HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 19, 16750-16757, May 10, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/19/16750    most recent M200475200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Oberkofler, H. Articles by Patsch, W. Search for Related Content PubMed PubMed Citation Articles by Oberkofler, H. Articles by Patsch, W. Social Bookmarking                      What's this?

Peroxisome Proliferator-activated Receptor (PPAR)  Coactivator-1 Recruitment Regulates PPAR Subtype Specificity^*

Hannes Oberkofler, Harald Esterbauer, Veronika Linnemayr, A. Donny Strosberg^§, Franz Krempler^¶, and Wolfgang Patsch

From the  Department of Laboratory Medicine, Landeskliniken Salzburg, A-5020 Austria, the ^¶ Department of Internal Medicine, Krankenhaus Hallein, A-5400 Austria, and the ^§ Institute Cochin de Genetique Moleculaire, Paris, 75014 France

Received for publication, January 16, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The peroxisome proliferator-activated receptors (PPAR)  and  play key roles in the transcriptional control of contrasting metabolic pathways such as adipogenesis and fatty acid -oxidation. Both ligand-activated nuclear receptors bind to common target gene response elements and interact with distinct domains of the transcriptional coactivator PGC-1 to attain their full transcriptional potency. Thus, PPAR subtype specificity may be determined by ligand availability and transcription factor or coactivator expression levels. To identify other, perhaps more precise mechanisms contributing to PPAR subtype specificity, we studied PGC-1 recruitment by PPARs using a previously described hormone response element in the human UCP1 promoter and a human brown adipocyte cell line as our model system. As in rodents, PGC-1 is involved in the transcriptional regulation of the UCP1 gene in humans and mediates the effects of PPAR and PPAR agonists and retinoic acid. Interestingly, a previously postulated PGC-1 repressor selectively affects the PPAR-mediated activation of UCP1 gene expression. Furthermore, inhibition of p38 MAPK signaling, known to regulate the PGC-1/repressor interaction, decreases the stimulatory effect of PPAR agonist treatment without reducing the response to thiazolidinedione or retinoic acid. These data support a model whereby PPAR subtype specificity is regulated by recruitment of PGC-1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Transcription of the uncoupling protein-1 (UCP1)¹ gene is almost exclusively restricted to brown adipose tissue (BAT) where its major function in diet-induced and in non-shivering thermogenesis depends on the capacity to uncouple oxidative phosphorylation from ATP generation (1). Several physiological stimuli including cold exposure and sympathetic signaling via norepinephrine and cAMP as well as thyroid hormone regulate UCP1 gene expression in rodents (2-5). In addition, retinoids (6, 7) and synthetic ligands for the peroxisome proliferator-activated receptors PPAR (8) and PPAR (9, 10) increase rodent UCP1 gene expression. A multipartite response element with partial homology to rat and mouse UCP1 enhancers has been identified recently (11) in humans. Located within this element is a putative binding site for cAMP-response element-binding protein mediating the effect of catecholamines on UCP1 gene expression as well as a complex element containing consensus recognition sites for the retinoic acid receptors, PPAR and PPAR.

The PPARs are ligand-activated transcription factors and members of the nuclear hormone receptor superfamily (12). PPAR is a master regulator of adipocyte differentiation (13), as evidenced by induction of adipose tissue markers in fibroblasts and myoblasts upon its ectopic overexpression (14), and controls the expression of genes involved in fatty acid synthesis and glucose metabolism (reviewed in Ref. 15). PPAR is involved in fatty acid catabolism by regulating the expression of genes encoding fatty acid oxidation enzymes (12, 16, 17). As in some other tissues, PPAR and PPAR are both expressed in BAT (18). Because each factor binds to the same consensus sequence in the UCP1 promoter, mechanism(s) must exist that regulate PPAR subtype specificity. The distinct transcriptional programs of PPAR subtypes could be realized through differential activation by endogenous and exogenous ligands. In addition, PPAR has also been shown to be more sensitive to sequences in the 5'-flanking regions of PPAR-response elements (PPREs), a finding that might help to explain subtype specificity (19). Moreover, distinct physical and functional interactions of PPARs with tissue-specific coactivators or corepressors and subtype-specific recruitment mechanisms of such factors may profoundly affect the transactivation properties of individual PPARs.

The PPAR coactivator-1 (PGC-1/PPARGC1) was originally described as a cold-inducible coactivator, regulating adaptive thermogenesis by increasing the transcriptional activation of the UCP1 gene by PPAR and the thyroid hormone receptor (20). PGC-1 interacts with several other nuclear hormone receptors including the glucocorticoid receptor (GR) (21), mineralocorticoid receptor (21), estrogen receptor (22), retinoic X receptor (RXR) (23), and PPAR (24). Studies by Puigserver et al. (25) showed that PGC-1 contains a negative regulatory domain that was mapped to amino acids 170-350. This region overlaps with the domain involved in docking of several transcription factors including GR, PPAR, and PPAR. Elegant studies led Knutti et al. (26) to postulate that a repressor competes with GR for binding to an overlapping domain of the PGC-1 molecule. This region of PGC-1 contains two Leu-rich motifs termed L2 and L3, essential for its interaction with PPAR, whereas the PPAR coactivation function maps to a different surface (20). We therefore tested the hypothesis that competition of a repressor with PPAR for binding to PGC-1 contributes to PPAR subtype specificity. We used a multipartite response element of the UCP1 promoter to confirm that PGC-1 is a potent transcriptional coactivator of PPAR and PPAR. However, the PPAR-mediated transcriptional response was negatively regulated by a putative PGC-1 repressor and by inhibition of p38 MAPK signaling, whereas the PPAR-mediated transcriptional response remained unaltered. Thus, regulation of coactivator recruitment by PPARs contributed to PPAR subtype specificity in the context of the UCP1 promoter.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- DNA restriction and modification enzymes were obtained from New England Biolabs (Beverly, MA) and Promega (Madison, WI). Cell culture media, fetal calf serum, and LipofectAMINE 2000 were obtained from Invitrogen. The synthetic PPAR ligand WY 14,643, 9-cis-retinoic acid (RA), all-trans-retinoic acid, dexamethasone, insulin, and triiodothyronine were purchased from Sigma. Troglitazone (TZD) was from Sankyo (Tokyo, Japan), and SB 202190 was purchased from Calbiochem. The QuikChange Site-directed Mutagenesis kit was obtained from Stratagene (La Jolla, CA). The Dual Luciferase Assay System was purchased from Promega.

Plasmid Constructs-- The (3846)UCP1-Luc plasmid in which the region from 3846 to + 71 of the human UCP1 gene drives the promoterless firefly luciferase gene was generated using 5' CATACGCGTCAGCGATTTCTGATTGAACCACAGTT 3' (3846 to 3820) and 5' CATCTCGAGAGTCCGATCCCCTCCTACCCAC 3' (+49 to +71) as upper and lower primers to amplify a 3917-bp DNA fragment that was cloned into the pGL3-Basic Vector (Promega). Numbers in parentheses refer to primer positions relative to the transcriptional start site (GenBank^TM accession number U28479). MluI and XhoI restriction enzymes sites introduced into the primer sequences are in boldface. The HindIII restriction site at nucleotide 3328 was used to generate the (3328)UCP1-Luc deletion construct by subcloning a HindIII-XhoI fragment into the pGL3-Basic Vector.

For construction of the U1-EN-Luc plasmid, a 249-bp fragment spanning nucleotides 3846 to 3598 was amplified using the upper primer described above and 5'-CATCTCGAGTCAGGTTGGAGAGAGCAGTAGG-3' (3820 to 3798) as lower primer. The resulting fragment was ligated into the pGL3-Promoter Vector (Promega). Mutations described by Gonzales-Barroso et al. (11) were introduced into the U1-EN-Luc plasmid to generate the mutC-, mutD-, and mutE-Luc reporter constructs using the QuikChange Site-directed Mutagenesis kit (Stratagene) and the primers shown in Table I.

A mammalian expression vector containing the human cDNA for PGC-1 driven by the cytomegalovirus immediate-early promoter (hPGC-1) was generated by reverse transcriptase-PCR amplification of the entire PGC-1 coding region (27) (GenBank^TM accession number AF106698). A 2340-bp cDNA fragment was amplified from human kidney total RNA using 5' TTCAGGAGCTGGATGGCGTGGGAC 3' and 5' TTACCTGCGCAAGCTTCTCTGAGCTTC 3' as forward and reverse primers, respectively, and ligated into the pcDNA6/V5-HisA vector (Invitrogen). The L2mutPGC-1 construct was derived from the original hPGC-1 expression construct by PCR-mediated site-directed mutagenesis using 5' CTCTACTTAAGAAGGCCGCACTGGCACCAGCCAA 3' and 5' TTGGCTGGTGCCAGTGCGGCCTTCTTAAGTAGAG 3' as forward and reverse primers, respectively. Mutated nucleotides are in bold. A deletion construct encompassing amino acids 92-292 (PGC-1-L2) was derived from the L2mutPGC-1 construct using 5' ACTACTGCTAGCATGGTCCTCACAGAGACACTAGAC 3' and 5' CAGGTACCAGTTAGGCCTGCAGTTCCAG 3' as forward and reverse primers, respectively. The resulting cDNA fragment was cloned into pcDNA6/V5-HisA. NheI and KpnI restriction enzymes sites introduced into the primer sequences are in bold. All constructs described were verified by dye-terminator cycle sequencing using the ABI Prism^TM 310 Genetic Analyzer (Applied Biosystems Inc., Foster City, CA).

Cell Culture and Transfection Studies-- PAZ6 cells were cultured in preadipocyte medium consisting of Dulbecco's modified Eagle's medium/F-12 supplemented with 10% fetal calf serum and 15 mM HEPES buffer. For differentiation, confluent PAZ6 preadipocytes were cultivated for 4 days in Dulbecco's modified Eagle's medium/F-12 supplemented with 15 mM HEPES, 0.25 mM 3-isobutyl-1-methylxanthine, 0.1 µM dexamethasone, 850 nM insulin, 1 nM triiodothyronine, and 1 µM troglitazone (28). Cells were washed twice with Hanks' balanced salt solution and incubated for 3 h in preadipocyte medium without drugs before transfection. Drugs at concentrations of 10 µM for troglitazone, 9-cis-retinoic acid, all-trans-retinoic acid and WY 14,643 and 20 µM for SB 202190 were added immediately before transfection.

Differentiated PAZ6 cells cultured in 24-well dishes were transfected using LipofectAMINE 2000 reagent. Unless otherwise indicated, we used 1 µg of reporter plasmids, 0.5 µg of expression plasmids, and 20 ng of pRL-TK plasmid (Promega) as transfection control. In dose-response experiments empty pGL3-Basic Vector was added to keep the amount of transfected DNA constant. Transfected differentiated cells were collected 24 h after transfection, and firefly and Renilla luciferase activities were measured in a luminometer (Anthos Labtec Instruments, Salzburg, Austria) using the Dual-luciferase Reporter Assay System (Promega). Graphs are representative for one of two experiments, each performed in quadruplicate. Results are given as means ± S.D.

Electrophoretic Mobility Shift Assays (EMSA)-- Nuclear extracts from differentiated PAZ6 cells were prepared, and EMSAs were performed as described recently (29). In brief, double-stranded 41-mers containing wild-type and/or mutated hexamers C-E were prepared by annealing of gel-purified sense and antisense oligonucleotides. An EcoRI overhang was filled in using [-³²P]dATP and Klenow enzyme. Nuclear extracts (2 µg) were mixed with binding buffer containing 1 µg of double-stranded poly(dI-dC) and preincubated for 15 min at room temperature. After the preincubation period ³²P-labeled wild-type 41-mer (~20,000 counts/min) was added, and the reaction mixture was incubated on ice for 20 min. For competition experiments increasing concentrations of unlabeled double-stranded oligonucleotides were included during preincubation.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PGC-1 Coactivates the Human UCP1 Promoter via a Putative PPRE/RARE (Retinoic Acid Response Element) in Differentiated Human Brown Adipocytes-- To examine the role of the transcriptional coactivator PGC-1 in the regulation of the human UCP1 gene, we performed cotransfection studies in PAZ6 cells expressing a low level of endogenous PGC-1 (data not shown). A plasmid construct containing 3.9 kb of human UCP1 5'-flanking sequence fused to a luciferase reporter gene (3846UCP1-Luc) was transiently transfected into differentiated PAZ6 cells. Cotransfection with an expression vector containing the entire coding region of human PGC-1 (hPGC-1) resulted in an up to 5-fold increase in the transcriptional activity of the luciferase construct in a dose-dependent manner (Fig. 1, A and B).

View larger version (14K): [in this window] [in a new window]   Fig. 1.   PGC-1 stimulates UCP1 gene expression via a multipartite retinoic acid response element/PPAR response element. A, differentiated PAZ6 cells were transfected with (3846)UCP1-Luc or (3328)UCP1-Luc either together with or without a human PGC-1 expression construct (hPGC-1). UCP1-driven firefly luciferase activity levels were standardized to pRL-TK driven Renilla luciferase levels used as transfection control. Fold stimulation refers to (3846)UCP1-Luc basal expression levels in the absence of hPGC-1. B, dose-response curve for the effect of hPGC-1 on (3846)UCP1-Luc activity. Differentiated PAZ6 cells were cotransfected with (3846)UCP1-Luc and increasing amounts of hPGC-1. C, characterization of the regulatory region involved in PGC-1-mediated activation of the UCP1 gene. Differentiated PAZ6 cells were cotransfected with hPGC-1 and U1-EN-Luc, mutC-, mutD-, or mutE-Luc, respectively. D, dose-response curve for the effect of increasing amounts of hPGC-1 on U1-EN-Luc activity.

To delineate the regulatory region of the human UCP1 gene essential for this effect, transfection studies were performed using a plasmid construct (3328UCP1-Luc) carrying a 5'-terminal deletion of a previously identified hormone-responsive enhancer element (11). PGC-1-mediated coactivation of the human UCP1 gene was completely abolished upon removal of a 460-bp region (Fig. 1A). According to Mar Gonzalez-Barroso et al. (11), this fragment harbors five potential hexamer-binding consensus sequences for nuclear hormone receptors including retinoic acid receptor (RAR), RXR, and PPAR/ (hexamers B-E) as well as a potential cAMP-response element-binding protein site (hexamer A). We cloned this complex element into a promoter vector (U1-EN-Luc) containing the luciferase gene under the control of the SV-40 promoter and performed cotransfection studies in differentiated PAZ6 cells. Cotransfection with hPGC-1 resulted in an up to 3-fold increase in luciferase activity in a dose-dependent manner (Fig. 1, C and D). Site-directed mutagenesis studies of the three hexamer sequences (shown in Fig. 2A) previously found to be essential for the retinoic acid- and PPAR-mediated up-regulation of the human UCP1 gene in a rodent cell line (11) were performed to characterize further the region responsible for PGC-1-mediated coactivation. Cotransfections with hPGC-1 showed that mutation of any of the three hexamer sequences resulted in a reduction of luciferase activity to basal levels (Fig. 1C). Binding of nuclear proteins to a 41-mer containing hexamers C-E was demonstrated in EMSA studies. Specificity of binding was shown by competition with a 30-fold molar excess of wild-type DNA. Three different double-stranded oligonucleotides carrying the mutations described competed much less effectively than the wild-type probe (Fig. 2B). These results are consistent with transfection studies showing that hexamers CE were required for PGC-1-mediated transcriptional coactivation.

View larger version (24K): [in this window] [in a new window]   Fig. 2.   Characterization of potential transcription factor binding sites in the UCP1 enhancer region. A, sequences of the 41WT probe and the mutated competitor fragments 41mutE, 41mutC, and 41mutD corresponding to nucleotides 3720 to 3680 in the human UCP1 promoter. Mutated nucleotides are in boldface. B, electrophoretic mobility shift assays were performed using a 32P-labeled 41WT probe and nuclear extract prepared from differentiated PAZ6 cells. Nuclear extracts were preincubated in the absence (control) or presence of a 30-fold molar excess of double-stranded unlabeled 41WT (41WT) and 30- or 100-fold molar excess of mutated competitor fragments (41mutC, 41mutD, and 41mutE). Neg refers to a control reaction without the addition of nuclear extract.

Drug Modulation of PGC-1-mediated Coactivation of the Human UCP1 Gene-- PGC-1 coactivates a number of nuclear hormone receptors, some of which are also implicated in the regulation of the UCP1 gene (8, 20). We studied the potential effects of retinoids as well as PPAR and PPAR agonists on PGC-1-mediated coactivation. RA and TZD both stimulated basal transcriptional activity of the U1-EN-Luc reporter construct in transiently transfected PAZ6 cells (Fig. 3A), whereas no increase in luciferase activity was observed with the synthetic PPAR ligand WY 14,643. No additive effect of RA and TZD was observed, and a combination of RA and WY 14,643 did not enhance luciferase activity in comparison to untreated control cells (Fig. 3A). Compared with RA treatment alone, reporter gene activity was significantly lower (p = 0.003, t test) after treatment with a combination of RA and WY 14,643. 

View larger version (10K): [in this window] [in a new window]   Fig. 3.   Effect of retinoic acid, PPAR agonist, and thiazolidinedione treatment on PGC-1-mediated transcriptional activation of the UCP1 gene. A, differentiated PAZ6 cells transfected with U1-EN-Luc or cotransfected with hPGC-1 were incubated with 9-cis-RA, WY 14,643, troglitazone, or combinations of drugs as indicated at concentrations of 10 µM each. Fold stimulation refers to basal U1-EN-Luc expression levels. B, differentiated PAZ6 cells cotransfected with U1-EN-Luc and hPGC-1 were stimulated with 9-cis-RA or all-trans-RA, 10 µM each.

Cotransfection experiments with the hPGC-1 expression vector enhanced RA-mediated transcriptional activation ~2.5-fold. This result was consistent with PGC-1 being a coactivator for RXR or RAR. Treatment of cotransfected cells with all-trans-retinoic acid or 9-cis-retinoic acid resulted in a similar increase in luciferase activity arguing for a role of RAR in the PGC-1-mediated regulation of the UCP1 gene (Fig. 3B). TZD treatment also stimulated UCP1 gene transcription in cotransfected PAZ6 cells, but no additive effect of RA and TZD was observed. Interestingly, a stimulatory effect of WY 14,643 was not observed in cells cotransfected with hPGC-1 (Fig. 3A). Combined treatment of cotransfected cells with WY 14,643 and RA was as effective as treatment with RA alone.

An Intact L2 Motif of PGC-1 Is Necessary for Coactivation of PPAR- but Not of RA- or PPAR-mediated Transcriptional Activity-- The L2 (LXXLL) motif has been shown to be essential for the interaction of PGC-1 with the ligand binding domain of several nuclear receptors including PPAR (24), GR (21), estrogen receptor (22), and thyroid hormone receptor (30). To determine whether the L2 motif in the human PGC-1 sequence is involved in transcriptional coactivation of the human UCP1 gene, the double leucine was substituted by a double alanine, a mutation known to disrupt leucine-rich interaction motifs (31). Cotransfections of U1-EN-Luc reporter plasmid with the mutated PGC-1 expression construct (L2mutPGC-1) showed that the absence of an intact L2 motif did not alter the response to RA, TZD, or a combination of both drugs, but reduced the luciferase activity to control levels in response to a combination of RA and WY 14,643. Because such a dependence on an intact L2 motif was not observed after treatment with RA alone, the changes in transcriptional activities observed upon combined treatment with RA and WY 14,643 must, at least in part, have been mediated by PPAR (Fig. 4).

View larger version (18K): [in this window] [in a new window]   Fig. 4.   Mutation of the PGC-1 L2 domain selectively impairs the response to PPAR agonists. A, constructs used in transfection experiments. hPGC-1, full-length human PGC-1 (amino acids 1-798); L2mutPGC-1, harboring two Leu to Ala mutations in the LXXLL motif (L2). Activation domain (AD), PPAR binding domain (PPAR), and LXXLL motifs (L2 and L3). B, differentiated PAZ6 cells were cotransfected with U1-EN-Luc together with either wild-type hPGC-1 or with L2mutPGC-1. Reporter gene activity was determined after stimulation of cells with 9-cis-RA, WY 14,643, troglitazone, or combinations of drugs, 10 µM each.

A Putative Repressor Is Involved in the PGC-1-mediated Coactivation of PPAR but Is of Little Importance for the PGC-1-mediated Transcriptional Response to TZD or Retinoids-- Previous studies (21) have demonstrated that a putative repressor negatively regulates the association between PGC-1 and GR. The L3 motif has been identified as a structural motif involved in repressor binding, whereas the association of PGC-1 with GR primarily depends on the L2 domain. The latter domain is also essential for the interaction between PGC-1 and PPAR. We therefore reasoned that a repressor mechanism could also regulate PPAR coactivation by PGC-1. We constructed a PGC-1 decoy molecule comprising amino acids 92-292 and harboring the disruptive substitution in the L2 motif, and we determined the ability of hPGC-1 to enhance the activity of the U1-EN-Luc reporter construct by RA, TZD, and WY 14,643 in the presence or absence of the decoy molecule. The decoy molecule had small effects on the transcriptional response to RA (3.01 ± 0.45 versus 4.10 ± 0.42-fold, p < 0.01), TZD (1.58 ± 0.26 versus 2.72 ± 0.92-fold, p < 0.1), or TZD and RA (3.11 ± 0.56 versus 5.04 ± 0.82-fold, p < 0.02). The transcriptional response to combined treatment with RA and WY 14,643, however, was dramatically increased by the decoy molecule (3.17 ± 0.53 versus 10.35 ± 1.87-fold, p < 0.005). These results lend strong support for a selective competition of the repressor with PPAR for binding to PGC-1 (Fig. 5).

View larger version (13K): [in this window] [in a new window]   Fig. 5.   Removal of a putative PGC-1 repressor specifically increases PPAR-mediated transcription of the UCP1 gene. A, constructs used in transfection experiments. hPGC-1, full-length human PGC-1 (amino acids 1-798); PGC-1-L2, decoy-construct encompassing amino acids 92-292. Activation domain (AD), PPAR binding domain (PPAR), and LXXLL motifs (L2 and L3). B, differentiated PAZ6 cells were cotransfected with U1-EN-Luc, hPGC-1, and PGC-1-L2mut, a construct harboring the mutation in the L2 motif together with deletions of the transcriptional activation domain and the PPAR interaction domain. Transfected cells were incubated with 9-cis-RA, WY 14,643, troglitazone, or combinations of drugs, 10 µM each.

Inhibition of p38 MAPK Decreases PGC-1-mediated Coactivation of PPAR-- p38 MAPK signaling has been shown to reduce the interaction of PGC-1 with the putative repressor thereby enhancing its coactivator function (26). The PPAR-mediated transcriptional activation of the muscle carnitine palmitoyltransferase I promoter was also enhanced by this signaling pathway (32) and was associated with phosphorylation of PPAR. We therefore studied the effect of the p38 MAPK-specific inhibitor SB 202190 on the PGC-1-mediated coactivation of the human UCP1 gene. Cotransfection studies of U1-EN-Luc with hPGC-1 showed that SB 202190 had no effect on the transcriptional response to RA (2.41 ± 0.30 versus 2.76 ± 0.52-fold, p < 0.6), TZD (1.97 ± 0.41 versus 1.92 ± 0.34-fold, p < 0.9), or RA and TZD (2.71 ± 0.45 versus 2.01 ± 0.62-fold, p < 0.3), whereas the stimulatory response to combined treatment with RA and WY 14,643 was completely abolished (2.65 ± 0.82 versus 0.64 ± 0.06-fold, p < 0.03) by the inhibitor (Fig. 6).

View larger version (10K): [in this window] [in a new window]   Fig. 6.   The p38 MAPK inhibitor SB 202190 selectively abolishes PPAR-mediated transcription of the UCP1 gene. PAZ6 cells cotransfected with U1-EN-Luc and hPGC-1 were stimulated with 9-cis-RA, WY 14,643, troglitazone, or combinations of drugs, 10 µM each, in the presence or absence of the p38 MAPK-specific inhibitor SB 202190 (20 µM).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PGC-1 transduces metabolic needs to the transcriptional regulation of genes involved in mitochondrial biogenesis, adaptive thermogenesis, and respiration (20, 33). Because of these important physiological functions, it is not surprising that the PGC-1 gene locus has recently been linked to human diseases such as type 2 diabetes and obesity (34, 35). PGC-1 has been shown to interact with numerous members of the nuclear hormone receptor family in a ligand-dependent or a ligand-independent manner (20-24, 30). Interestingly, a number of PGC-1 target genes, including GLUT4 and UCP1, are regulated by several transcription factors that all can associate with PGC-1 (36). This raises an intriguing question regarding the regulation of coactivator recruitment and activity.

In an effort to approach this problem, we used the BAT-specific UCP1 promoter and PAZ6 cells derived from human brown adipocytes that express both PPAR and PPAR. We mapped the UCP1 region required for PGC-1-mediated coactivation to a multipartite response element described previously (11). Although these authors were unable to observe coactivation of UCP1 by PGC-1 in a heterologous system, others (8, 9) identified a PPRE that served as a promiscuous site for PPAR- and PPAR-mediated transactivation in the rodent UCP1 upstream enhancer. The respective response element regions in the rodent and human genes exhibit 81% homology. Five hexamer motifs have been identified within the human UCP1 enhancer region that match consensus sequences for nuclear hormone receptor-binding sites (11). Our mutational analyses of the three most likely cis regulatory regions for PPAR and PPAR transactivation indicated that all three sequences were essential for PGC-1-mediated coactivation. Furthermore, functional studies demonstrated that PGC-1 was involved in the stimulatory effect of nuclear receptor ligands. RA evoked a stronger transcriptional response than TZD both in the presence and absence of PGC-1, whereas treatment with the PPAR ligand did not alter transcriptional activities compared with the respective controls. However, a striking stimulatory effect of the PPAR agonist WY 14,643 was observed in the presence of RA and after trapping the putative repressor with a decoy molecule (Fig. 5). That RA was required in addition to WY 14,643 may be related to a low intrinsic amount of RA in PAZ6 cells. Studies in a mouse BAT-derived cell line showing that RA was necessary for stimulation of the human UCP1 promoter by isoproterenol and/or TZD are consistent with our results (11).

Irrespective of the specific role of RA, we propose that PPAR subtype specificity is not only determined by the relative amounts of ligands, transcription factors, and coactivators but also depends on a repressor mechanism, which was originally postulated to control the interaction of PGC-1 with GR (25). The putative PGC-1 repressor specifically interfered with PPAR-mediated up-regulation of the UCP1 gene. Expression of a decoy construct providing excess binding surface for the repressor in trans significantly increased the response to PPAR agonist treatment, whereas little or no effect on PPAR agonist or retinoic acid stimulation was observed.

Despite the specificity of the putative repressor for PGC-1/PPAR interactions, RA-induced increases in reporter gene activity were abolished upon costimulation with RA and WY 14,643 of cells not transfected with PGC-1 (Fig. 3) or transfected with the L2-mutated PGC-1 construct (Fig. 4). In contrast, the RA induced reporter gene activity was not altered by the addition of WY 14,643 when cells were transfected with wild-type PGC-1. Thus, the amount of wild-type PGC-1 relative to the amount of repressor affected the transcriptional response to combined treatment with both ligands. Hence, binding of ligand-activated PPARRXR heterodimers to the multipartite response element might inhibit binding of, and transactivation by, other transcription factors if the stoichiometry favors trapping of PGC-1 by the repressor. As a result, PPARRXR heterodimers could become functional repressors for other transcriptional responses.

Signaling via the p38 MAPK pathway positively regulates the PGC-1-mediated coactivation of the GR by reducing the repressor/PGC-1 interaction (26). Upon inhibition of p38 MAPK, we observed a complete shutdown of the PGC-1-mediated transcriptional response to combined treatment with RA and WY 14,643, whereas responses to RA and TZD alone or in combination were not affected. These results are consistent with regulation of the repressor/PGC-1 interaction by p38 MAPK but inhibition of PPAR phosphorylation may also play a role (32). Stimulation of rodent UCP1 transcription by cAMP is protein kinase-dependent but can be abrogated by inhibition of p38 MAPK signaling (37). Whether the permissive role of p38 MAPK signaling in the context of UCP1 transactivation by cAMP-response element-binding protein is related to the control of PGC-1/repressor interactions is not known. Very recently, cytokines have been shown to activate PGC-1 through phosphorylation by p38 MAPK. As a result, respiration and the expression of genes involved in energy expenditure were increased in muscle cells (38). Phosphorylation by p38 MAPK enhanced the half-life of PGC-1, but only part of the responses observed could be attributed to an increased PGC-1 tissue level. Interestingly, the three amino acid residues phosphorylated by p38 MAPK are all located within or close to the PGC-1 surface implicated in the interaction with the putative repressor.

Retinoic acids play important roles in mammalian development (39, 40) and adipocyte differentiation (41) and have been shown to regulate expression of the human and rodent UCP1 gene (6, 7, 11, 42). PGC-1 enhances RXR-mediated transcription, and the L2 motif of PGC-1 is required for coactivation of RXR (23). Because PGC-1-dependent transcriptional responses were similar after stimulation with 9-cis- and all-trans-retinoic acids (Fig. 3), PGC-1 must have acted as transcriptional coactivator for the RAR. Moreover, comparable reporter gene activities were observed in response to 9-cis-retinoic acid treatment of cells transfected with wild-type or L2-mutated PGC-1 (Fig. 4). Thus, in contrast to RXR-dependent transactivation, RAR-mediated transactivation appears to be independent of the L2 domain.

In conclusion, our data, consistent with other studies, suggest a model whereby PPAR subtype-specific interactions with PGC-1 are regulated by a putative repressor. Furthermore, p38 MAPK signaling might control PPAR subtype specificity via modulation of the PGC-1/repressor interaction and/or perhaps direct stimulation of PPAR activity. Whether such a model is restricted to the regulation of the UCP1 gene in brown adipocytes or is also valid for other PPRE-containing genes expressed in other cell types with PPAR and PPAR activity remains to be determined. Clearly, the identification and characterization of the putative repressor will be essential for further studies.

	FOOTNOTES

^* This work was supported by Oesterreichische Nationalbank Project 9364, the Medizinische Forschungsgesellschaft Salzburg, and the Stiftung Propter Homines, Vaduz, Liechtenstein.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Laboratory Medicine, Landeskliniken Salzburg, A-5020 Salzburg, Austria. Tel.: 43-662-4482-3800; Fax: 43-662-4482-885; E-mail: w.patsch@lks.at.

Published, JBC Papers in Press, March 1, 2002, DOI 10.1074/jbc.M200475200

	ABBREVIATIONS

The abbreviations used are: UCP1, uncoupling protein-1; PPAR and PPAR, peroxisome proliferator-activated receptors  and ; BAT, brown adipose tissue; PPRE, PPAR-response element; PGC-1/PPARGC1, PPAR coactivator-1; GR, glucocorticoid receptor; RXR, retinoic X receptor; TZD, thiazolidinedione; EMSA, electrophoretic mobility shift assay; RAR, retinoic acid receptor; RA, 9-cis-retinoic acid; MAPK, mitogen-activated protein kinase.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Talukdar, S. Bhatnagar, S. Dridi, and F. B. Hillgartner Chenodeoxycholic acid suppresses the activation of acetyl-coenzyme A carboxylase-{alpha} gene transcription by the liver X receptor agonist T0-901317 J. Lipid Res., December 1, 2007; 48(12): 2647 - 2663. [Abstract] [Full Text] [PDF]

				L. Michalik, J. Auwerx, J. P. Berger, V. K. Chatterjee, C. K. Glass, F. J. Gonzalez, P. A. Grimaldi, T. Kadowaki, M. A. Lazar, S. O'Rahilly, et al. International Union of Pharmacology. LXI. Peroxisome Proliferator-Activated Receptors Pharmacol. Rev., December 1, 2006; 58(4): 726 - 741. [Abstract] [Full Text] [PDF]

				J. H. Chang, K. H. Lin, C. H. Shih, Y. J. Chang, H. C. Chi, and S. L. Chen Myogenic Basic Helix-Loop-Helix Proteins Regulate the Expression of Peroxisomal Proliferator Activated Receptor-{gamma} Coactivator-1{alpha} Endocrinology, June 1, 2006; 147(6): 3093 - 3106. [Abstract] [Full Text] [PDF]

				E. Burgermeister, A. Schnoebelen, A. Flament, J. Benz, M. Stihle, B. Gsell, A. Rufer, A. Ruf, B. Kuhn, H. P. Marki, et al. A Novel Partial Agonist of Peroxisome Proliferator-Activated Receptor-{gamma} (PPAR{gamma}) Recruits PPAR{gamma}-Coactivator-1{alpha}, Prevents Triglyceride Accumulation, and Potentiates Insulin Signaling in Vitro Mol. Endocrinol., April 1, 2006; 20(4): 809 - 830. [Abstract] [Full Text] [PDF]

				H. Oberkofler, K. Klein, T. K. Felder, F. Krempler, and W. Patsch Role of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Transcriptional Regulation of the Human Uncoupling Protein 2 Gene in INS-1E Cells Endocrinology, February 1, 2006; 147(2): 966 - 976. [Abstract] [Full Text] [PDF]

				J. C. Corton and H. M. Brown-Borg Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 in Caloric Restriction and Other Models of Longevity J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2005; 60(12): 1494 - 1509. [Abstract] [Full Text] [PDF]

				H. Oberkofler, B. Iglseder, K. Klein, J. Unger, M. Haltmayer, F. Krempler, B. Paulweber, and W. Patsch Associations of the UCP2 Gene Locus With Asymptomatic Carotid Atherosclerosis in Middle-Aged Women Arterioscler. Thromb. Vasc. Biol., March 1, 2005; 25(3): 604 - 610. [Abstract] [Full Text] [PDF]

				H. Oberkofler, V. Linnemayr, R. Weitgasser, K. Klein, M. Xie, B. Iglseder, F. Krempler, B. Paulweber, and W. Patsch Complex Haplotypes of the PGC-1{alpha} Gene Are Associated With Carbohydrate Metabolism and Type 2 Diabetes Diabetes, May 1, 2004; 53(5): 1385 - 1393. [Abstract] [Full Text] [PDF]