order article via Infotrieve]
|
| 4.
|
Young, R. L.,
and Korsmeyer, S. J.
(1993)
Mol. Cell. Biol.
13,
3686-3697[Abstract/Free Full Text]
|
| 5.
|
Perillo, B.,
Sasso, A.,
Abbondanza, C.,
and Palumbo, G.
(2000)
Mol. Cell. Biol.
20,
2890-2901[Abstract/Free Full Text]
|
| 6.
|
Huang, Y.,
Sheikh, M. S.,
Fornace, A. J., Jr.,
and Holbrook, N. J.
(1999)
Oncogene
18,
3431-3439[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Breitschopf, K.,
Haendeler, J.,
Malchow, P.,
Zeiher, A. M.,
and Dimmeler, S.
(2000)
Mol. Cell. Biol.
20,
1886-1896[Abstract/Free Full Text]
|
| 8.
|
Schiavone, N.,
Rosini, P.,
Quattrone, A.,
Donnini, M.,
Lapucci, A.,
Citti, L.,
Bevilacqua, A.,
Nicolin, A.,
and Capaccioli, S.
(2000)
FASEB J.
14,
174-184[Abstract/Free Full Text]
|
| 9.
|
Donnini, M.,
Lapucci, A.,
Papucci, L.,
Witort, E.,
Tempestini, A.,
Brewer, G.,
Bevilacqua, A.,
Nicolin, A.,
Capaccioli, S.,
and Schiavone, N.
(2001)
Biochem. Biophys. Res. Commun.
287,
1063-1069[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Chen, C. Y.,
and Shyu, A. B.
(1995)
Trends Biochem. Sci.
20,
465-470[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Xu, N.,
Loflin, P.,
Chen, C. Y.,
and Shyu, A. B.
(1998)
Nucleic Acids Res.
26,
558-565[Abstract/Free Full Text]
|
| 12.
|
Rodriguez-Pascual, F.,
Hausding, M.,
Ihrig-Biedert, I.,
Furneaux, H.,
Levy, A. P.,
Forstermann, U.,
and Kleinert, H.
(2000)
J. Biol. Chem.
275,
26040-26049[Abstract/Free Full Text]
|
| 13.
|
Madireddi, M. T.,
Dent, P.,
and Fisher, P. B.
(2000)
Oncogene
19,
1362-1368[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Shaw, G.,
and Kamen, R.
(1986)
Cell
46,
659-667[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
You, Y.,
Chen, C. Y.,
and Shyu, A. B.
(1992)
Mol. Cell. Biol.
12,
2931-2940[Abstract/Free Full Text]
|
| 16.
|
Winstall, E.,
Gamache, M.,
and Rayamond, V.
(1995)
Mol. Cell. Biol.
15,
3796-3804[Abstract]
|
| 17.
|
Dreyfuss, G.,
Matunis, M. J.,
Pinol-Roma, S.,
and Burd, C. G.
(1993)
Annu. Rev. Biochem.
62,
289-321[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Krecic, A. M.,
and Swanson, M. S.
(1999)
Curr. Opin. Cell Biol.
11,
363-371[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Peng, S. S.,
Chen, C. Y., Xu, N.,
and Shyu, A. B.
(1988)
EMBO J.
17,
3461-3470
|
| 20.
|
Maurer, F.,
Tierney, M.,
and Medcalf, R. L.
(1999)
Nucleic Acids Res.
27,
1664-1673[Abstract/Free Full Text]
|
| 21.
|
Levy, N. S.,
Chung, S.,
Furneaux, H.,
and Levy, A. P.
(1998)
J. Biol. Chem.
273,
6417-6423[Abstract/Free Full Text]
|
| 22.
|
Fan, X. C.,
and Steits, J. A.
(1998)
EMBO J.
17,
3448-3460[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Blaxall, B. C.,
Dwyer-Nield, L. D.,
Bauer, A. K.,
Bohlmeyer, T. J.,
Malkinson, A. M.,
and Port, J. D.
(2000)
Mol. Carcinog.
28,
76-83[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Wang, W.,
Furneaux, H.,
Cheng, H.,
Caldwell, M. C.,
Hutter, D.,
Liu, Y.,
Holbrook, N.,
and Gorospe, M.
(2000)
Mol. Cell. Biol.
20,
760-769[Abstract/Free Full Text]
|
| 25.
|
Zhang, W.,
Wagner, B. J.,
Ehrenman, K.,
Schaefer, A. W.,
DeMaria, C. T.,
Crater, D.,
DeHaven, K.,
Long, L.,
and Brewer, G.
(1993)
Mol. Cell. Biol.
13,
7652-7665[Abstract/Free Full Text]
|
| 26.
|
Brewer, G.
(1991)
Mol. Cell. Biol.
11,
2460-2466[Abstract/Free Full Text]
|
| 27.
|
Kiledijian, M.,
DeMaria, C. T.,
Brewer, G.,
and Novick, K.
(1997)
Mol. Cell. Biol.
11,
4870-4876
|
| 28.
|
Sela-Brown, A.,
Silver, J.,
Brewer, G.,
and Naveh-Many, T.
(2000)
J. Biol. Chem.
275,
7424-7429[Abstract/Free Full Text]
|
| 29.
|
Sheflin, L. G.,
and Spaulding, S. W.
(2000)
Am. J. Physiol. Endocrinol. Metab.
278,
E50-E57[Abstract/Free Full Text]
|
| 30.
|
Wagner, B. J.,
DeMaria, C. T.,
Sun, Y.,
and Brewer, G.
(1998)
Genomics
48,
195-202[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
De Maria, C. T.,
and Brewer, G.
(1996)
J. Biol. Chem.
271,
12179-12184[Abstract/Free Full Text]
|
| 32.
|
Cleary, M. L.,
Smith, S. D.,
and Sklar, J.
(1986)
Cell
47,
19-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Seto, M.,
Jaeger, U.,
Hockett, R. D.,
Graninger, W.,
Bennett, S.,
Goldman, P.,
and Korsmeyer, S. J.
(1988)
EMBO J.
7,
123-131[Medline]
[Order article via Infotrieve]
|
| 34.
|
Kraemer, B.,
Zhang, B.,
Sen Gupta, D.,
Fields, S.,
and Wickens, M.
(2000)
Methods Enzymol.
328,
297-321[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Putz, U.,
Skehel, P.,
and Kuhl, D.
(1996)
Nucleic Acids Res.
24,
4838-4840[Abstract/Free Full Text]
|
| 36.
|
Wilson, G.,
and Brewer, G.
(1999)
Methods
17,
74-83[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Claffey, K. P.,
Shih, S. C.,
Mullen, A.,
Dziennis, S.,
Cusick, J. L.,
Abrams, K. R.,
Lee, S. W.,
and Detmar, M.
(1998)
Mol. Biol. Cell
9,
469-481[Abstract/Free Full Text]
|
| 38.
|
King, P. H.
(2000)
Nucleic Acids Res.
28,
E20[Medline]
[Order article via Infotrieve]
|
| 39.
|
Bickel, M.,
Iwai, Y.,
Pluznik, D. H.,
and Cohen, R. B.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10001-10005[Abstract/Free Full Text]
|
| 40.
|
Nakamaki, T.,
Imamura, J.,
Brewer, G.,
Tsuruoka, N.,
and Koeffler, H. P.
(1995)
J. Cell. Physiol.
165,
484-492[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Gillis, P.,
and Malter, J. S.
(1991)
J. Biol. Chem.
266,
3172-3177[Abstract/Free Full Text]
|
| 42.
|
Chung, S.,
Jiang, L.,
Cheng, S.,
and Furneaux, H.
(1996)
J. Biol. Chem.
271,
11518-11524[Abstract/Free Full Text]
|
| 43.
|
Arao, Y.,
Kuriyama, R.,
Kayama, F.,
and Kato, S.
(2000)
Arch. Biochem. Biophys.
380,
228-236[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Wilson, G. M.,
Sun, Y., Lu, H.,
and Brewer, G.
(1999)
J. Biol. Chem.
274,
33374-33381[Abstract/Free Full Text]
|
| 45.
|
Loflin, P.,
Chen, C. Y.,
and Shyu, A. B.
(1999)
Genes Dev.
13,
1884-1897[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Mazan-Mamczarz, Y. Kuwano, M. Zhan, E. J. White, J. L. Martindale, A. Lal, and M. Gorospe
Identification of a signature motif in target mRNAs of RNA-binding protein AUF1
Nucleic Acids Res.,
January 1, 2009;
37(1):
204 - 214.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Huang, S. Duan, E. O. Kistner, W. K. Bleibel, S. M. Delaney, D. L. Fackenthal, S. Das, and M. E. Dolan
Genetic Variants Contributing to Daunorubicin-Induced Cytotoxicity
Cancer Res.,
May 1, 2008;
68(9):
3161 - 3168.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Papucci, E. Witort, A. M. Bevilacqua, M. Donnini, M. Lulli, E. Borchi, K. S. A. Khabar, A. Tempestini, A. Lapucci, N. Schiavone, et al.
Impact of Targeting the Adenine- and Uracil-Rich Element of bcl-2 mRNA with Oligoribonucleotides on Apoptosis, Cell Cycle, and Neuronal Differentiation in SHSY-5Y Cells
Mol. Pharmacol.,
February 1, 2008;
73(2):
498 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bevilacqua, L. Ghisolfi, S. Franzi, G. Maresca, R. Gherzi, S. Capaccioli, A. Nicolin, and G. Canti
Stabilization of Cellular mRNAs and Up-Regulation of Proteins by Oligoribonucleotides Homologous to the Bcl2 Adenine-Uridine Rich Element Motif
Mol. Pharmacol.,
February 1, 2007;
71(2):
531 - 538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Banihashemi, G. M. Wilson, N. Das, and G. Brewer
Upf1/Upf2 Regulation of 3' Untranslated Region Splice Variants of AUF1 Links Nonsense-Mediated and A+U-Rich Element-Mediated mRNA Decay
Mol. Cell. Biol.,
December 1, 2006;
26(23):
8743 - 8754.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. D. Glaser, Y. O. Lukyanenko, Y. Wang, G. M. Wilson, and T. B. Rogers
JNK activation decreases PP2A regulatory subunit B56{alpha} expression and mRNA stability and increases AUF1 expression in cardiomyocytes
Am J Physiol Heart Circ Physiol,
September 1, 2006;
291(3):
H1183 - H1192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Schroeder, H. Ibrahim, L. Taylor, and N. P. Curthoys
Role of deadenylation and AUF1 binding in the pH-responsive stabilization of glutaminase mRNA
Am J Physiol Renal Physiol,
March 1, 2006;
290(3):
F733 - F740.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Barreau, L. Paillard, and H. B. Osborne
AU-rich elements and associated factors: are there unifying principles?
Nucleic Acids Res.,
January 3, 2006;
33(22):
7138 - 7150.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Blum, A. M. Samarel, and R. Mestril
Phosphorylation and binding of AUF1 to the 3'-untranslated region of cardiomyocyte SERCA2a mRNA
Am J Physiol Heart Circ Physiol,
December 1, 2005;
289(6):
H2543 - H2550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ghisolfi, L. Papucci, A. Bevilacqua, G. Canti, G. Tataranni, A. Lapucci, N. Schiavone, S. Capaccioli, and A. Nicolin
Increased Bcl2 Expression by Antisense Oligoribonucleotides Targeting the Adenine-Uridine-Rich Element Motif
Mol. Pharmacol.,
September 1, 2005;
68(3):
816 - 821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. J. Fialcowitz, B. Y. Brewer, B. P. Keenan, and G. M. Wilson
A Hairpin-like Structure within an AU-rich mRNA-destabilizing Element Regulates trans-Factor Binding Selectivity and mRNA Decay Kinetics
J. Biol. Chem.,
June 10, 2005;
280(23):
22406 - 22417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Machuy, B. Thiede, K. Rajalingam, C. Dimmler, O. Thieck, T. F. Meyer, and T. Rudel
A Global Approach Combining Proteome Analysis and Phenotypic Screening with RNA Interference Yields Novel Apoptosis Regulators
Mol. Cell. Proteomics,
January 1, 2005;
4(1):
44 - 55.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-H. Lee, M.-H. Jeon, Y.-J. Seo, Y.-J. Lee, J. H. Ko, Y. Tsujimoto, and J.-H. Lee
CA Repeats in the 3'-Untranslated Region of bcl-2 mRNA Mediate Constitutive Decay of bcl-2 mRNA
J. Biol. Chem.,
October 8, 2004;
279(41):
42758 - 42764.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Y. Brewer, J. Malicka, P. J. Blackshear, and G. M. Wilson
RNA Sequence Elements Required for High Affinity Binding by the Zinc Finger Domain of Tristetraprolin: CONFORMATIONAL CHANGES COUPLED TO THE BIPARTITE NATURE OF AU-RICH mRNA-DESTABILIZING MOTIFS
J. Biol. Chem.,
July 2, 2004;
279(27):
27870 - 27877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Donnini, A. Lapucci, L. Papucci, E. Witort, A. Jacquier, G. Brewer, A. Nicolin, S. Capaccioli, and N. Schiavone
Identification of TINO: A NEW EVOLUTIONARILY CONSERVED BCL-2 AU-RICH ELEMENT RNA-BINDING PROTEIN
J. Biol. Chem.,
May 7, 2004;
279(19):
20154 - 20166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. K. Sengupta, S. Bandyopadhyay, D. J. Fernandes, and E. K. Spicer
Identification of Nucleolin as an AU-rich Element Binding Protein Involved in bcl-2 mRNA Stabilization
J. Biol. Chem.,
March 19, 2004;
279(12):
10855 - 10863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Raineri, D. Wegmueller, B. Gross, U. Certa, and C. Moroni
Roles of AUF1 isoforms, HuR and BRF1 in ARE-dependent mRNA turnover studied by RNA interference
Nucleic Acids Res.,
February 19, 2004;
32(4):
1279 - 1288.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Wilson, J. Lu, K. Sutphen, Y. Sun, Y. Huynh, and G. Brewer
Regulation of A + U-rich Element-directed mRNA Turnover Involving Reversible Phosphorylation of AUF1
J. Biol. Chem.,
August 29, 2003;
278(35):
33029 - 33038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Wilson, J. Lu, K. Sutphen, Y. Suarez, S. Sinha, B. Brewer, E. C. Villanueva-Feliciano, R. M. Ysla, S. Charles, and G. Brewer
Phosphorylation of p40AUF1 Regulates Binding to A + U-rich mRNA-destabilizing Elements and Protein-induced Changes in Ribonucleoprotein Structure
J. Biol. Chem.,
August 29, 2003;
278(35):
33039 - 33048.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. E. Frevel, T. Bakheet, A. M. Silva, J. G. Hissong, K. S. A. Khabar, and B. R. G. Williams
p38 Mitogen-Activated Protein Kinase-Dependent and -Independent Signaling of mRNA Stability of AU-Rich Element-Containing Transcripts
Mol. Cell. Biol.,
January 15, 2003;
23(2):
425 - 436.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Shchors, F. Yehiely, R. K. Kular, K. U. Kotlo, G. Brewer, and L. P. Deiss
Cell Death Inhibiting RNA (CDIR) Derived from a 3'-Untranslated Region Binds AUF1 and Heat Shock Protein 27
J. Biol. Chem.,
November 27, 2002;
277(49):
47061 - 47072.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|