|
Originally published In Press as doi:10.1074/jbc.M111682200 on March 1, 2002
J. Biol. Chem., Vol. 277, Issue 19, 16705-16711, May 10, 2002
Characterizing the DNA Contacts and Cooperative Binding of F
Plasmid TraM to Its Cognate Sites at oriT*
Richard A.
Fekete and
Laura S.
Frost§
From the Department of Biological Sciences, University of Alberta,
Edmonton, Alberta T6G 2E9, Canada
Received for publication, December 7, 2001
 |
ABSTRACT |
TraM is a DNA binding protein required for
conjugative transfer of the self-transmissible IncF group of plasmids,
including F, R1, and R100. F TraM binds to three sites in F
oriT: two high affinity binding sites, sbmA and
sbmB, which are direct repeats of nearly identical sequence
involved in the autoregulation of the traM gene; and a
lower affinity site, sbmC, an inverted repeat important for
transfer, which is situated nearest to the nic site where
transfer originates. TraM bound cooperatively to its binding sites at
oriT; the presence of sbmA and sbmB
increased the affinity for sbmC 10-fold. Bending of
oriT DNA by TraM was minimal, suggesting that TraM, a
tetramer, was able to loop the DNA when bound to sbmA and
sbmB simultaneously. Hydroxyl radical footprinting of DNA
of sbmA and sbmC revealed that TraM contacted
the DNA within a region previously delineated by DNase I footprinting.
TraM protected the CT bases within the sequence CTAG, which occurred at
12-base intervals on the top and bottom strand of sbmA,
most consistently with other protected bases. The footprint on
sbmC revealed that the predicted inverted repeats were
protected by TraM with a pattern that began at the center of the
repeats and radiated outward at 11-12 base intervals toward the
5'-ends of either strand. At high protein concentrations, this pattern
extended beyond the footprint defined by DNase I, suggesting that the
DNA was wrapped around the protein forming a nucleosome-like structure,
which could aid in preparing the DNA for transfer.
 |
INTRODUCTION |
The F plasmid is a 100-kbp circular
plasmid1 found in
Escherichia coli and is a paradigm for pilus-mediated
conjugation. Transfer proteins required for conjugation have been
divided into five categories based on relaxosome formation and DNA
transport, pilus assembly, mating pair stabilization, surface
exclusion, and regulation (1). The relaxosome is a nucleoprotein
complex of TraI, TraY, and TraM bound to the origin of transfer
(oriT), which interacts with the DNA transport protein TraD,
located in the inner membrane. TraI is both a relaxase, which cleaves
at the nic site within oriT in a strand- and
sequence- specific manner, and a helicase, which is essential for
transfer (2, 3). TraY facilitates TraI relaxase activity at
nic (4, 5), whereas TraM is a DNA binding protein that binds
to three sites in the oriT region (sbmA,
-B, -C). TraM is not required for cleavage at
oriT (5, 6), although it is essential for conjugation (7).
Because TraM is thought to bind TraD (8), it might function by linking the relaxosome to the transferosome, a multiprotein complex that spans
the cell envelope and is responsible for pilus assembly and mating pair formation.
The highest affinity binding sites for F TraM are sbmA and
-B, which are involved in the autoregulation of the
traM gene (9), whereas the lowest affinity site,
sbmC, is located nearest to nic and appears to
have an important role in DNA metabolism during transfer. Removal of
sbmA and -B from a cloned oriT segment
decreases transfer by 100-fold, whereas removal of sbmC
further decreases transfer another 100-fold (10). A second function of
sbmA and sbmB may be to assist binding of TraM to
sbmC, the weakest binding site, which is also the most
critical for conjugation. This is supported by a similar mutational
analysis of R100 (an F-like plasmid), where mutagenesis of the proximal
half of sbmC (closest to nic) decreased mating
120-fold, whereas mutagenesis of any of the other TraM binding sites
decreased mating to a maximum of 7-fold (11).
The multiple binding sites may function in a cooperative
fashion (12) whereby low concentrations of protein act synergistically to control DNA-related events. Cooperative binding of TraM to its
binding sites was determined using electrophoretic mobility shift
assays (EMSA)2 (2).
TraM·DNA contacts within the sbmA and -C sites
were mapped using hydroxyl radical footprinting. The results suggest
that TraM contacts slightly different bases than predicted and that the
pattern of contact by TraM on the DNA suggests the formation of a
nucleosome-like structure, which might aid in readying the DNA for transfer.
 |
EXPERIMENTAL PROCEDURES |
Recombinant DNA Techniques--
Restriction enzymes, calf
intestinal alkaline phosphatase, Klenow fragment, T4 polynucleotide
kinase, and T4 DNA ligase were supplied by Roche Diagnostics.
All procedures were as described in Ausubel et al. (13)
except where noted. Plasmids were transformed using CaCl2
competent cells (14) or by electroporation using a Bio-Rad Gene Pulser
at 2.5 V, 25 microfarads, and 200 . DNA fragments used to
create plasmid constructs were isolated from acrylamide (14) or agarose
gels (Qiagen gel extraction kit). All gels were run in 89 mM Tris, 89 mM boric acid, 2 mM
EDTA, pH 8.0, buffer unless otherwise indicated. PCR was performed
using Vent polymerase (New England BioLabs) with 20 mmol of dNTP
(Roche) and ~500 pmol of each primer in a 100-µl volume for 30 cycles. Fill-in reactions were done using Klenow polymerase and 500 pmol of dNTP in 30 µl at 37 °C for 30 min. Plasmids were isolated
using the method of Birnboim and Doly (15) or using Qiagen Miniprep columns.
Construction of Clones Containing TraM Binding
Sites--
pRF911 was constructed by phosphorylating ~400 pmol of
RFE11 (CTAGGGACGCACCGCTAGCAGCGCCCCTAGCGGTATC) and RFE12
(CTAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCC) with T4 polynucleotide kinase.
The primers were heated to 95 °C, cooled to room temperature,
digested with BlnI for 30 min, and ethanol-precipitated.
This fragment was ligated to 0.3 pmol of pBEND2 (16) digested with
XbaI, dephosphorylated with alkaline phosphatase, and
purified from a 0.6% agarose gel. pRF918 was constructed by annealing
400 pmol of LFR49 (CTAGAGCAGCGCCCCTAGCGG) and LFR50
(CTAGCCGCTAGGGGCGCTGCT) and ligating to 0.3 pmol of pBEND2 digested
with XhoI. pRF920 was constructed by digesting pNY300 with
RsaI and DraI and purifying the 58-bp band from
an agarose gel. This was ligated to pBEND2, which had been digested with SalI, dephosphorylated with alkaline phosphatase, and
filled in with Klenow polymerase. pRF940 was constructed by digesting pNY300 with DraI and SalI, and purifying the
300-bp fragment from a 5% polyacrylamide gel. This was then digested
with BstBI and filled in with Klenow polymerase, and the
190-bp fragment was purified from an 8% acrylamide gel, which was
ligated to pBEND2, which had been digested with XbaI, filled
in with Klenow polymerase, dephosphorylated with alkaline phosphatase,
and isolated from a 0.6% agarose gel. pRF930 was constructed by
digesting pRF940 with BamHI, ClaI, and
RsaI, filling in with Klenow polymerase, and purifying the
144-bp fragment from an 8% acrylamide gel. This was ligated to pBEND2
digested with XbaI, dephosphorylated with alkaline
phosphatase, filled in with Klenow polymerase, and isolated from a
0.6% agarose gel.
Electrophoretic Mobility Shift Assays--
PCR was used to
amplify sequences from pRF911, pRF912, pRF918, pRF920, pRF930, and
pRF940 with primers RFE16 (GGTGCCTGACTGCGTTGCA) and RFE17
(TAGGCGTATCACGAGGCCCT). DNA was radiolabeled by including ~50 µCi
of [ 32P]ATP in the PCR reactions. Reactions were
concentrated in a Savant SpeedVac, and the DNA was isolated from a
1.5% agarose gel. A Beckman LS3801 scintillation counter was used to
determine the concentration of labeled DNA using the specific activity
of [ 32P]ATP. Approximately 3000 cpm of DNA was used in
each reaction with the specified amount of purified TraM. Binding
reactions were conducted in binding buffer (final concentration 50 mM Tris, 10% glycerol, 1 mM dithiothreitol, 30 µg/ml bovine serum albumin) with 1 µg of poly(dI·dC) in a
final volume of 15 µl. After addition of protein, binding reactions
were incubated at 37 °C for 15 min before loading on a 8%
acrylamide gel containing 89 mM Tris, 89 mM
boric acid which had been pre-run at 4 °C at 30 mA. Gels were run at
4 °C at 30 mA until the bromphenol blue marker reached the bottom of
the gel. Gels were analyzed using a Molecular Dynamics PhosphorImager
445SI using ImageQuaNT version 4.2a software.
Bending of TraM-bound DNA--
PCR-amplified DNA (~50,000 cpm)
was digested with a series of restriction enzymes specific for the MCS
of pBEND2 for 8 h. Digests were extracted with phenol and
chloroform, ethanol-precipitated, and resuspended in 20 µl of water.
2 µl of the digested DNA was run in each lane of an 8%
polyacrylamide gel following the same protocol as for EMSA. The
relative mobility of each retarded band was calculated by comparing its
mobility to that of the BamHI-digested DNA, which
represented the most linear fragment with the highest predicted
mobility. The maximal bend angle was then estimated using the formula
= 2[cos 1(relative mobility)] (16).
Determination of Cooperativity of Binding--
The presence of
cooperativity of binding was assessed using four different but related
approaches: 1) Hill plots (12) were constructed by graphing the log of
the free DNA concentration divided by that of the total complexed DNA
versus the log of the protein concentration. The Hill
coefficient (nH), was calculated from the
maximum slope of the curve and used to determine cooperative binding
(nH greater than 1). 2) The breadth of the
binding curve was used to determine affinity of TraM for its binding
sites according to the method of Freifelder (12) with cooperativity
being defined as less than 1.81 log units between the TraM
concentrations that define 10 and 90% bound DNA (17). 3) The
cooperativity factor, , was used to determine cooperativity when
more than one species was bound during EMSA using the equation,
|
(Eq. 1)
|
Cooperativity was assumed if values of exceeded 1. 4. Cooperativity was also measured by determining the value of (18, 19) using the association constants for two individual sites in a given
fragment of DNA. For example, if the individual sites are X
and Z,
|
(Eq. 2)
|
If the association constants for each site are identical,
then,
|
(Eq. 3)
|
Values of greater than 1 indicate cooperativity.
Competition Assays to Determine the Specificity of
Binding--
The binding sites cloned into pRF911 (sbmA)
and pRF940 (sbmABC) were amplified by PCR using primers
RFE16 and RFE17 and used as competitor DNA in competitive
electrophoretic mobility assays. The non-radioactive DNA was purified
from a 1.5% agarose gel and quantified by absorbance at 260 nm. 0.5 fmol of radiolabeled template was incubated with various amounts of
TraM for 15 min at 37 °C. Non-radioactive sbmABC (0.5 amol to 500 fmol) was then added in a 1-µl volume and incubated for
an additional 15 min at 37 °C. Reactions were resolved on a 5%
acrylamide gel, and the intensity of bands was determined by
phosphorimaging the dried gel.
Hydroxyl Radical Footprinting--
Approximately 0.5 µg of
plasmid DNA (pRF911, pRF920) was digested with PvuII and run
on a 1.8% agarose gel. The 156- and 183-bp (respectively) fragments
were excised from the gel and purified. Sequencing reactions were
performed using RFE9 (GCTGCCCGGGAGGCCTTC) or RFE10
(GCTGGATATCTTTAAACTCGAG), Sequenase (United States Biochemical), and 33P-labeled ddNTP (Amersham Biosciences, Inc.). 125 pmol of RFE9 or RFE10 were end-labeled using 5 µl (50 µCi) of
[ -32P]ATP (ICN) and polynucleotide kinase for 1 h. Primers were purified using Quick Spin Oligo columns (Roche
Molecular Biochemicals). PCR reactions using the end-labeled primer and
125 pmol of either RFE9 or RFE10 were performed, and the product was
run out on a 1.8% agarose gel. The 158- and 185-bp fragments were
excised and purified. Radioactivity was quantified using a
scintillation counter and ~5000 cpm was used in each reaction.
Purified TraM was allowed to bind to the DNA in a 15-µl volume in 100 mM Tris, 1 mM EDTA, pH 8.0, buffer for 15 min
at 37 °C. 2 µl of each of 10 mM sodium ascorbate, 0.2 mM iron ammonium sulfate, 0.4 mM EDTA, and
0.3% H2O2 (v/v) were mixed and added to the
binding reaction. After 2 min 12 µl of stop solution (32 µl of 0.2 M EDTA, 10 µl of 0.1 M thiourea, and 1 µl
of 0.5 mg/ml tRNA) was added with 3 µl of 100% glycerol to stop the
cleavage reaction. Reactions were loaded onto a 5% TB polyacrylamide
gel and run at 28 mA at 4 °C until the bromphenol blue dye reached
the bottom of the gel. The gel was exposed to X-OMAT AR film (Kodak)
for 4 h. After development of the film, bands, which corresponded
to the bound and unbound DNA, were excised and the DNA was eluted
overnight in 400 µl of 0.5 M ammonium acetate, 1 mM EDTA at 37 °C. The samples were clarified by
centrifugation at 14,000 rpm in a microcentrifuge. 1 ml of 95% ethanol
was added to the aqueous layer to precipitate the DNA. The DNA was
dissolved in 5 µl of Sequencing Stop Solution (United States
Biochemical) and loaded onto an 8% polyacrylamide gel
containing 8 M urea. As a marker, 1 µl of the 10-µl G,
A, T, and C sequencing reactions was loaded onto the gel. The gel was
run at 40 watts, until the xylene cyanol marker was ~5 cm from the
bottom, dried, and exposed to a Molecular Dynamics Phosphor Screen for
up to 5 days. The intensity of each band was determined by scanning
each lane using ImageQuaNT software, and a consensus for the pattern of
binding was generated from three clearest gels.
 |
RESULTS |
TraM Binds sbmA, -B, -C Cooperatively--
EMSA was used to
determine the affinity of TraM for fragments of DNA containing
sbmA, -B, and/or sbmC derived from the
F oriT region. The TraM binding sites were cloned
individually and in combinations into pBEND2 (Ref. 16, Fig.
1) to give pRF911 (sbmA), pRF918 (half of the sbmA site), pRF920 (sbmC),
pRF930 (sbmAB), and pRF940 (sbmABC). Examples of
EMSA for these fragments and a negative control (MCS of pBEND2) are
shown in Fig. 2, A-F. Shifts above 1700 nM TraM were considered to be the result of
nonspecific binding as demonstrated in the negative control (Fig.
2F). TraM bound to sbmA, sbmAB, and
sbmABC in an ordered fashion giving one or two retarded
species (complexes I and II) below 1700 nM. A finer
gradation in increasing TraM concentrations gave more precisely defined
patterns of band retardation for sbmAB and
sbmABC, which were used to determine association constants
and the presence of cooperativity (Fig.
3, A and B). Only
two species were initially seen for sbmABC (Fig. 2), which
were resolved into three distinct bands in Fig. 3B
(complexes I-III). Increased amounts of TraM gradually decreased the
mobilities of sbmC and the half sbmA site, with a
faint intermediate band appearing in the latter (Fig. 2, B
and C). This was interpreted as a lower affinity for these
sites and indicated that either TraM requires both half sites in
cis for high affinity binding or the smaller repeats within
sbmA are not sufficient for TraM recognition. By calculating
the percentage of unbound DNA in each lane, association constants
(Ka) were estimated (1/[TraM] at 50% unbound,
Table I). TraM bound sbmA and sbmAB with similar affinities (1-2 × 108 M 1), sbmABC
with the highest affinity (5 × 108
M 1), and sbmC and half
sbmA with ~3- to 15-fold lower affinities than
sbmA. These results reflected the DNase I protection pattern of the F oriT region, which showed that the order of binding
was sbmA>sbmB>sbmC (6).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 1.
Sequences of the TraM binding sites cloned
into pBEND2 (16). The positions of putative repeats are shown with
arrows. On larger sites such as sbmAB and
sbmABC, the names of the individual binding sites are
indicated. The number of nucleotides to the primers used in PCR
amplification, RFE16 and RFE17, are shown bordering the
sequences.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Binding of TraM to sbmA
(A), sbmC (B),
half sbmA (C), sbmAB
(D), sbmABC
(E), and a negative control
(F). Binding sites were amplified from the clones
described in Fig. 1. DNA (0.3 fmol) was bound with increasing
concentrations of TraM (in nanomolar). Bound complexes (I, II, III) are
indicated with Roman numerals.
|
|

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
EMSA of TraM bound to sbmAB
(A) and sbmABC
(B) using finer gradations of increasing TraM
concentration (nanomolar). Bound complexes are shown with
Roman numerals.
|
|
Determining Cooperativity of Binding--
TraM could bind
sbmA, sbmC, sbmAB, or
sbmABC cooperatively because of the presence of two half
sites in sbmA and sbmC as well as multiple sites
in the more complex fragments. Consequently, a variety of methods were
used to assess cooperative binding ("Experimental Procedures").
Using the EMSA data (Figs. 2 and 3), Hill plots were constructed for
sbmA, sbmC, sbmAB, and
sbmABC and used to determine the Hill coefficient,
nH (Table I). If nH is
greater than 1 and less than n, the number of binding sites,
cooperativity is assumed. The nH value for
sbmA was 1.7 indicating cooperative binding to
sbmA, which has two TraM binding sites. A Hill coefficient of 0.9 was found for sbmC, which contains also two predicted
binding sites, indicating non-cooperative binding. Hill coefficients of 3.25 and 2.9 were found for sbmAB (four sites) and
sbmABC (six sites), respectively, indicating cooperative
binding of TraM to both these fragments. The breadth of the binding
curve, and values (Table I), also confirmed that TraM bound
sbmA, sbmAB, and sbmABC cooperatively,
with TraM binding to sbmABC with the greatest degree of
cooperativity. Calculations for were not done for
sbmABC, because the presence of three shifted species on an
EMSA complicated the calculations.
Competition Assays to Determine Specificity of Binding--
The
stabilities of TraM·DNA complexes described above were determined by
performing EMSA in the presence of increasing amounts of unlabeled
sbmA or sbmABC competitor DNA. The amount of TraM used to generate either complex I or II(III) was based on the results
presented in Fig. 2. Competitive EMSA using sbmA as a competitor gave similar results to assays using sbmABC and
are not shown. TraM bound to sbmA (complex I, Fig.
4A), sbmAB (complex II, data not shown), or sbmABC (complex II(III), Fig.
5) could be competed off at high
concentrations of either competitor DNA. In the case of
sbmAB (data not shown) and sbmABC (Fig. 5),
complex II was shifted to the position of complex I at the highest
concentrations of competitor DNA. Complex I of sbmAB or
sbmABC was extremely stable and could not be competed off
over the range of competitor DNA used during a 15-min incubation. TraM
bound to sbmC was completely competed off with 100-fold
excess of competitor DNA, supporting the idea that TraM has a lower
affinity for linear DNA containing sbmC alone (Fig.
4B).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 4.
EMSA competition assays to determine the
stability of TraM bound to sbmA (A)
and sbmC (B). TraM was 21 nM or 170 nM as indicated. 0.5 fmol of DNA was
used in each lane with the amount and type of competitor specified
above each lane. The positions of unbound fragments are
shown in the lanes with no protein.
|
|

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
EMSA competition assays to determine the
stability of TraM·sbmABC complexes formed using 6.8 nM or 17 nM. 0.5 fmol of DNA was used in
each lane with the amount of sbmABC competitor specified
above each lane. The position of unbound fragments are shown
in the lanes with no protein.
|
|
DNA Bending Assays--
The ability of TraM to bend DNA was
estimated using circular permutation assays (see "Experimental
Procedures"). Using primers that bordered the MCS of pBEND2, DNA
fragments from pRF911 (sbmA) and pRF940 (sbmABC)
were amplified by PCR and digested with restriction enzymes to generate
a nest of fragments of equal length but with the TraM binding site
positioned at different distances from the ends of the fragments. The
fragments, with or without TraM bound, were subject to EMSA, and the
relative mobilities of fragments were calculated (Fig.
6). Using the equation from Kim et
al. (16), TraM was estimated to bend sbmA by 50° or
less. No detectable bending of sbmABC was observed,
suggesting that TraM bound to all three sites to form a compact
structure possibly involving bends and loops in the DNA that was
insensitive to the position of the large sbmABC binding site
within the DNA fragment.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Analysis of sbmA
(A) and sbmABC
(B) bending by TraM. The fragments were
digested with the restriction enzymes indicated and electrophoresed
with or without 17 and 6.8 nM TraM. The unbound and bound
DNA fragments are indicated by the lower and upper
arrows, respectively. The bands below the lower arrow
represent small labeled fragments resulting from digestion of the PCR
products with different restriction enzymes, which were used as
negative controls for TraM binding as well as internal markers for the
distance each band had migrated in the gel.
|
|
Hydroxyl Radical Footprinting--
Previously, DNase I
footprinting had delineated sequences (smbA, -B,
-C) in the oriT region protected by TraM, which
suggested that TraM contacted the upper, retained DNA strand more than
the lower, transferred strand. These protected regions were used to predict a consensus sequence, which was thought to be important for
TraM recognition of its binding sites
(NT(A/G)(G/T)(G/C)GG(C/T)GC(T/G)GCTA (6)). To determine which
nucleotides are contacted by TraM within these binding sites, hydroxyl
radical footprinting of the upper and lower strands of DNA containing
sbmA and sbmC was performed (Fig.
7, A and B), and
the results from three different gels are summarized in Fig.
8. Unlike the DNase I protection assay,
protection of bases in the top and bottom strands was approximately
equal. There also appeared to be protection of bases outside the
sbmC footprint with a spacing pattern of ~11 bp (Figs.
7B and 8B).

View larger version (127K):
[in this window]
[in a new window]
|
Fig. 7.
Hydroxyl radical footprinting of the top and
bottom strands of sbmA (A) and
sbmC (B). Sequencing reactions
(GATC) using the same primers as for the footprinting are shown to the
left (sbmA) and right
(sbmC) of each of the footprinting lanes. The
brackets show the position of the footprint defined by DNase
I protection (6). Large and small asterisks show
the strongly and weakly protected bases, respectively. Protein
concentrations used in the experiment are shown above the
lanes. Arrows indicate protected bases outside the
DNase I footprint
|
|

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 8.
Summary of bases protected by TraM during
hydroxyl radical footprinting of sbmA
(A) and sbmC
(B). The thick brackets above
the sequences represent the DNase I footprints (6). The
solid arrows represent the direct and inverted repeats in
Fig. 1 whereas the dashed arrows indicate the repeats based
on the CTAG motif. The thin brackets represent the 12-bp
spacing in sbmA (A) and the 11-bp spacing in
sbmC (B). The boldface
letters represent bases derived from the vector. The degree of
protection is proportional to the shading of the
boxes.
|
|
The hydroxyl radical footprint for sbmA did not align
precisely with the predicted consensus sequence but was shifted
somewhat upstream (solid arrows compared with dashed
arrows in Fig. 8A). Although the GC-rich nature of the
TraM binding sites is striking, TraM contacted the CT bases within the
CTAG motif, repeated twice, 12 bases apart, on both the upper and lower
strands of sbmA, suggesting that sequence recognition was
dependent on the non-GC bases within this 4-base palindrome.
The pattern of contact between TraM and bases within sbmC
appeared to be unrelated to the footprint for TraM and sbmA
(Fig. 8B). The strongest binding was in the center of the
inverted repeat with both strands of the DNA being protected. This
sequence bears no resemblance to the CTAG motif in sbmA
suggesting that sequence recognition and protection did not coincide
with each other. Radiating out from this central footprint are
protected regions spaced approximately every 11 bases toward the
5'-ends of the DNA fragment. The bases protected at these intervals do
not in any way resemble the sequences protected in sbmA.
 |
DISCUSSION |
An improved purification procedure for TraM has allowed better
resolution of shifted bands in EMSA, resulting in the estimation of
Ka values that reflect the affinity of TraM for its binding sites. Although TraM is predominately a tetramer upon purification (6, 20, 21), monomer and dimer forms are present as
measured by gel exclusion and analytical ultracentrifugation. Resizing
purified tetrameric TraM resulted in the reappearance of monomers and
dimers, suggesting that the three forms of TraM exist in equilibrium
(3).
The cooperative nature of TraM binding, especially to
sbmABC, was clearly evident and probably reflects the
tetrameric nature of the protein. In binding to sbmAB, an
initial complex (I) of TraM bound to sbmA could be converted
to a single tetramer of TraM bound to both sbmA and
sbmB simultaneously (complex II) upon increasing
concentrations of TraM. Thus the small amounts of the monomeric or
dimeric forms of TraM might initiate the binding process, followed by
tetramerization of TraM during cooperative binding to these sites.
Preliminary evidence on estimating the number of TraM molecules bound
to sbmAB suggested that complex I contains less than a
tetramer of TraM whereas complex II does indeed contain a tetramer.
More complete studies are currently under way. The number and
arrangement of TraM subunits within complex III of sbmABC is
not obvious, because TraM is apparently binding up to six sites
involving direct and inverted repeats simultaneously.
Analysis of F TraM, bound to its individual binding sites
(sbmA and sbmC), showed little bending of the
DNA. This is in accord with results for TraM from the F-like plasmid
pED208, which had no detectable effect on DNA bending as determined by
electron microscopy (22). Instead, IHF, which has two binding sites in oriT bordering sbmC, has been implicated in
construction of the relaxosome in F and pED208 (22, 23). The sequence
between sbmA and sbmB does not contain an IHF
binding site (3), suggesting that TraM could bind sbmA and
-B simultaneously, folding the DNA back on itself to form a
hairpin. Thus, bending the DNA in the sbmABC region could
involve a combination of IHF and looping by TraM.
An interesting phenomenon involved the binding patterns of TraM to
sbmA, sbmAB, and sbmABC
versus sbmC and a half sbmA site. The
binding pattern of the first three gave defined species suggesting the
formation of distinct complexes that were composed of specified amounts
of protein and DNA. However, binding to the latter two binding sites
gave species that gradually increased in size as more TraM was added, a
phenomenon that was also seen in all EMSAs at high protein
concentrations. This suggests that, as more protein was added, the
protein complex bound to the DNA increased proportionately in size,
with the added TraM being distributed approximately evenly among all
the complexes. The smearing of these species during EMSA also suggested
that these complexes were not stable and dissociated during
electrophoresis. The striking pattern of protection in the hydroxyl
radical footprints occurred at approximately every 11-12 bp. This
suggests a model whereby TraM could wrap the DNA around itself to form
a large complex with the protein contacting 4-5 bases approximately
every 11 bp. This would resemble the nucleosome-like structure proposed
for TraK in the RP4 system (24). TraK bends the DNA and wraps it around
a multimeric core of protein in a process that is independent of
IHF.
Competition assays demonstrated that complex I and II(III) for
sbmA, sbmAB, and sbmABC, were found to
be highly stable and resist dissociation in the presence of a 1000-fold
excess of specific DNA competitor. At very high concentrations of
competitor DNA, small amounts of dissociation were seen for complex II
of sbmAB and sbmABC, which resulted in formation
of complex I. Complex I resisted dissociation in all cases suggesting a
very stable complex was formed. Binding to sbmC was not as
strong, and dissociation was seen when competitor DNA reached a
100-fold excess. Clearly, the presence of sbmA and
sbmB stabilizes TraM binding to sbmC. These
experiments were conducted using linear DNA templates, however, supercoiling is predicted to have an effect on TraM activity and possibly increase the degree of cooperativity even further, an aspect
of TraM function that is currently under study.
Hydroxyl radical footprinting was also performed on TraM bound to
sbmA and sbmC to define which bases were
protected within the previously published DNase I footprint (6).
Footprinting of sbmA showed that TraM had as many points of
contact on the upper and lower strands in contrast to the results for
DNase I footprinting, which indicated more contact with the upper,
retained strand. Modeling TraM onto sbmA suggested that a
dimer initially recognizes the sequence CTAG and binds to two adjacent
major grooves 12 bp apart on the same face of the DNA (Fig. 8). This
would agree with the tetrameric nature of TraM where each dimer within
a tetramer would interact with two major grooves at two binding sites
(sbmA and sbmB, for instance), in a cooperative fashion.
Footprinting of sbmC showed that TraM made contact with the
top and bottom strands in a symmetrical pattern, although there appeared to be no sequence conservation between the contacted sites.
The footprints on the top and bottom strands were approximately equal
in intensity and were centered at the ACAACA sequence in the center of
the footprint. Interestingly the footprints extended from the central
region toward the 5'-ends of the DNA fragment. Two dimers can be
modeled onto the sbmC site with each dimer occupying two
major grooves on the upper and lower strands, respectively. The dimers
would overlap at the center of the inverted repeat giving protection on
both strands (Fig. 8B). The spacing of 11-12 bp is
suggestive of a phase-dependent process with one face of the DNA repeatedly contacting the protein. A consensus sequence was
previously generated from the DNase I footprints by compiling the
sequences in all three TraM binding sites (6). However, the hydroxyl
radical footprint for sbmA demonstrated that contact with
the DNA was shifted slightly upstream toward the palindromic sequence
CTAG and that all four CTAG sequences in sbmA were involved (Fig. 8). TraM contacted the DNA every 11-12 bases outside the original DNase I footprint when a high concentration of TraM was used
(Fig. 7, A and B). This suggested that TraM
aggregates, as seen at high concentrations of protein on EMSA gels,
wrapping the DNA around the protein and contacting the same face of the DNA upon each turn.
The importance of multiple binding sites was exemplified by the LacI
repressor using a reporter gene containing various combinations of Lac
operators (25). These experiments showed that O1 is
required for repression, with repression increasing 38- and 24-fold
when O2 or O3, respectively, were present. This
effect was attributed to cooperativity of binding by Lac repressor
tetramers to the DNA. A similar mechanism can be suggested for TraM at
oriT. The weak binding sites, sbmC (10) and
sbmA in R100 (corresponding to the proximal half of
sbmC in F (11)), have been shown to be of critical
importance in maximizing transfer efficiency. The increase in affinity
of TraM for DNA fragments containing sbmABC versus sbmC alone (almost 10-fold) suggests that
sbmAB may assist with loading TraM onto sbmC, the
weakest binding site, a step that might be critical for TraM function
and efficient transfer.
We have demonstrated that the intracellular concentration of TraM is
critical for transfer (26). As cells enter exponential growth, the
transcription of traM diminishes and the levels of TraM in
the cell are undetectable by late exponential phase. If sbmC, the site nearest oriT, and ostensibly the
most important for transfer, was bound by TraM in a manner that was
sensitive to the intracellular concentrations of the protein, the F
conjugation apparatus would have engineered a simple, sensitive
mechanism for controlling conjugation ability. In wild type F-like
plasmids, conjugation is repressed by the fertility inhibition system
FinOP (27). F is naturally derepressed and appears to control
its fertility via a complex circuitry centered around control of
traM transcription by TraY (9) and other host proteins. F
could modulate its readiness for transfer at oriT by
controlling the amount of TraM in the cell which, in turn, would affect
binding of TraM to sbmC, following binding to
smbA and sbmB, in a cooperative manner. This
model would predict that binding of TraM to the oriT region,
especially sbmC, would affect the local superhelical density of the DNA. This would cause unwinding near oriT, most
probably in the AT-rich region upstream of sbmC in
sbyA, permitting entry of the TraI helicase and initiating
large scale DNA unwinding and transport to the recipient cell. Because
TraM has been suggested to bind TraD, the coupling protein (8, 28), the
ability to form a nucleosome-like structure at high intracellular
concentrations plus its ability to move the DNA into position for
transport by binding TraD suggest that TraM might indeed be the
"signaling" protein proposed by Willetts and Wilkins in 1984 (29).
 |
FOOTNOTES |
*
This work was supported in part by the Canadian Institutes
for Health Research.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by an Alberta Heritage Foundation for Medical Research
Studentship. Present address: the Laboratory of Biochemistry, NCI,
National Institutes of Health, Bldg. 37, Rm. 6044, 37 Convent Dr.,
Bethesda, MD 20892-4255.
§
To whom correspondence should be addressed: Dept. of Biological
Sciences, CW405 Biological Sciences Bldg., University of Alberta, Edmonton, Alberta T6G 2E9, Canada. Tel.: 780-492-5172; Fax:
780-492-9234; E-mail: laura.frost@ualberta.ca.
Published, JBC Papers in Press, March 1, 2002, DOI 10.1074/jbc.M111682200
1
The nucleotide sequence of the F plasmid is
available in the GenBankTM database under accession number NC002483.
 |
ABBREVIATIONS |
The abbreviations used are:
EMSA, electrophoretic mobility shift assay;
MCS, multiple cloning site;
IHF, integration host factor.
 |
REFERENCES |
| 1.
|
Frost, L. S.,
Ippen-Ihler, K.,
and Skurray, R. A.
(1994)
Microbiol. Rev.
58,
162-210[Abstract/Free Full Text]
|
| 2.
|
Matson, S. W.,
Nelson, W. C.,
and Morton, B. S.
(1993)
J. Bacteriol.
175,
2599-2606[Abstract/Free Full Text]
|
| 3.
|
Matson, S. W.,
Sampson, J. K.,
and Byrd, D. R.
(2001)
J. Biol. Chem.
276,
2372-2379[Abstract/Free Full Text]
|
| 4.
|
Nelson, W. C.,
Howard, M. T.,
Sherman, J. A.,
and Matson, S. W.
(1995)
J. Biol. Chem.
270,
28374-28380[Abstract/Free Full Text]
|
| 5.
|
Fekete, R. A.,
and Frost, L. S.
(2000)
J. Bacteriol.
182,
4022-4027[Abstract/Free Full Text]
|
| 6.
|
Di Laurenzio, L.,
Frost, L. S.,
and Paranchych, W.
(1992)
Mol. Microbiol.
6,
2951-2959[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Achtman, M.,
Willetts, N.,
and Clark, A. J.
(1971)
J. Bacteriol.
106,
529-538[Abstract/Free Full Text]
|
| 8.
|
Disque-Kochem, C.,
and Dreiseikelmann, B.
(1997)
J. Bacteriol.
179,
6133-6137[Abstract/Free Full Text]
|
| 9.
|
Penfold, S. S.,
Simon, J.,
and Frost, L. S.
(1996)
Mol. Microbiol.
20,
549-558[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Fu, Y. H.,
Tsai, M. M.,
Luo, Y. N.,
and Deonier, R. C.
(1991)
J. Bacteriol.
173,
1012-1020[Abstract/Free Full Text]
|
| 11.
|
Abo, T.,
and Ohtsubo, E.
(1995)
J. Bacteriol.
177,
4350-4355[Abstract/Free Full Text]
|
| 12.
|
Freifelder, D.
(1982)
Physical Biochemistry: Applications to Biochemistry and Molecular Biology
, W. H. Freeman and Co., San Francisco
|
| 13.
|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, J. A.
(eds)
(1987)
Current Protocols in Molecular Biology, and Supplements
, John Wiley & Sons, Inc., New York
|
| 14.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 15.
|
Birnboim, H. C.,
and Doly, J.
(1979)
Nucleic Acids Res.
7,
1513-1523[Abstract/Free Full Text]
|
| 16.
|
Kim, J.,
Zwieb, C., Wu, C.,
and Adhya, S.
(1989)
Gene
85,
15-23[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Carey, J.
(1991)
Methods Enzymol.
208,
103-117[Medline]
[Order article via Infotrieve]
|
| 18.
|
Carlson, N. G.,
and Little, J. W.
(1993)
J. Mol. Biol.
230,
1108-1130[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Chatterjee, J.,
Miyamoto, C. M.,
and Meighen, E. A.
(1996)
Mol. Microbiol.
20,
415-425[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Penfold, S. S.
(1995)
Transcriptional Regulation of the F Plasmid.Ph.D. thesis
, University of Alberta
|
| 21.
|
Kupelweiser, G.,
Schwab, M.,
Hogenauer, G.,
Koraimann, G.,
and Zechner, E. L.
(1998)
J. Mol. Biol.
275,
81-94[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Di Laurenzio, L.,
Scraba, D. G.,
Paranchych, W.,
and Frost, L. S.
(1995)
Mol. Gen. Genet.
247,
726-734[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Tsai, M. M., Fu, Y. H.,
and Deonier, R. C.
(1990)
J. Bacteriol.
172,
4603-4609[Abstract/Free Full Text]
|
| 24.
|
Ziegelin, G.,
Pansegrau, W.,
Lurz, R.,
and Lanka, E.
(1992)
J. Biol. Chem.
267,
17279-17286[Abstract/Free Full Text]
|
| 25.
|
Oehler, S.,
Eismann, E. R.,
Kramer, H.,
and Muller-Hill, B.
(1990)
EMBO J.
9,
973-979[Medline]
[Order article via Infotrieve]
|
| 26.
|
Frost, L. S.,
and Manchak, J.
(1998)
Microbiology
144,
2579-2587[Abstract/Free Full Text]
|
| 27.
|
Frost, L.,
Lee, S.,
Yanchar, N.,
and Paranchych, W.
(1989)
Mol. Gen. Genet.
218,
152-160[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Cabezon, E.,
Sastre, J. I.,
and de la Cruz, F.
(1997)
Mol. Gen. Genet.
254,
400-406[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Willetts, N. S.,
and Wilkins, B. M.
(1984)
Microbiol. Rev.
48,
24-41[Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. J. Fenner, W. Goh, and J. Kwang
Sequestration and Protection of Double-Stranded RNA by the Betanodavirus B2 Protein
J. Virol.,
July 15, 2006;
80(14):
6822 - 6833.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Will and L. S. Frost
Characterization of the Opposing Roles of H-NS and TraJ in Transcriptional Regulation of the F-Plasmid tra Operon
J. Bacteriol.,
January 15, 2006;
188(2):
507 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lu and L. S. Frost
Mutations in the C-Terminal Region of TraM Provide Evidence for In Vivo TraM-TraD Interactions during F-Plasmid Conjugation
J. Bacteriol.,
July 15, 2005;
187(14):
4767 - 4773.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Matson and H. Ragonese
The F-Plasmid TraI Protein Contains Three Functional Domains Required for Conjugative DNA Strand Transfer
J. Bacteriol.,
January 15, 2005;
187(2):
697 - 706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lu, W. Zhao, and L. S. Frost
Mutational Analysis of TraM Correlates Oligomerization and DNA Binding with Autoregulation and Conjugative DNA Transfer
J. Biol. Chem.,
December 31, 2004;
279(53):
55324 - 55333.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Beranek, M. Zettl, K. Lorenzoni, A. Schauer, M. Manhart, and G. Koraimann
Thirty-Eight C-Terminal Amino Acids of the Coupling Protein TraD of the F-Like Conjugative Resistance Plasmid R1 Are Required and Sufficient To Confer Binding to the Substrate Selector Protein TraM
J. Bacteriol.,
October 15, 2004;
186(20):
6999 - 7006.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Miller and J. F. Schildbach
Evidence for a Monomeric Intermediate in the Reversible Unfolding of F Factor TraM
J. Biol. Chem.,
March 14, 2003;
278(12):
10400 - 10407.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|