![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 18, 16324-16331, May 3, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, December 28, 2001, and in revised form, February 25, 2002
Protein primers are used to initiate genomic
synthesis of several RNA and DNA viruses, although the structural
details of the primer-polymerase interactions are not yet known.
Poliovirus polymerase binds with high affinity to the membrane-bound
viral protein 3AB but uridylylates only the smaller peptide 3B in
vitro. Mutational analysis of the polymerase identified four
surface residues on the three-dimensional structure of poliovirus
polymerase whose wild-type identity is required for 3AB binding. These
mutants also decreased 3B uridylylation, arguing that the binding sites for the membrane tether and the protein primer overlap. Mutation of
flanking residues between the 3AB binding site and the polymerase active site specifically decreased 3B uridylylation, likely affecting steps subsequent to binding. The physical overlap of sites for protein priming and membrane association should facilitate replication initiation in the membrane-associated complex.
The replication of linear nucleic acids without loss of coding
information from the ends is a problem that has been solved in several
ways by cellular and viral genomes. Solutions include those used by
vaccinia virus, which primes DNA replication from hairpins that can be
refolded to regenerate the terminal sequences (1, 2), by
Drosophila, which repair damaged chromosomal termini by
recombination (3), by many eukaryotic cells, which add end-specific
telomeric sequences postreplicatively, and by viruses such as
adenovirus and The protein primer for the synthesis of poliovirus RNA includes, at a
minimum, the 22-amino acid viral peptide 3B (also called VPg), which is
found covalently linked to the 5' ends of all newly synthesized
positive and negative strands. Poliovirus translates its proteins as a
single, large polyprotein that is cleaved into the proteins required
for virion formation, host modification, and RNA replication. In many
cases, proteolytic precursors have functions distinct from those of the
limit digestion products. Evidence for the use of 3B. As a
protein primer comes from in vitro experiments in which it
was demonstrated that 3B is uridylylated in the presence of UTP, the
poliovirus RNA-dependent RNA polymerase (3D), and an
RNA template (9). The RNA used to template the uridylylation of 3B can
either be poly(A), poliovirus RNA, or the small cis replication
enhancer RNA (10, 11), an internal sequence required for RNA
replication in infected cells (12). Whether 3B itself serves as the
primer within infected cells and how it is brought into the RNA
replication complex are not yet known.
Evidence for direct binding between polymerase and 3B was observed in
the two-hybrid system (13), although a stronger signal was observed
between the polymerase and a larger polypeptide that contains the 3B,
sequences, 3AB (13, 14). When mutations of 3AB were tested to identify
those that disrupted interactions with the poliovirus polymerase in the
two-hybrid system, only those that mapped within the 3B sequences were
found to be disruptive (13). Therefore, it is likely that many of the
direct contacts between the polymerase and 3AB are within the 3B sequence.
All positive-strand RNA viruses, from picornaviruses such as poliovirus
and foot and mouth disease virus to flaviviruses such as Dengue and
hepatitis C virus, form their RNA replication complexes in association
with cytoplasmic membranes whose identity differs for different viruses
(Refs. 15-17 and the references therein). Protein 3AB contains an
extended hydrophobic domain and associates with membranes both in
vitro and when expressed in isolation in tissue culture cells (18,
19). Membrane-bound 3AB has been recovered from Escherichia
coli expression systems and found to both stimulate the
proteolytic activity of the precursor of poliovirus polymerase, 3CD
(20), and recruit soluble polymerase from solution (14). A specific
interaction between 3AB and poliovirus polymerase can also be observed
with purified, detergent-solubilized 3AB, which stimulates poliovirus
polymerase activity (20-22) by stabilizing the polymerase complex with
the template and primer (23, 24). These data have led to a model in
which membrane-associated 3AB or one of its larger precursors (25)
binds directly to the soluble RNA-dependent RNA polymerase,
facilitating its recruitment to the membranes upon which viral RNA
replication occurs.
Previously, it was shown that the V391L mutation in poliovirus
polymerase confers a specific defect in the interaction of the
polymerase with viral protein 3AB in the yeast two-hybrid system and
in vitro (14). Val391 is located near motif E, a
motif conserved among RNA-dependent RNA polymerases; the
positions of Val391 and several motifs conserved among
polymerases are shown in Fig. 1 (26).
According to the frequently used analogy comparing polymerase structures to right hands, the "thumb" of polymerases such as HIV1 reverse transcriptase,
Taq DNA polymerase, and T7 DNA polymerase binds to the
double-stranded portion of the template strand, positioning the primer,
the 3'-hydroxyl of the nascent strand, at the active site (reviewed in
Ref. 27). The precise orientations of the template, the protein primer,
and the nascent RNA strand in the poliovirus polymerase structure are
not yet known.
To define the 3AB binding site further and to determine whether
residues in that site are important for 3B uridylylation, mutagenesis
of the surface residues that surround the V391L mutation was
undertaken. The ability of 14 mutant polymerases to bind to viral
protein 3AB, catalyze RNA-dependent RNA polymerization, and
uridylylate 3B was determined. The wild-type identities of several
clustered surface residues near motif E were found to be involved in
all 3AB- and 3B-mediated functions. Flanking residues appear to have
additional functions in the enzymology of protein priming.
Plasmids and Mutagenesis--
Mutations were introduced into the
pT5T3D plasmid, designed to express polymerase 3D in E. coli, using the QuikChange mutagenesis protocol (Stratagene, La
Jolla, CA) or the megaprimer method (28) with the primers described in
Table I. The flanking primers for the megaprimer mutagenesis
were CTGGGAGCAATAAAG and CCCAGGAGTGATAACAGGTTCAGCAGTGGG, amplifying the
coding region of 3D polymerase from nucleotide 606-1348. The PCR
products were cleaved with NsiI and MfeI (New England Biolabs, Beverly, MA) and inserted into similarly cleaved wild-type pT5T3D. The mutations were confirmed by sequencing.
To construct two-hybrid bait plasmids, the 3D polymerase coding region
was amplified from mutant pT5T3D using primers
CCGAATTCGGTGAAATCCAGTGGATGAGA and CGGGATCCTCGAGTTACTAAAATGAGTCAAGCC,
cleaved with EcoRI and BamHI, and cloned into
pLex202+PL (29). The appropriate sequence in all plasmids constructed
using PCR was confirmed by sequencing.
3D Polymerase Purification and Activity Assays--
Wild-type
and mutant poliovirus polymerases were purified as described previously
(30). Activity assays were performed with 2 µM polymerase
in 50 mM HEPES (pH 7.5), 0.5 mM
MnCl2, 50 µM ZnSO4, 30 mM NaCl, 70 µg/ml poly(A) (200 µM
nucleotide), 25 µg/ml oligod(T)16 (100 µM nucleotide), 400 µM UTP, and 1 µCi/ml
[ Two-hybrid Analysis--
For expression in the yeast two-hybrid
system, the coding regions of wild-type polymerase and all mutant
polymerases that were successfully expressed in E. coli were
cloned into the C-terminal coding region of a lexA-encoding "bait"
plasmid (29). Expression of these lexA-polymerase bait proteins was
comparable to that of the wild-type lexA-polymerase fusion protein
(data not shown; Ref. 14). Preparation of 3AB-containing E. coli Membranes--
Membranes
containing 3AB were prepared basically according to the protocol of
Lama et al. (20). E. coli (BL21) containing pKK3AB (20) were grown in LB with 150 µg/ml ampicillin at 37 °C to
A660 = 0.5/cm. The cultures were then grown at
22 °C until they reached A660 = 0.75/cm, at
which time they were induced with 0.5 µM
isopropyl-1-thio- Polymerase Recruitment Assay--
Ten µl of membranes (125 µg of total protein) was mixed with 30 µl of a preparation that
contained 5 µM wild-type or mutant polymerase, diluted
using the buffers from the final column of the purification (100 mM NaCl, 25 mM Tris-HCl (pH 8.5), 15%
glycerol, 0.5% octyl- 3B Uridylylation--
Wild-type and mutant polymerase
preparations were adjusted to 20 µM polymerase, 50%
glycerol, and 150 mM NaCl using the buffers from the final
column of the purification and glycerol. 30 µl of solution that
contained 10 µl of 75% acetonitrile and 20 µl of column buffer
supplemented to 4 M NaCl was added to 100 µl of
polymerase. The mixture was incubated on ice for 1 h. An aliquot (100 µl) of the mixture was dialyzed against 100 mM NaCl
and 50% glycerol for 6 h. (Slide-A-Lyzer Mini Dialysis Units;
Pierce). Protein concentration was then adjusted to 10 µM
polymerase with dialysis buffer. Polymerase (10 µl) was then
added to 40 µl of reaction buffer to final concentrations of 50 mM HEPES (pH 7.5), 2 mM dithiothreitol, 0.5 mM MnCl2, 8% glycerol, 140 µg/ml poly(A) (400 µM/nt), 200 µM 3B (VPg), 2 µM UTP, and 10 µCi/ml [ Structure Analysis--
Analysis of the crystal structure of
poliovirus 3D polymerase was performed using Swiss-PDB Viewer (Ref. 33;
available at www.expasy.ch/spdbv/) using coordinates from Hansen
et al. (26). Images were rendered using POV-Ray freeware
(available at www.povray.org).
Mutagenesis of a Candidate Surface for 3AB Binding on the
Poliovirus Polymerase--
We predicted that if the genetic screen
that identified the V391L mutation accurately identified the 3AB
binding site on the poliovirus polymerase (14), then polymerases that
contained mutations in residues adjacent to Val391
should display phenotypes similar to that of the V391L polymerase. Mutations were introduced into 14 additional residues surrounding Val391, as shown on the three-dimensional structure of
polymerase (26) in Fig. 5A and summarized in Table
I. For Asp358,
Lys359, Glu369, Glu370,
Lys375, Arg376, Phe377,
Arg379, Glu382, His389,
Pro393, and Lys395, codons that encode alanine
were substituted for the wild-type codons (Table I). Mutational
analyses of Asn424 (changed to Asp, His, and Tyr) and
Met394 (changed to Thr) have been described previously, and
the resulting viruses have been shown to be temperature-sensitive for
RNA synthesis (34, 35). Therefore, the published mutations N424D,
N424H, N424Y, and M394T were introduced at these positions. Because the R379A mutant polymerase exhibited decreased solubility, making it
unsuitable for direct binding assays, an additional mutant polymerase,
R379E, was created. Mutant polymerases D358A, K359A, E369A, K375A,
F377A, R379A, R379E, E382A, V391L, M394T, K395A, and N424H were
successfully expressed and purified.
Mutations in Three Clustered Residues in the Poliovirus
Polymerase Cause Specific Defects in Binding to Viral Protein 3AB
in the Two-hybrid System--
The effects of mutations in the putative
3AB-binding domain of poliovirus polymerase on its interactions with
3AB in the two-hybrid system are shown in Fig.
2. Testing the effect of these mutations on the interaction of polymerase with known ligands in addition to 3AB
provided controls for proper folding of the lexA-polymerase bait fusion
protein. Those mutations that conferred a defect in polymerase binding
to the 3AB "prey" but not to other preys (human Sam68 protein or
other polymerase molecules) were considered to confer specific defects
in 3AB binding (13, 14, 36).
Mutations F377A, R379A, R379E, and V391L all caused specific defects in
polymerase-3AB binding (Fig. 2, first two rows). However, mutations in flanking residues D358A, K359A, E369A, E370A, K375A, E382A, M394T, K395A, and N424Y had no significant effect on the interaction of polymerase with 3AB, other polymerase molecules, or
Sam68 (Fig. 2). Therefore, Phe377, Arg379, and
Val391 are likely to constitute at least part of the 3AB
binding site, as summarized in Fig. 5B.
Effect of Polymerase Mutations on Binding to Membrane-associated
3AB--
To test the effect of mutations on the ability of the
polymerase to bind 3AB outside of the context of a fusion protein,
membranes that contained 3AB were used to recruit mutant and wild-type
3D polymerases from solution. E. coli membranes were
prepared from cells that did or did not express plasmid-encoded 3AB.
Equivalent amounts of these membranes were used as affinity matrices to
recruit soluble polymerases from solution. Whereas expression of 3AB in eukaryotic systems has been reported (19, 25), these expression levels
are low (37), so that obtaining sufficient quantities from these
systems to perform the analyses reported here would be difficult.
As shown in Fig. 3A, the
presence of 3AB in the membranes allowed the recruitment from solution
of wild-type polymerase (lanes 2 and 3) and E369A
mutant polymerase (lanes 5 and 6). However, recruitment was significantly disturbed by the R379E mutation (lanes 8 and 9), even though equivalent amounts
of all polymerases were present in the reaction mixtures (lanes
10-12). These data and similar data for other mutant polymerases
are quantified in Fig. 3B, where the amounts of wild-type
and mutant polymerases recruited by the 3AB-containing membranes are
compared for several independent experiments. Consistent with the
results of the two-hybrid experiments, mutant polymerases R379E, V391L,
and F377A all displayed reduced binding to the 3AB-containing
membranes. In addition, E382A mutant polymerase
displayed reduced binding, whereas none of the other mutant polymerases
displayed significantly reduced interactions with membrane-associated
3AB. These data are summarized on the three-dimensional structure of
the polymerase in Fig. 5C. The clustering of the residues in
a hydrophobic pocket on the protein surface and the lack of apparent
misfolding of the mutant polymerases argue that these residues identify
a site of direct 3AB binding.
Mutations in the 3AB Binding Site and Several Flanking Residues
Decrease 3B Uridylylation--
It is not clear whether the 3AB binding
site on poliovirus polymerase identified the binding site for 3B as
well. However, available evidence (see "Introduction") supports the
hypothesis that important contacts for 3AB with polymerase are
contained in the 3B sequences. In addition, the 3AB binding site
identified by two-hybrid and membrane recruitment assays (Fig. 5,
B and C) is close to the active site for
phosphodiester bond formation (26), making the 3AB binding site an
attractive candidate for the binding of the 3B sequences during uridylylation.
To determine whether mutations in the binding sites for 3AB affect 3B
uridylylation, 12 different mutant polymerases whose effects on the
binding of 3AB had been defined (Figs. 2 and 3) and 2 mutant
polymerases that contained mutations in the active site for
polymerization (Y326A and D328A/D329A) were studied. Uridylylation of
3B was quantified during the initial, linear phase of the uridylylation
reaction (data not shown), therefore giving a measure of the reaction
rate. As can be seen from the direct labeling of 3B by
The RNA-dependent RNA polymerase activity of each of these
enzymes was tested under the conditions of saturating RNA
concentrations present in the 3B uridylylation assays. As shown in Fig.
4D, all the mutant enzymes except D328A/D329A, which
contains two mutations in the polymerase active site, showed at least
wild-type RNA-dependent RNA polymerase activities.
Therefore, for the D328A/D329A mutant polymerase, the observed failure
to uridylylate 3B could be explained by its failure to perform any
phosphoryl transfer reaction.
All of the mutations that interfered with 3AB binding in two-hybrid
assays or in 3AB-mediated membrane recruitment (F377A, R379E, E382A,
and V391L) showed reduced rates of 3B uridylylation (Fig.
4C). This is consistent with the idea that the the 3AB
binding site (Fig. 5, B and C) and the binding
site for the 3B substrate during uridylylation are similar or overlapping.
Mutations in residues adjacent to the 3AB binding site showed mixed
effects on the rate of 3B uridylylation. N424H and K395A polymerases
showed no defect in either polymerization (Fig. 4D) or 3B
uridylylation (Fig. 4C) under these conditions, although the
residues are directly adjacent to the 3AB binding site. M394T polymerase, previously demonstrated to be defective in both 3B uridylylation and RNA-dependent RNA polymerase activity
(9), displayed a decreased rate of 3B uridylylation but not polymerase activity in these experiments (Fig. 4, C and D).
It should be noted that in these experiments, initial rates of
uridylylation and polymerization were measured, whereas previous
studies measured the extents of these reactions. Therefore, the
differences observed may be due to the lability of the M394T polymerase
during extended incubation. Similar to our observations for M394T,
defects in 3B uridylylation but not polymerase activity were
demonstrated by D358A and K359A mutant polymerases.
Mutation of another residue near the active site of the polymerase,
Y326A, caused an apparent stimulation in polymerase activity (Fig.
4D) but a dramatic reduction in the rate of 3B uridylylation (Fig. 4C). These results suggest that although the same
active site is used for phosphoryl transfer with both nucleic acid and protein primers, the exact chemistry of the reactions may differ.
We have defined a binding surface for membrane-associated
poliovirus protein 3AB on the three-dimensional structure of the viral
RNA-dependent RNA polymerase 3D using yeast two-hybrid and direct binding assays. Mutations in residues Val391,
Phe377, and Arg379 interfered with 3AB binding
in both assays (Fig. 5, B and C), whereas a
mutation in residue Glu382 showed a defect in the direct
binding assay only (Fig. 5C), indicating that this assay is
perhaps more sensitive than the two-hybrid assay. Although it is
formally possible that these mutations interfere indirectly with 3AB
binding, it is likely that they identify a region of direct contact
between 3AB and the polymerase due to the lack of evidence of
misfolding of the mutant polymerases and the physical clustering of the
residues near a hydrophobic pocket on the polymerase surface (Fig. 5,
B and C). Phe377, Arg379,
Glu382, and Val391 are present at this position
in 18.5%, 50.0%, 53.7%, and 74.1%, respectively, of picornavirus
polymerases (38).
All the mutations that interfered with the binding of 3AB to polymerase
(F377A, R379A, R379E, E382A, and V391L) also decreased the rate of 3B
uridylylation by the polymerase (Figs. 4 and 5D) but had
little effect on nucleic acid-primed polymerase activity under similar
conditions (Fig. 4D), consistent with the hypotheses that
the binding sites for 3B and 3AB overlap and that binding of 3B via
these contacts is required for uridylylation. Similarly, several
mutations in the DNA polymerase of Mutations in some of the residues that surround the 3AB binding site,
specifically, M394T, R358A, R359A, and K395A, also reduced the rate of
3B uridylylation (Figs. 4 and 5D) but showed little effect
on either polymerase activity (Fig. 4D) or 3AB binding affinity (Fig. 5, B and C). Assuming that
substrate binding is only one step in the uridylylation reaction, it is
not surprising that the residues required for high-affinity binding of
3AB, and likely 3B as well, are only a subset of those required for
catalysis. Similar mutations that decrease protein primer utilization
but not its binding have been characterized in the DNA polymerase of
The poliovirus RNA-dependent RNA polymerase catalyzes two
different types of phosphoryl transfer reactions, the formation of
internucleotide bonds during RNA elongation and the formation of
tyrosine-phosphate bonds during the uridylylation of 3B (9). Both
reactions involve pairing of the incorporated nucleotide with an RNA
template. Mutations in the conserved YGDD sequences at the active site
are known to alter metal specificity and to impair the ability of the
enzyme to catalyze internucleotide bond formation (41, 42). As shown in
Fig. 4, C and D, mutation of this YGDD sequence
to YGAA destroyed the ability of polymerase 3D to form either
internucleotide or tyrosine-phosphate bonds. However, mutation of
Asp358, which contains atoms within 5 Å of the metal at
the active site (Fig. 6), had no effect
on the formation of internucleotide bonds but almost completely
abrogated 3B uridylylation. Mutation of Lys359, a residue
highly conserved in RNA-dependent polymerases, shares this
phenotype. It is intriguing that, although widely conserved, Lys359 is not conserved in polymerases that perform
de novo synthesis, such as those of hepatitis C and
Similar Structural Basis for Membrane Localization and Protein
Priming by an RNA-dependent RNA Polymerase*
§,
¶,
,
,
,
§§, and
¶¶
Department of Microbiology and Immunology,
Stanford University School of Medicine, Stanford, California 94305 and
the Departments of
Molecular, Cellular, and Developmental
Biology and ** Chemistry and Biochemistry, University of
Colorado, Boulder, Colorado 80309
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
29, which use protein primers that are covalently
linked to the initiating nucleotides (reviewed in Ref. 4). For
mammalian positive-strand RNA viruses such as poliovirus and hepatitis
C, two mechanisms are suspected: de novo initiation (5-8)
and protein priming (9) from the genomic ends.

View larger version (36K):
[in a new window]
Fig. 1.
Ribbon diagram of the poliovirus
RNA-dependent RNA polymerase, 3D. The
three-dimensional structure of poliovirus polymerase (26)
resolves residues 12-37, 67-97, and 182-461. Residues 12-37 are
thought to be donated intermolecularly (26, 30). Views from the front,
facing the "palm" (A), and from the "back" of the
polymerase "hand" (B) are shown. The five canonical
RNA-dependent RNA polymerase domains are colored as
follows: motif A, orange; motif B, blue; motif C,
red; motif D, purple; and motif E,
green. Val391, identified as important for the
binding of viral protein 3AB (14), is shown in yellow. The
metal ion at the active site is shown in aqua.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]UTP (3000 Ci/mmol; PerkinElmer Life Sciences).
Reactions were incubated for 10 min on ice, incubated for 30 min at
30 °C, and spotted onto DE81 paper wetted in wash (5% dibasic
sodium phosphate and 2% sodium pyrophosphate (w/v)). The paper was
washed five times for 5 min in 200 ml of wash and then washed for 1 min
in 200 ml of distilled H2O and 1 min in 200 ml of 95%
ethanol. The paper was allowed to dry, and bound 32P was
quantified using a PhosphorImager (Molecular Dynamics).
-Galactosidase assays were performed as
described previously (14) by the permeabilized cell method of Miller
(31). Cells were grown at 30 °C in medium containing 2% raffinose
to A600 = 0.1/cm. Galactose was then
added to 2% (w/v), and cells were incubated at 25 °C until they
reached A600 = 0.3/cm, at which time the cells
were harvested.
-D-galactopyranoside. The cultures were harvested by centrifugation at 11,000 × g at 4 °C
(8500 rpm in a Beckman JA-14 rotor) for 5 min. The cells were
resuspended in 25 ml of ice-cold 100 mM NaCl, 50 mM Tris-HCl (pH 7.6), and 5% glycerol and harvested as
described above. This wash step was repeated one additional time. The
final pellet was frozen at
80 °C. The pellet was thawed and
resuspended on ice in 10 ml/liter original culture of Buffer A (100 mM NaCl, 50 mM Tris-HCl (pH 7.6), 5% glycerol,
1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 1 mM dithiothreitol, and 1× Complete Protease Inhibitor
Mixture (Roche Molecular Biochemicals)). This suspension was lysed by passage through a chilled French press at 16,000 p.s.i. The
lysate was precleared by centrifugation at 10,000 × g
for 40 min in a Beckman JA-20 rotor at 9000 rpm at 4 °C. The
membrane fraction was collected by centrifugation at 24,000 rpm for 30 min (100,000 × g) in a Beckman SW-41Ti rotor at
4 °C. The pellet was resuspended to 12.5 mg/ml protein in Buffer A
and stored at
80 °C. Control membranes were prepared identically
from cells harboring the pGEM vector.
-glucopyranoside, 0.1 mM EDTA,
0.02% NaN3, 2 mM dithiothreitol) and glycerol
to 40% and 600 mM NaCl. The reaction was incubated on ice
for 1 h and then incubated at 30 °C for 20 min. The reaction was spun at 14,000 rpm (16,000 × g) at room
temperature for 5 min. The supernatant was removed, and the pellet was
resuspended in 100 µl of wash buffer (500 mM NaCl, 25 mM Tris-HCl (pH 8.0), and 10 mM
dithiothreitol). The membranes were collected by centrifugation as
described above, and the pellet was resuspended in 8 µl of 2×
SDS-PAGE buffer (32), vortexed, and boiled for 4 min. The proteins were
resolved on a 12.5% SDS gel (29:1, acrylamide:bis). The gel was
stained with Sypro Red (Molecular Dynamics) diluted 1:5000 in 7.5%
acetic acid for 30 min at room temperature with gentle rocking. The gel
was destained for 30 min in 7.5% acetic acid. Staining was visualized
using the Molecular Dynamics Storm in red fluorescence mode.
Quantitation was performed with ImageQuant software (Molecular Dynamics).
-32P]UTP (3000 Ci/mmol; PerkinElmer Life Sciences), and the reactions were incubated
at 30 °C for 30 min. The reaction was stopped by the addition of 100 µl of 2× SDS-PAGE buffer. The products were resolved on a 12%
(29:1, acrylamide:bis) Tris-tricine gel. The gel was dried onto 3MM
Whatman paper and analyzed by PhosphorImager (Molecular Dynamics).
Quantitation was performed with ImageQuant (Molecular Dynamics).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
Introduced mutations in 3D polymerase, mutagenic oligonucleotides, and
sources of plasmids

View larger version (17K):
[in a new window]
Fig. 2.
Two-hybrid analysis of the interaction of
mutant poliovirus polymerases with 3AB and two other ligands.
Wild-type and mutant poliovirus polymerase sequences were expressed as
bait lexA fusion proteins (29) in Saccharomyces cerevisiae
to similar cellular concentrations and did not affect the expression or
accumulation of prey proteins (data not shown). The amounts of
-galactosidase activity are therefore an indication of the relative
affinities of the wild-type and mutant polymerase baits for each of the three different prey
proteins, expressed as fusions with a transcriptional activation domain
(29). For each experiment, both the interactions displayed by the
mutant polymerase bait and the interactions displayed by a wild-type
control performed in the same experiment are shown.
, control prey
vector;
, wild-type poliovirus
polymerase;
, 3AB prey;
, human Sam68 protein. For each graphed
value of
-galactosidase activity, the average value (expressed in
Miller units) and the S.E. observed from three to five different
cultures are indicated. These data are summarized in Fig.
5B.

View larger version (16K):
[in a new window]
Fig. 3.
Ability of membrane-bound 3AB to recruit
wild-type and mutant poliovirus polymerases from solution.
Membranes were prepared from E. coli that did not express
(
) and did express (+) poliovirus 3AB protein ("Experimental
Procedures"). After incubation of membrane preparations (175 µg of
total protein) with solutions containing 5 µM wild-type
(WT) or mutant polymerases, the percentage of polymerase
that precipitated with the membranes was determined by comparison of
the amount of precipitated polymerase to total polymerase on a
SyproRed-stained gel (Molecular Dynamics) as shown in A. The
results shown in A for E369A and R379E polymerases, as well
as the results for nine other mutant polymerases, are quantified in
B. Polymerase recruitment by E. coli membranes
that did not contain 3AB is indicated by
, and polymerase
recruitment by E. coli membranes that contained 3AB is shown
by
. S.D. values from duplicate experiments performed for polymerase
binding to 3AB-containing membranes are indicated. The results of these
experiments are summarized in Fig. 5C.
-[32P]UTP (Fig. 4,
A and B), several of the mutant polymerases
showed decreased rates of 3B uridylylation relative to wild-type
polymerase, although two (N424H and K395A) showed no apparent change,
and one (E369A) showed an apparent stimulation of this rate. These data
are summarized in Fig. 4C. The residues for which mutations caused reductions in the rate of 3B uridylylation are shown on the
three-dimensional structure in Fig.
5D.

View larger version (24K):
[in a new window]
Fig. 4.
Effect of mutations in the 3AB binding site
on 3D polymerase on the uridylylation of 3B and on
RNA-dependent RNA polymerase activity. Assays to
measure the uridylylation of 3B (200 µM) by wild-type and
mutant polymerases (2 µM) were performed as described
(see "Experimental Procedures"). The 30 min time point chosen
reflects the initial rate of the reaction under these conditions, and
the amount of incorporated 32P from
[
-32P]UTP was linearly responsive to the concentration
of 3B for wild-type and mutant polymerases (data not shown).
32P-labeled proteins were displayed by SDS-PAGE on a 12%
Tris-tricine gel and imaged with a PhosphorImager (Molecular Dynamics).
Two sets of experiments are shown in A and B.
With the exception of the D328A/D329A polymerase, experiments were
performed in duplicate. The results are quantified in C, and
the S.D. is shown. RNA-dependent RNA polymerase activity
was determined for the wild-type and mutant polymerases in a
poly(A)/oligo(dT)16 assay at 2 µM polymerase
as described under "Experimental Procedures" (D). These
results are summarized in Fig. 5D.

View larger version (87K):
[in a new window]
Fig. 5.
Residues of 3D polymerase whose wild-type
identity is important for 3AB binding and 3B uridylylation. The
residues of the polymerase targeted for mutation are shown as
light blue space-filling representations on a ribbon diagram
of the polymerase viewed from the back (A). Motif C, which
contains the YGDD sequences at the active site, is shown in
red. The remaining panels summarize the results of the yeast
two-hybrid (B), 3AB-mediated membrane recruitment
(C), and 3B uridylylation assays (D). Residues
that, when mutagenized, show a decrease in binding are shown in
yellow, and those that have no effect are shown in
blue. In D, those residues that were not found to
be involved in binding of 3AB but that, when altered, reduce
uridylylation of 3B are shown in orange. Other residues
that, when altered, result in low expression of the polymerase in
E. coli are shown in black. Arg376,
when changed to Ala, reduced the expression of polymerase in E. coli and cannot be seen from this view.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
29 phage that interfere with polymerase binding to terminal protein, the primer of DNA synthesis, abrogated terminal protein-primed DNA synthesis but not DNA
synthesis primed with a DNA oligonucleotide (39). Therefore, the
reduction in binding affinity for the protein primer is likely to
provide one mechanism for reducing the rate of protein priming for both
poliovirus and
29 phage.
29 (Ref. 40 and the references therein).
6.
Similarly, mutation of Tyr326, the first conserved residue
in the YGDD sequence, stimulated the formation of internucleotide bonds
but destroyed the ability of polymerase 3D to perform 3B uridylylation
(Fig. 4, C and D).

View larger version (64K):
[in a new window]
Fig. 6.
Proximity of Asp358, required for
3B uridylylation but not 3AB binding, to the polymerase active
site. Amino acid residues that contain atoms within 5 Å of the
metal ion present at the active site of 3D polymerase (26) are shown.
The Ca2+ ion present in the polymerase crystal is shown in
aqua; this is presumably replaced by Mg2+ or
Mn2+ during catalysis (26). The ribbon diagrams of the
canonical polymerase domains are colored as described in Fig. 1 (motif
A, orange; motif C, red).
It is possible that differential effects of mutagenesis of the polymerase active site on tyrosine uridylylation and internucleotide bond formation result from different chemistries of these two reactions. For example, residues such as Tyr326 and Asp358 in the poliovirus polymerase may participate in metal chelation and phosphoryl transfer reactions during uridylylation of 3B, but not during internucleotide bond formation. In DNA topoisomerases, the same active site promotes four phosphoryl transfer reactions: the breakage of internucleotide phosphodiester bonds, the formation of a covalent bond between the active site tyrosine and the cleaved DNA, the cleavage of the tyrosine-DNA complex, and the formation of a new internucleotide bond. Several mutations in the active site can specifically reduce the rate of the later steps without affecting earlier steps (43-46).
Here we provide evidence that poliovirus protein 3AB can tether the
soluble polymerase to membranes by direct binding via four residues on
the polymerase surface, two of which are part of conserved motif E. Our
data do not clarify whether the proteolytic liberation of 3B from 3AB
or a larger precursor occurs before or after the protein priming
reaction. However, the observation that membrane tethering by 3AB could
place the protein primer 3B in the vicinity of the polymerase active
site was shown by the inhibition of 3B uridylylation by mutation of the
residues required for 3AB binding. This is the second time that a
function for motif E in priming of RNA replication has been described: in the three-dimensional structure of
6 RNA-dependent
RNA polymerase, motif E appears to position the C-terminal domain,
which in turn positions the GTP molecules used to initiate de
novo RNA replication (47).
Poliovirus polymerase functions as an oligomer in solution (30, 48,
49). The three-dimensional structure of poliovirus polymerase
revealed two intermolecular interfaces (26), as shown in Fig.
7. Disruption of either interface by
mutagenesis correlates with loss of viral viability (30). Polymerase
interactions via either Interface I or Interface II display
head-to-tail orientations such that the polymerase oligomer could, in
principle, continue indefinitely; the size of the oligomeric polymerase
in infected cells has yet to be determined. As shown in Fig. 7, the 3AB
binding site identified here does not overlap with any of the
polymerase-polymerase interaction surfaces. Instead,
membrane-associated 3AB could contact every second polymerase in a
higher-order polymerase oligomer, consistent with the hypothesis that
these protein-protein interactions occur in the viral RNA replication
complex to coordinate membrane association, protein priming, and
RNA elongation.
|
| |
ACKNOWLEDGEMENTS |
|---|
We thank Ellie Ehrenfeld, Jeffrey L. Hansen and Scott D. Hobson for discussions of the polymerase structure and membrane association, Katya Smirnyagina for experimental contributions, and Aniko Paul for technical advice concerning the 3B uridylylation reaction. Comments on the manuscript from Peter Sarnow, Esther Bullitt, and Scott Crowder are gratefully acknowledged.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant AI-42119.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ A predoctoral fellow of the Howard Hughes Medical Institute.
¶ Present address: Bastyr University, 14500 Juanita Dr. NE, Kenmore, WA 98028.

Present address: Cellomics Inc., 100 Technology Dr.,
Pittsburgh, PA 15219.
§§ Present address: Diné College, P. O. Box 251C, Tsaile, AZ 86556.
¶¶ To whom correspondence should be addressed: Dept. of Microbiology and Immunology, Stanford University School of Medicine, 299 Campus Dr., Stanford, CA 94305. Tel.: 650-498-7075; Fax: 650-498-7174; E-mail: karlak@stanford.edu.
Published, JBC Papers in Press, February 27, 2002, DOI 10.1074/jbc.M112429200
| |
ABBREVIATIONS |
|---|
The abbreviation used is: HIV, human immunodeficiency virus.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Baroudy, B. M.,
Venkatesan, S.,
and Moss, B.
(1982)
Cell
28,
315-324[CrossRef][Medline]
[Order article via Infotrieve] |
| 2. |
deLange, A. M.,
Reddy, M.,
Scraba, D.,
Upton, C.,
and McFadden, G.
(1986)
J. Virol.
59,
249-259 |
| 3. |
Biessmann, H.,
Mason, J. M.,
Ferry, K.,
d'Hulst, M.,
Vlageirdottir, K.,
Traverse, K. L.,
and Pardue, M. L.
(1990)
Cell
61,
663-673[CrossRef][Medline]
[Order article via Infotrieve] |
| 4. |
Salas, M.
(1991)
Annu. Rev. Biochem.
60,
39-71[CrossRef][Medline]
[Order article via Infotrieve] |
| 5. |
Sun, X.,
Johnson, R.,
Hockman, M.,
and Wang, Q.
(2000)
Biochem. Biophys. Res. Commun.
268,
798-803[CrossRef][Medline]
[Order article via Infotrieve] |
| 6. |
Zhong, W.,
Uss, A. S.,
Ferrari, E.,
Lau, J. Y.,
and Hong, Z.
(2000)
J. Virol.
74,
2017-2022 |
| 7. |
Luo, G.,
Hamatake, R. K.,
Mathis, D. M.,
Racela, J.,
Rigat, K. L.,
Lemm, J.,
and Colonno, R. J.
(2000)
J. Virol.
74,
851-863 |
| 8. |
Kim, M. J.,
Zhong, W.,
Hong, Z.,
and Kao, C. C.
(2000)
J. Virol.
74,
10312-10322 |
| 9. |
Paul, A. V.,
Boom, J. H.,
Filippov, D.,
and Wimmer, E.
(1998)
Nature
393,
280-284[CrossRef][Medline]
[Order article via Infotrieve] |
| 10. |
Paul, A. V.,
Rieder, E.,
Kim, D. W.,
van Boom, J. H.,
and Wimmer, E.
(2000)
J. Virol.
74,
10359-10370 |
| 11. |
Rieder, E.,
Paul, A. V.,
Kim, D. W.,
van Boom, J. H.,
and Wimmer, E.
(2000)
J. Virol.
74,
10371-10380 |
| 12. |
Goodfellow, I.,
Chaudhry, Y.,
Richardson, A.,
Meredith, J.,
Almond, J. W.,
Barclay, W.,
and Evans, D. J.
(2000)
J. Virol.
74,
4590-4600 |
| 13. |
Xiang, W.,
Cuconati, A.,
Hope, D.,
Kirkegaard, K.,
and Wimmer, E.
(1998)
J. Virol.
72,
6732-6741 |
| 14. |
Hope, D. A.,
Diamond, S. E.,
and Kirkegaard, K.
(1997)
J. Virol.
71,
9490-9498[Abstract] |
| 15. |
Chen, J.,
and Ahlquist, P. A.
(2000)
J. Virol.
74,
4310-4318 |
| 16. |
Suhy, D. A.,
Giddings, T. H. J.,
and Kirkegaard, K.
(2000)
J. Virol.
74,
8158-8165 |
| 17. |
Teterina, N. L.,
Egger, D.,
Bienz, K.,
Brown, D. M.,
Semler, B. L.,
and Ehrenfeld, E.
(2001)
J. Virol.
75,
3841-3850 |
| 18. |
Towner, J. S., Ho, T. V.,
and Semler, B. L.
(1996)
J. Biol. Chem.
271,
26810-26818 |
| 19. |
Datta, U.,
and Dasgupta, A.
(1994)
J. Virol.
68,
4468-4477 |
| 20. |
Lama, J.,
Paul, A. V.,
Harris, K. S.,
and Wimmer, E.
(1994)
J. Biol. Chem.
269,
66-70 |
| 21. |
Paul, A. V.,
Cao, X.,
Harris, K. S.,
Lama, J.,
and Wimmer, E.
(1994)
J. Biol. Chem.
269,
29173-29181 |
| 22. |
Plotch, S. J.,
and Palant, O.
(1995)
J. Virol.
69,
7169-7179[Abstract] |
| 23. |
Richards, O. C.,
and Ehrenfeld, E.
(1998)
J. Biol. Chem.
273,
12832-12840 |
| 24. |
Rodriguez-Wells, V.,
Plotch, S. J.,
and DeStefano, J. J.
(2001)
Nucleic Acids Res.
29,
2715-2724 |
| 25. |
Towner, J. S.,
Mazanet, M. M.,
and Semler, B. L.
(1998)
J. Virol.
72,
7191-7200 |
| 26. |
Hansen, J. L.,
Long, A. M.,
and Schultz, S. C.
(1997)
Structure
5,
1109-1122[Medline]
[Order article via Infotrieve] |
| 27. |
Jager, J.,
and Pata, J. D.
(1999)
Curr. Opin. Struct. Biol.
9,
21-28[CrossRef][Medline]
[Order article via Infotrieve] |
| 28. |
Ke, S. H.,
and Madison, E. L.
(1997)
Nucleic Acids Res.
25,
3371-3372 |
| 29. |
Gyuris, J.,
Golemis, E.,
Chertkov, H.,
and Brent, R.
(1993)
Cell
75,
791-803[CrossRef][Medline]
[Order article via Infotrieve] |
| 30. |
Hobson, S. D.,
Rosenblum, E. S.,
Richards, O. C.,
Richmond, K.,
Kirkegaard, K.,
and Schultz, S. C.
(2001)
EMBO J.
20,
1153-1163[CrossRef][Medline]
[Order article via Infotrieve] |
| 31. | Miller, J. H. (1972) Experiments in Molecular Genetics , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY |
| 32. |
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve] |
| 33. |
Guex, N.,
and Peitsch, M. S.
(1997)
Electrophoresis
18,
2714-2723[CrossRef][Medline]
[Order article via Infotrieve] |
| 34. |
Burns, C. C.,
Richards, O. C.,
and Ehrenfeld, E.
(1992)
J. Virol.
189,
568-582 |
| 35. |
Barton, D. J.,
Morasco, B. J.,
Eisner-Smerage, L.,
Collis, P. S.,
Diamond, S. E.,
and Hewlett, M. J.
(1996)
Virology
217,
459-469[CrossRef][Medline]
[Order article via Infotrieve] |
| 36. |
McBride, A. E.,
Schlegel, A.,
and Kirkegaard, K.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
93,
2296-2301 |
| 37. |
Barco, A.,
and Carrasco, L.
(1995)
Gene (Amst.)
156,
19-25[CrossRef][Medline]
[Order article via Infotrieve] |
| 38. | Hobson, S. D. (2000) Crystallographic and Biochemical Studies of Higher Order Poliovirus Polymerase Structures.Ph.D. thesis , University of Colorado |
| 39. |
Dufour, E.,
Mendez, J.,
Lazazro, J. M., De,
Vega, M.,
Blanco, L.,
and Salas, M.
(2000)
J. Mol. Biol.
304,
289-300[CrossRef][Medline]
[Order article via Infotrieve] |
| 40. |
Meijer, W. J.,
Horcajadas, J. A.,
and Salas, M.
(2001)
Microbiol. Mol. Biol. Rev.
65,
261-287 |
| 41. |
Jablonski, S. A.,
Luo, M.,
and Morrow, C. D.
(1991)
J. Virol.
65,
4565-4572 |
| 42. |
Jablonski, S. A.,
and Morrow, C. D.
(1993)
J. Virol.
67,
373-381 |
| 43. |
Chen, S.-J.,
and Wang, J. C.
(1998)
J. Biol. Chem.
273,
6050-6056 |
| 44. |
Zhu, C.-X.,
Roche, C. J.,
Papanicolaou, N.,
Dipietrantonio, A.,
and Tse-Dinh, Y.-C.
(1998)
J. Biol. Chem.
273,
8783-8789 |
| 45. |
Wittschieben, J.,
Peterson, B. O.,
and Shuman, S.
(1999)
Nucleic Acids Res.
26,
490-496 |
| 46. |
Fertala, J.,
Vance, J. R.,
Pourquier, P.,
Pommier, Y.,
and Bjornsti, M.-A.
(2000)
J. Biol. Chem.
275,
15346-15253 |
| 47. |
Butcher, S. J.,
Grimes, J. M.,
Makeyev, E. V.,
Bamford, D. H.,
and Stuart, D. I.
(2001)
Nature
410,
235-240[CrossRef][Medline]
[Order article via Infotrieve] |
| 48. |
Pata, J. D.,
Schultz, S. C.,
and Kirkegaard, K.
(1995)
RNA (N. Y.)
1,
466-477 |
| 49. |
Beckman, M. T.,
and Kirkegaard, K.
(1998)
J. Biol. Chem.
273,
6724-6730 |
| 50. |
Diamond, S. E.,
and Kirkegaard, K.
(1994)
J. Virol.
68,
863-876 |
This article has been cited by other articles:
![]() |
B. Wolk, B. Buchele, D. Moradpour, and C. M. Rice A Dynamic View of Hepatitis C Virus Replication Complexes J. Virol., November 1, 2008; 82(21): 10519 - 10531. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hass, M. Lelke, C. Busch, B. Becker-Ziaja, and S. Gunther Mutational Evidence for a Structural Model of the Lassa Virus RNA Polymerase Domain and Identification of Two Residues, Gly1394 and Asp1395, That Are Critical for Transcription but Not Replication of the Genome J. Virol., October 15, 2008; 82(20): 10207 - 10217. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gruez, B. Selisko, M. Roberts, G. Bricogne, C. Bussetta, I. Jabafi, B. Coutard, A. M. De Palma, J. Neyts, and B. Canard The Crystal Structure of Coxsackievirus B3 RNA-Dependent RNA Polymerase in Complex with Its Protein Primer VPg Confirms the Existence of a Second VPg Binding Site on Picornaviridae Polymerases J. Virol., October 1, 2008; 82(19): 9577 - 9590. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Yin, Y. Liu, E. Wimmer, and A. V. Paul Complete protein linkage map between the P2 and P3 non-structural proteins of poliovirus J. Gen. Virol., August 1, 2007; 88(8): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Strauss and D. S. Wuttke Characterization of Protein-Protein Interactions Critical for Poliovirus Replication: Analysis of 3AB and VPg Binding to the RNA-Dependent RNA Polymerase J. Virol., June 15, 2007; 81(12): 6369 - 6378. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Liu, D. Franco, A. V. Paul, and E. Wimmer Tyrosine 3 of Poliovirus Terminal Peptide VPg(3B) Has an Essential Function in RNA Replication in the Context of Its Precursor Protein, 3AB J. Virol., June 1, 2007; 81(11): 5669 - 5684. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Korneeva and C. E. Cameron Structure-Function Relationships of the Viral RNA-dependent RNA Polymerase: FIDELITY, REPLICATION SPEED, AND INITIATION MECHANISM DETERMINED BY A RESIDUE IN THE RIBOSE-BINDING POCKET J. Biol. Chem., June 1, 2007; 282(22): 16135 - 16145. [Abstract] [Full Text] [PDF] |