|
Originally published In Press as doi:10.1074/jbc.M200475200 on March 1, 2002
J. Biol. Chem., Vol. 277, Issue 19, 16750-16757, May 10, 2002
Peroxisome Proliferator-activated Receptor (PPAR) Coactivator-1 Recruitment Regulates PPAR Subtype Specificity*
Hannes
Oberkofler ,
Harald
Esterbauer ,
Veronika
Linnemayr ,
A. Donny
Strosberg§,
Franz
Krempler¶, and
Wolfgang
Patsch
From the Department of Laboratory Medicine,
Landeskliniken Salzburg, A-5020 Austria, the ¶ Department of
Internal Medicine, Krankenhaus Hallein, A-5400 Austria, and the
§ Institute Cochin de Genetique Moleculaire,
Paris, 75014 France
Received for publication, January 16, 2002
 |
ABSTRACT |
The peroxisome proliferator-activated receptors
(PPAR) and play key roles in the transcriptional control of
contrasting metabolic pathways such as adipogenesis and fatty acid
-oxidation. Both ligand-activated nuclear receptors bind to common
target gene response elements and interact with distinct domains of the transcriptional coactivator PGC-1 to attain their full transcriptional potency. Thus, PPAR subtype specificity may be determined by ligand availability and transcription factor or coactivator expression levels.
To identify other, perhaps more precise mechanisms contributing to PPAR
subtype specificity, we studied PGC-1 recruitment by PPARs using a
previously described hormone response element in the human UCP1 promoter and a human brown adipocyte cell line
as our model system. As in rodents, PGC-1 is involved in the
transcriptional regulation of the UCP1 gene in humans and
mediates the effects of PPAR and PPAR agonists and retinoic acid.
Interestingly, a previously postulated PGC-1 repressor selectively
affects the PPAR -mediated activation of UCP1 gene
expression. Furthermore, inhibition of p38 MAPK signaling, known to
regulate the PGC-1/repressor interaction, decreases the stimulatory
effect of PPAR agonist treatment without reducing the response to
thiazolidinedione or retinoic acid. These data support a model whereby
PPAR subtype specificity is regulated by recruitment of
PGC-1.
 |
INTRODUCTION |
Transcription of the uncoupling protein-1
(UCP1)1 gene is almost
exclusively restricted to brown adipose tissue (BAT) where its major
function in diet-induced and in non-shivering thermogenesis depends on
the capacity to uncouple oxidative phosphorylation from ATP generation
(1). Several physiological stimuli including cold exposure and
sympathetic signaling via norepinephrine and cAMP as well as thyroid
hormone regulate UCP1 gene expression in rodents (2-5). In
addition, retinoids (6, 7) and synthetic ligands for the peroxisome
proliferator-activated receptors PPAR (8) and PPAR (9, 10)
increase rodent UCP1 gene expression. A multipartite
response element with partial homology to rat and mouse UCP1
enhancers has been identified recently (11) in humans. Located within
this element is a putative binding site for cAMP-response element-binding protein mediating the effect of catecholamines on
UCP1 gene expression as well as a complex element containing consensus recognition sites for the retinoic acid receptors, PPAR and PPAR .
The PPARs are ligand-activated transcription factors and members of the
nuclear hormone receptor superfamily (12). PPAR is a master
regulator of adipocyte differentiation (13), as evidenced by induction
of adipose tissue markers in fibroblasts and myoblasts upon its ectopic
overexpression (14), and controls the expression of genes involved in
fatty acid synthesis and glucose metabolism (reviewed in Ref. 15).
PPAR is involved in fatty acid catabolism by regulating the
expression of genes encoding fatty acid oxidation enzymes (12, 16, 17).
As in some other tissues, PPAR and PPAR are both expressed in BAT
(18). Because each factor binds to the same consensus sequence in the
UCP1 promoter, mechanism(s) must exist that regulate PPAR
subtype specificity. The distinct transcriptional programs of PPAR
subtypes could be realized through differential activation by
endogenous and exogenous ligands. In addition, PPAR has also been
shown to be more sensitive to sequences in the 5'-flanking regions of
PPAR-response elements (PPREs), a finding that might help to explain
subtype specificity (19). Moreover, distinct physical and functional
interactions of PPARs with tissue-specific coactivators or corepressors
and subtype-specific recruitment mechanisms of such factors may
profoundly affect the transactivation properties of individual PPARs.
The PPAR coactivator-1 (PGC-1/PPARGC1) was originally described as a
cold-inducible coactivator, regulating adaptive thermogenesis by
increasing the transcriptional activation of the UCP1 gene by PPAR and the thyroid hormone receptor (20). PGC-1 interacts with
several other nuclear hormone receptors including the glucocorticoid receptor (GR) (21), mineralocorticoid receptor (21), estrogen receptor
(22), retinoic X receptor (RXR) (23), and PPAR (24). Studies by
Puigserver et al. (25) showed that PGC-1 contains a negative
regulatory domain that was mapped to amino acids 170-350. This region
overlaps with the domain involved in docking of several transcription
factors including GR, PPAR , and PPAR . Elegant studies led Knutti
et al. (26) to postulate that a repressor competes with GR
for binding to an overlapping domain of the PGC-1 molecule. This region
of PGC-1 contains two Leu-rich motifs termed L2 and L3, essential for
its interaction with PPAR , whereas the PPAR coactivation function
maps to a different surface (20). We therefore tested the hypothesis
that competition of a repressor with PPAR for binding to PGC-1
contributes to PPAR subtype specificity. We used a multipartite
response element of the UCP1 promoter to confirm that PGC-1
is a potent transcriptional coactivator of PPAR and PPAR .
However, the PPAR -mediated transcriptional response was negatively
regulated by a putative PGC-1 repressor and by inhibition of p38 MAPK
signaling, whereas the PPAR -mediated transcriptional response
remained unaltered. Thus, regulation of coactivator recruitment by
PPARs contributed to PPAR subtype specificity in the context of the
UCP1 promoter.
 |
EXPERIMENTAL PROCEDURES |
Materials--
DNA restriction and modification enzymes were
obtained from New England Biolabs (Beverly, MA) and Promega (Madison,
WI). Cell culture media, fetal calf serum, and LipofectAMINE 2000 were
obtained from Invitrogen. The synthetic PPAR ligand WY 14,643, 9-cis-retinoic acid (RA), all-trans-retinoic
acid, dexamethasone, insulin, and triiodothyronine were purchased from
Sigma. Troglitazone (TZD) was from Sankyo (Tokyo, Japan), and SB 202190 was purchased from Calbiochem. The QuikChange Site-directed Mutagenesis
kit was obtained from Stratagene (La Jolla, CA). The Dual Luciferase
Assay System was purchased from Promega.
Plasmid Constructs--
The ( 3846)UCP1-Luc plasmid in which
the region from 3846 to + 71 of the human UCP1 gene
drives the promoterless firefly luciferase gene was generated using 5'
CATACGCGTCAGCGATTTCTGATTGAACCACAGTT 3' ( 3846 to 3820)
and 5' CATCTCGAGAGTCCGATCCCCTCCTACCCAC 3' (+49 to +71)
as upper and lower primers to amplify a 3917-bp DNA fragment that was
cloned into the pGL3-Basic Vector (Promega). Numbers in parentheses
refer to primer positions relative to the transcriptional start site
(GenBankTM accession number U28479). MluI and
XhoI restriction enzymes sites introduced into the primer
sequences are in boldface. The HindIII restriction site at
nucleotide 3328 was used to generate the ( 3328)UCP1-Luc deletion
construct by subcloning a HindIII-XhoI fragment
into the pGL3-Basic Vector.
For construction of the U1-EN-Luc plasmid, a 249-bp fragment spanning
nucleotides 3846 to 3598 was amplified using the
upper primer described above and 5'-CATCTCGAGTCAGGTTGGAGAGAGCAGTAGG-3' ( 3820 to 3798) as lower primer. The resulting fragment was
ligated into the pGL3-Promoter Vector (Promega). Mutations described by Gonzales-Barroso et al. (11) were introduced into the
U1-EN-Luc plasmid to generate the mutC-, mutD-, and mutE-Luc reporter
constructs using the QuikChange Site-directed Mutagenesis kit
(Stratagene) and the primers shown in Table
I.
View this table:
[in this window]
[in a new window]
|
Table I
Sequences of oligonucleotides used to generate the mutC-, mutD-, and
mutE-Luc reporter constructs
Mutated nucleotides are in boldface type.
|
|
A mammalian expression vector containing the human cDNA for PGC-1
driven by the cytomegalovirus immediate-early promoter (hPGC-1) was
generated by reverse transcriptase-PCR amplification of the entire
PGC-1 coding region (27) (GenBankTM accession number
AF106698). A 2340-bp cDNA fragment was amplified from human
kidney total RNA using 5' TTCAGGAGCTGGATGGCGTGGGAC 3' and 5'
TTACCTGCGCAAGCTTCTCTGAGCTTC 3' as forward and reverse primers,
respectively, and ligated into the pcDNA6/V5-HisA vector (Invitrogen). The L2mutPGC-1 construct was derived from the original hPGC-1 expression construct by PCR-mediated site-directed
mutagenesis using 5' CTCTACTTAAGAAGGCCGCACTGGCACCAGCCAA
3' and 5' TTGGCTGGTGCCAGTGCGGCCTTCTTAAGTAGAG 3' as forward
and reverse primers, respectively. Mutated nucleotides are in bold. A
deletion construct encompassing amino acids 92-292 ( PGC-1-L2) was
derived from the L2mutPGC-1 construct using 5' ACTACTGCTAGCATGGTCCTCACAGAGACACTAGAC 3' and 5'
CAGGTACCAGTTAGGCCTGCAGTTCCAG 3' as forward and reverse
primers, respectively. The resulting cDNA fragment was cloned into
pcDNA6/V5-HisA. NheI and KpnI restriction enzymes sites introduced into the primer sequences are in bold. All
constructs described were verified by dye-terminator cycle sequencing
using the ABI PrismTM 310 Genetic Analyzer (Applied
Biosystems Inc., Foster City, CA).
Cell Culture and Transfection Studies--
PAZ6 cells were
cultured in preadipocyte medium consisting of Dulbecco's modified
Eagle's medium/F-12 supplemented with 10% fetal calf serum and 15 mM HEPES buffer. For differentiation, confluent PAZ6
preadipocytes were cultivated for 4 days in Dulbecco's modified
Eagle's medium/F-12 supplemented with 15 mM HEPES, 0.25 mM 3-isobutyl-1-methylxanthine, 0.1 µM
dexamethasone, 850 nM insulin, 1 nM
triiodothyronine, and 1 µM troglitazone (28). Cells were washed twice with Hanks' balanced salt solution and incubated for
3 h in preadipocyte medium without drugs before transfection. Drugs at concentrations of 10 µM for troglitazone,
9-cis-retinoic acid, all-trans-retinoic acid and
WY 14,643 and 20 µM for SB 202190 were added immediately
before transfection.
Differentiated PAZ6 cells cultured in 24-well dishes were transfected
using LipofectAMINE 2000 reagent. Unless otherwise indicated, we used 1 µg of reporter plasmids, 0.5 µg of expression plasmids, and 20 ng
of pRL-TK plasmid (Promega) as transfection control. In dose-response
experiments empty pGL3-Basic Vector was added to keep the amount of
transfected DNA constant. Transfected differentiated cells were
collected 24 h after transfection, and firefly and Renilla luciferase activities were measured in a luminometer
(Anthos Labtec Instruments, Salzburg, Austria) using the
Dual-luciferase Reporter Assay System (Promega). Graphs are
representative for one of two experiments, each performed in
quadruplicate. Results are given as means ± S.D.
Electrophoretic Mobility Shift Assays (EMSA)--
Nuclear
extracts from differentiated PAZ6 cells were prepared, and EMSAs were
performed as described recently (29). In brief, double-stranded 41-mers
containing wild-type and/or mutated hexamers C-E were prepared by
annealing of gel-purified sense and antisense oligonucleotides. An
EcoRI overhang was filled in using
[ -32P]dATP and Klenow enzyme. Nuclear extracts (2 µg) were mixed with binding buffer containing 1 µg of
double-stranded poly(dI-dC) and preincubated for 15 min at room
temperature. After the preincubation period 32P-labeled
wild-type 41-mer (~20,000 counts/min) was added, and the reaction
mixture was incubated on ice for 20 min. For competition experiments
increasing concentrations of unlabeled double-stranded oligonucleotides
were included during preincubation.
 |
RESULTS |
PGC-1 Coactivates the Human UCP1 Promoter via a Putative
PPRE/RARE (Retinoic Acid Response Element) in Differentiated
Human Brown Adipocytes--
To examine the role of the transcriptional
coactivator PGC-1 in the regulation of the human UCP1 gene,
we performed cotransfection studies in PAZ6 cells expressing a low
level of endogenous PGC-1 (data not shown). A plasmid construct
containing 3.9 kb of human UCP1 5'-flanking sequence fused
to a luciferase reporter gene ( 3846UCP1-Luc) was transiently
transfected into differentiated PAZ6 cells. Cotransfection with an
expression vector containing the entire coding region of human PGC-1
(hPGC-1) resulted in an up to 5-fold increase in the transcriptional
activity of the luciferase construct in a dose-dependent
manner (Fig. 1, A and
B).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
PGC-1 stimulates UCP1 gene
expression via a multipartite retinoic acid response
element/PPAR response element. A, differentiated PAZ6 cells
were transfected with ( 3846)UCP1-Luc or ( 3328)UCP1-Luc either
together with or without a human PGC-1 expression construct (hPGC-1).
UCP1-driven firefly luciferase activity levels were standardized to
pRL-TK driven Renilla luciferase levels used as transfection
control. Fold stimulation refers to ( 3846)UCP1-Luc basal expression
levels in the absence of hPGC-1. B, dose-response curve for
the effect of hPGC-1 on ( 3846)UCP1-Luc activity. Differentiated PAZ6
cells were cotransfected with ( 3846)UCP1-Luc and increasing amounts
of hPGC-1. C, characterization of the regulatory region
involved in PGC-1-mediated activation of the UCP1 gene.
Differentiated PAZ6 cells were cotransfected with hPGC-1 and U1-EN-Luc,
mutC-, mutD-, or mutE-Luc, respectively. D, dose-response
curve for the effect of increasing amounts of hPGC-1 on U1-EN-Luc
activity.
|
|
To delineate the regulatory region of the human UCP1 gene
essential for this effect, transfection studies were performed using a
plasmid construct ( 3328UCP1-Luc) carrying a 5'-terminal deletion of a
previously identified hormone-responsive enhancer element (11).
PGC-1-mediated coactivation of the human UCP1 gene was completely abolished upon removal of a 460-bp region (Fig.
1A). According to Mar Gonzalez-Barroso et al.
(11), this fragment harbors five potential hexamer-binding consensus
sequences for nuclear hormone receptors including retinoic acid
receptor (RAR), RXR, and PPAR / (hexamers B-E) as well as a
potential cAMP-response element-binding protein site (hexamer
A). We cloned this complex element into a promoter vector (U1-EN-Luc)
containing the luciferase gene under the control of the SV-40 promoter
and performed cotransfection studies in differentiated PAZ6 cells.
Cotransfection with hPGC-1 resulted in an up to 3-fold increase in
luciferase activity in a dose-dependent manner (Fig. 1,
C and D). Site-directed mutagenesis studies of
the three hexamer sequences (shown in Fig.
2A) previously found to be
essential for the retinoic acid- and PPAR -mediated up-regulation of
the human UCP1 gene in a rodent cell line (11) were
performed to characterize further the region responsible for
PGC-1-mediated coactivation. Cotransfections with hPGC-1 showed that
mutation of any of the three hexamer sequences resulted in a reduction
of luciferase activity to basal levels (Fig. 1C). Binding of
nuclear proteins to a 41-mer containing hexamers C-E was demonstrated
in EMSA studies. Specificity of binding was shown by competition with a
30-fold molar excess of wild-type DNA. Three different double-stranded
oligonucleotides carrying the mutations described competed much less
effectively than the wild-type probe (Fig. 2B). These
results are consistent with transfection studies showing that hexamers C E were required for PGC-1-mediated transcriptional coactivation.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2.
Characterization of potential transcription
factor binding sites in the UCP1 enhancer region. A,
sequences of the 41WT probe and the mutated competitor fragments
41mutE, 41mutC, and 41mutD corresponding to nucleotides 3720 to
3680 in the human UCP1 promoter. Mutated nucleotides are
in boldface. B, electrophoretic mobility shift
assays were performed using a 32P-labeled 41WT probe and
nuclear extract prepared from differentiated PAZ6 cells. Nuclear
extracts were preincubated in the absence (control) or presence of a
30-fold molar excess of double-stranded unlabeled 41WT
(41WT) and 30- or 100-fold molar excess of mutated
competitor fragments (41mutC, 41mutD, and
41mutE). Neg refers to a control reaction without
the addition of nuclear extract.
|
|
Drug Modulation of PGC-1-mediated Coactivation of the Human UCP1
Gene--
PGC-1 coactivates a number of nuclear hormone receptors,
some of which are also implicated in the regulation of the
UCP1 gene (8, 20). We studied the potential effects of
retinoids as well as PPAR and PPAR agonists on PGC-1-mediated
coactivation. RA and TZD both stimulated basal transcriptional activity
of the U1-EN-Luc reporter construct in transiently transfected PAZ6
cells (Fig. 3A), whereas no
increase in luciferase activity was observed with the synthetic PPAR
ligand WY 14,643. No additive effect of RA and TZD was observed, and a
combination of RA and WY 14,643 did not enhance luciferase activity in
comparison to untreated control cells (Fig. 3A). Compared
with RA treatment alone, reporter gene activity was significantly lower
(p = 0.003, t test) after treatment with a
combination of RA and WY 14,643.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of retinoic acid,
PPAR agonist, and thiazolidinedione treatment
on PGC-1-mediated transcriptional activation of the UCP1
gene. A, differentiated PAZ6 cells transfected
with U1-EN-Luc or cotransfected with hPGC-1 were incubated with
9-cis-RA, WY 14,643, troglitazone, or combinations of drugs
as indicated at concentrations of 10 µM each. Fold
stimulation refers to basal U1-EN-Luc expression levels. B,
differentiated PAZ6 cells cotransfected with U1-EN-Luc and hPGC-1 were
stimulated with 9-cis-RA or all-trans-RA, 10 µM each.
|
|
Cotransfection experiments with the hPGC-1 expression vector enhanced
RA-mediated transcriptional activation ~2.5-fold. This result was
consistent with PGC-1 being a coactivator for RXR or RAR. Treatment of
cotransfected cells with all-trans-retinoic acid or
9-cis-retinoic acid resulted in a similar increase in luciferase activity arguing for a role of RAR in the PGC-1-mediated regulation of the UCP1 gene (Fig. 3B). TZD
treatment also stimulated UCP1 gene transcription in
cotransfected PAZ6 cells, but no additive effect of RA and TZD was
observed. Interestingly, a stimulatory effect of WY 14,643 was not
observed in cells cotransfected with hPGC-1 (Fig. 3A).
Combined treatment of cotransfected cells with WY 14,643 and RA was as
effective as treatment with RA alone.
An Intact L2 Motif of PGC-1 Is Necessary for Coactivation of
PPAR - but Not of RA- or PPAR -mediated Transcriptional
Activity--
The L2 (LXXLL) motif has been shown to be
essential for the interaction of PGC-1 with the ligand binding domain
of several nuclear receptors including PPAR (24), GR (21), estrogen receptor (22), and thyroid hormone receptor (30). To determine whether
the L2 motif in the human PGC-1 sequence is involved in transcriptional
coactivation of the human UCP1 gene, the double leucine was
substituted by a double alanine, a mutation known to disrupt
leucine-rich interaction motifs (31). Cotransfections of U1-EN-Luc
reporter plasmid with the mutated PGC-1 expression construct
(L2mutPGC-1) showed that the absence of an intact L2 motif did not
alter the response to RA, TZD, or a combination of both drugs, but
reduced the luciferase activity to control levels in response to a
combination of RA and WY 14,643. Because such a dependence on an intact
L2 motif was not observed after treatment with RA alone, the changes in
transcriptional activities observed upon combined treatment with RA and
WY 14,643 must, at least in part, have been mediated by PPAR (Fig.
4).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
Mutation of the PGC-1 L2 domain selectively
impairs the response to PPAR agonists.
A, constructs used in transfection experiments. hPGC-1,
full-length human PGC-1 (amino acids 1-798); L2mutPGC-1, harboring two
Leu to Ala mutations in the LXXLL motif (L2). Activation
domain (AD), PPAR binding domain (PPAR ),
and LXXLL motifs (L2 and L3).
B, differentiated PAZ6 cells were cotransfected with
U1-EN-Luc together with either wild-type hPGC-1 or with L2mutPGC-1.
Reporter gene activity was determined after stimulation of cells with
9-cis-RA, WY 14,643, troglitazone, or combinations of drugs,
10 µM each.
|
|
A Putative Repressor Is Involved in the PGC-1-mediated Coactivation
of PPAR but Is of Little Importance for the PGC-1-mediated
Transcriptional Response to TZD or Retinoids--
Previous studies
(21) have demonstrated that a putative repressor negatively regulates
the association between PGC-1 and GR. The L3 motif has been identified
as a structural motif involved in repressor binding, whereas the
association of PGC-1 with GR primarily depends on the L2 domain. The
latter domain is also essential for the interaction between PGC-1 and
PPAR . We therefore reasoned that a repressor mechanism could also
regulate PPAR coactivation by PGC-1. We constructed a PGC-1 decoy
molecule comprising amino acids 92-292 and harboring the disruptive
substitution in the L2 motif, and we determined the ability of hPGC-1
to enhance the activity of the U1-EN-Luc reporter construct by RA, TZD,
and WY 14,643 in the presence or absence of the decoy molecule. The decoy molecule had small effects on the transcriptional response to RA
(3.01 ± 0.45 versus 4.10 ± 0.42-fold,
p < 0.01), TZD (1.58 ± 0.26 versus
2.72 ± 0.92-fold, p < 0.1), or TZD and RA
(3.11 ± 0.56 versus 5.04 ± 0.82-fold,
p < 0.02). The transcriptional response to combined
treatment with RA and WY 14,643, however, was dramatically increased by
the decoy molecule (3.17 ± 0.53 versus 10.35 ± 1.87-fold, p < 0.005). These results lend strong support for a selective competition of the repressor with PPAR for
binding to PGC-1 (Fig. 5).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5.
Removal of a putative PGC-1 repressor
specifically increases PPAR -mediated
transcription of the UCP1 gene. A,
constructs used in transfection experiments. hPGC-1, full-length human
PGC-1 (amino acids 1-798); PGC-1-L2, decoy-construct encompassing
amino acids 92-292. Activation domain (AD), PPAR binding
domain (PPAR ), and LXXLL motifs (L2
and L3). B, differentiated PAZ6 cells were
cotransfected with U1-EN-Luc, hPGC-1, and PGC-1-L2mut, a construct
harboring the mutation in the L2 motif together with deletions of the
transcriptional activation domain and the PPAR interaction domain.
Transfected cells were incubated with 9-cis-RA, WY 14,643, troglitazone, or combinations of drugs, 10 µM each.
|
|
Inhibition of p38 MAPK Decreases PGC-1-mediated Coactivation of
PPAR --
p38 MAPK signaling has been shown to reduce the
interaction of PGC-1 with the putative repressor thereby enhancing its
coactivator function (26). The PPAR -mediated transcriptional
activation of the muscle carnitine palmitoyltransferase I
promoter was also enhanced by this signaling pathway (32) and was
associated with phosphorylation of PPAR . We therefore studied the
effect of the p38 MAPK-specific inhibitor SB 202190 on the
PGC-1-mediated coactivation of the human UCP1 gene.
Cotransfection studies of U1-EN-Luc with hPGC-1 showed that SB 202190 had no effect on the transcriptional response to RA (2.41 ± 0.30 versus 2.76 ± 0.52-fold, p < 0.6), TZD (1.97 ± 0.41 versus 1.92 ± 0.34-fold,
p < 0.9), or RA and TZD (2.71 ± 0.45 versus 2.01 ± 0.62-fold, p < 0.3),
whereas the stimulatory response to combined treatment with RA and WY
14,643 was completely abolished (2.65 ± 0.82 versus
0.64 ± 0.06-fold, p < 0.03) by the inhibitor
(Fig. 6).

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 6.
The p38 MAPK inhibitor SB 202190 selectively
abolishes PPAR -mediated transcription of the
UCP1 gene. PAZ6 cells cotransfected with
U1-EN-Luc and hPGC-1 were stimulated with 9-cis-RA, WY
14,643, troglitazone, or combinations of drugs, 10 µM
each, in the presence or absence of the p38 MAPK-specific inhibitor SB
202190 (20 µM).
|
|
 |
DISCUSSION |
PGC-1 transduces metabolic needs to the transcriptional regulation
of genes involved in mitochondrial biogenesis, adaptive thermogenesis,
and respiration (20, 33). Because of these important physiological
functions, it is not surprising that the PGC-1 gene locus
has recently been linked to human diseases such as type 2 diabetes and
obesity (34, 35). PGC-1 has been shown to interact with numerous
members of the nuclear hormone receptor family in a
ligand-dependent or a ligand-independent manner (20-24, 30). Interestingly, a number of PGC-1 target genes, including GLUT4 and UCP1, are regulated by several
transcription factors that all can associate with PGC-1 (36). This
raises an intriguing question regarding the regulation of coactivator
recruitment and activity.
In an effort to approach this problem, we used the BAT-specific
UCP1 promoter and PAZ6 cells derived from human brown
adipocytes that express both PPAR and PPAR . We mapped the UCP1
region required for PGC-1-mediated coactivation to a multipartite
response element described previously (11). Although these authors were
unable to observe coactivation of UCP1 by PGC-1 in a heterologous
system, others (8, 9) identified a PPRE that served as a promiscuous site for PPAR - and PPAR -mediated transactivation in the rodent UCP1 upstream enhancer. The respective response element
regions in the rodent and human genes exhibit 81% homology. Five
hexamer motifs have been identified within the human UCP1
enhancer region that match consensus sequences for nuclear hormone
receptor-binding sites (11). Our mutational analyses of the three most
likely cis regulatory regions for PPAR and PPAR
transactivation indicated that all three sequences were essential for
PGC-1-mediated coactivation. Furthermore, functional studies
demonstrated that PGC-1 was involved in the stimulatory effect of
nuclear receptor ligands. RA evoked a stronger transcriptional response
than TZD both in the presence and absence of PGC-1, whereas treatment
with the PPAR ligand did not alter transcriptional activities
compared with the respective controls. However, a striking stimulatory
effect of the PPAR agonist WY 14,643 was observed in the presence of
RA and after trapping the putative repressor with a decoy molecule
(Fig. 5). That RA was required in addition to WY 14,643 may be related
to a low intrinsic amount of RA in PAZ6 cells. Studies in a mouse BAT-derived cell line showing that RA was necessary for stimulation of
the human UCP1 promoter by isoproterenol and/or TZD are
consistent with our results (11).
Irrespective of the specific role of RA, we propose that PPAR subtype
specificity is not only determined by the relative amounts of ligands,
transcription factors, and coactivators but also depends on a repressor
mechanism, which was originally postulated to control the interaction
of PGC-1 with GR (25). The putative PGC-1 repressor specifically
interfered with PPAR -mediated up-regulation of the UCP1
gene. Expression of a decoy construct providing excess binding surface
for the repressor in trans significantly increased the response to PPAR agonist treatment, whereas little or no effect on
PPAR agonist or retinoic acid stimulation was observed.
Despite the specificity of the putative repressor for PGC-1/PPAR
interactions, RA-induced increases in reporter gene activity were
abolished upon costimulation with RA and WY 14,643 of cells not
transfected with PGC-1 (Fig. 3) or transfected with the L2-mutated PGC-1 construct (Fig. 4). In contrast, the RA induced reporter gene
activity was not altered by the addition of WY 14,643 when cells were
transfected with wild-type PGC-1. Thus, the amount of wild-type PGC-1
relative to the amount of repressor affected the transcriptional
response to combined treatment with both ligands. Hence, binding of
ligand-activated PPAR RXR heterodimers to the multipartite response
element might inhibit binding of, and transactivation by, other
transcription factors if the stoichiometry favors trapping of PGC-1 by
the repressor. As a result, PPAR RXR heterodimers could become
functional repressors for other transcriptional responses.
Signaling via the p38 MAPK pathway positively regulates the
PGC-1-mediated coactivation of the GR by reducing the repressor/PGC-1 interaction (26). Upon inhibition of p38 MAPK, we observed a complete
shutdown of the PGC-1-mediated transcriptional response to combined
treatment with RA and WY 14,643, whereas responses to RA and TZD alone
or in combination were not affected. These results are consistent with
regulation of the repressor/PGC-1 interaction by p38 MAPK but
inhibition of PPAR phosphorylation may also play a role (32).
Stimulation of rodent UCP1 transcription by cAMP is protein
kinase-dependent but can be abrogated by inhibition of p38
MAPK signaling (37). Whether the permissive role of p38 MAPK signaling
in the context of UCP1 transactivation by
cAMP-response element-binding protein is related to the control
of PGC-1/repressor interactions is not known. Very recently, cytokines
have been shown to activate PGC-1 through phosphorylation by p38 MAPK.
As a result, respiration and the expression of genes involved in energy
expenditure were increased in muscle cells (38). Phosphorylation by p38
MAPK enhanced the half-life of PGC-1, but only part of the responses
observed could be attributed to an increased PGC-1 tissue level.
Interestingly, the three amino acid residues phosphorylated by p38 MAPK
are all located within or close to the PGC-1 surface implicated in the
interaction with the putative repressor.
Retinoic acids play important roles in mammalian development (39, 40)
and adipocyte differentiation (41) and have been shown to regulate
expression of the human and rodent UCP1 gene (6, 7, 11, 42).
PGC-1 enhances RXR-mediated transcription, and the L2 motif of PGC-1 is
required for coactivation of RXR (23). Because
PGC-1-dependent transcriptional responses were similar
after stimulation with 9-cis- and
all-trans-retinoic acids (Fig. 3), PGC-1 must have acted as
transcriptional coactivator for the RAR. Moreover, comparable reporter
gene activities were observed in response to 9-cis-retinoic
acid treatment of cells transfected with wild-type or L2-mutated PGC-1
(Fig. 4). Thus, in contrast to RXR-dependent
transactivation, RAR-mediated transactivation appears to be independent
of the L2 domain.
In conclusion, our data, consistent with other studies, suggest a model
whereby PPAR subtype-specific interactions with PGC-1 are regulated by
a putative repressor. Furthermore, p38 MAPK signaling might control
PPAR subtype specificity via modulation of the PGC-1/repressor
interaction and/or perhaps direct stimulation of PPAR activity.
Whether such a model is restricted to the regulation of the
UCP1 gene in brown adipocytes or is also valid for other PPRE-containing genes expressed in other cell types with PPAR and
PPAR activity remains to be determined. Clearly, the identification and characterization of the putative repressor will be essential for
further studies.
 |
FOOTNOTES |
*
This work was supported by Oesterreichische Nationalbank
Project 9364, the Medizinische Forschungsgesellschaft Salzburg, and the
Stiftung Propter Homines, Vaduz, Liechtenstein.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Laboratory Medicine, Landeskliniken Salzburg, A-5020 Salzburg, Austria. Tel.: 43-662-4482-3800; Fax: 43-662-4482-885; E-mail:
w.patsch@lks.at.
Published, JBC Papers in Press, March 1, 2002, DOI 10.1074/jbc.M200475200
 |
ABBREVIATIONS |
The abbreviations used are:
UCP1, uncoupling
protein-1;
PPAR and PPAR , peroxisome proliferator-activated
receptors and ;
BAT, brown adipose tissue;
PPRE, PPAR-response
element;
PGC-1/PPARGC1, PPAR coactivator-1;
GR, glucocorticoid
receptor;
RXR, retinoic X receptor;
TZD, thiazolidinedione;
EMSA, electrophoretic mobility shift assay;
RAR, retinoic acid receptor;
RA, 9-cis-retinoic acid;
MAPK, mitogen-activated protein
kinase.
 |
REFERENCES |
| 1.
|
Nicholls, D. G.,
and Locke, R. M.
(1984)
Physiol. Rev.
64,
1-64[Free Full Text]
|
| 2.
|
Kozak, U. C.,
Kopecky, J.,
Teisinger, J.,
Enerback, S.,
Boyer, B.,
and Kozak, L. P.
(1994)
Mol. Cell. Biol.
14,
59-67[Abstract/Free Full Text]
|
| 3.
|
Bouillaud, F.,
Ricquier, D.,
Mory, G.,
and Thibault, J.
(1984)
J. Biol. Chem.
259,
11583-11586[Abstract/Free Full Text]
|
| 4.
|
Rehnmark, S.,
Nechad, M.,
Herron, D.,
Cannon, B.,
and Nedergaard, J.
(1990)
J. Biol. Chem.
265,
16464-16471[Abstract/Free Full Text]
|
| 5.
|
Silva, J. E.
(1988)
Mol. Endocrinol.
2,
706-713[Abstract/Free Full Text]
|
| 6.
|
Cassard-Doulcier, A. M.,
Larose, M.,
Matamala, J. C.,
Champigny, O.,
Bouillaud, F.,
and Ricquier, D.
(1994)
J. Biol. Chem.
269,
24335-24342[Abstract/Free Full Text]
|
| 7.
|
Alvarez, R.,
de Andres, J.,
Yubero, P.,
Vinas, O.,
Mampel, T.,
Iglesias, R.,
Giralt, M.,
and Villarroya, F.
(1995)
J. Biol. Chem.
270,
5666-5673[Abstract/Free Full Text]
|
| 8.
|
Barbera, M. J.,
Schluter, A.,
Pedraza, N.,
Iglesias, R.,
Villarroya, F.,
and Giralt, M.
(2001)
J. Biol. Chem.
276,
1486-1493[Abstract/Free Full Text]
|
| 9.
|
Sears, I. B.,
MacGinnitie, M. A.,
Kovacs, L. G.,
and Graves, R. A.
(1996)
Mol. Cell. Biol.
16,
3410-3419[Abstract]
|
| 10.
|
Digby, J. E.,
Montague, C. T.,
Sewter, C. P.,
Sanders, L.,
Wilkison, W. O.,
O'Rahilly, S.,
and Prins, J. B.
(1998)
Diabetes
47,
138-141[Abstract]
|
| 11.
|
Mar Gonzalez-Barroso, M.,
Pecqueur, C.,
Gelly, C.,
Sanchis, D.,
Alves-Guerra, M. C.,
Bouillaud, F.,
Ricquier, D.,
and Cassard-Doulcier, A. M.
(2000)
J. Biol. Chem.
275,
31722-31732[Abstract/Free Full Text]
|
| 12.
|
Lemberger, T.,
Desvergne, B.,
and Wahli, W.
(1996)
Annu. Rev. Cell Dev. Biol.
12,
335-363[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Tontonoz, P., Hu, E.,
and Spiegelman, B. M.
(1994)
Cell
79,
1147-1156[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Hu, E.,
Tontonoz, P.,
and Spiegelman, B. M.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
9856-9860[Abstract/Free Full Text]
|
| 15.
|
Kliewer, S. A.,
and Willson, T. M.
(1998)
Curr. Opin. Genet. & Dev.
8,
576-581[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Gulick, T.,
Cresci, S.,
Caira, T.,
Moore, D. D.,
and Kelly, D. P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11012-11016[Abstract/Free Full Text]
|
| 17.
|
Brandt, J. M.,
Djouadi, F.,
and Kelly, D. P.
(1998)
J. Biol. Chem.
273,
23786-23792[Abstract/Free Full Text]
|
| 18.
|
Valmaseda, A.,
Carmona, M. C.,
Barbera, M. J.,
Vinas, O.,
Mampel, T.,
Iglesias, R.,
Villarroya, F.,
and Giralt, M.
(1999)
Mol. Cell. Endocrinol.
154,
101-109[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Juge-Aubry, C.,
Pernin, A.,
Favez, T.,
Burger, A. G.,
Wahli, W.,
Meier, C. A.,
and Desvergne, B.
(1997)
J. Biol. Chem.
272,
25252-25259[Abstract/Free Full Text]
|
| 20.
|
Puigserver, P., Wu, Z.,
Park, C. W.,
Graves, R.,
Wright, M.,
and Spiegelman, B. M.
(1998)
Cell
92,
829-839[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Knutti, D.,
Kaul, A.,
and Kralli, A.
(2000)
Mol. Cell. Biol.
20,
2411-2422[Abstract/Free Full Text]
|
| 22.
|
Tcherepanova, I.,
Puigserver, P.,
Norris, J. D.,
Spiegelman, B. M.,
and McDonnell, D. P.
(2000)
J. Biol. Chem.
275,
16302-16308[Abstract/Free Full Text]
|
| 23.
|
Delerive, P., Wu, Y.,
Burris, T. P.,
Chin, W. W.,
and Suen, C. S.
(2002)
J. Biol. Chem.
277,
3913-3917[Abstract/Free Full Text]
|
| 24.
|
Vega, R. B.,
Huss, J. M.,
and Kelly, D. P.
(2000)
Mol. Cell. Biol.
20,
1868-1876[Abstract/Free Full Text]
|
| 25.
|
Puigserver, P.,
Adelmant, G., Wu, Z.,
Fan, M., Xu, J.,
O'Malley, B.,
and Spiegelman, B. M.
(1999)
Science
286,
1368-1371[Abstract/Free Full Text]
|
| 26.
|
Knutti, D.,
Kressler, D.,
and Kralli, A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
9713-9718[Abstract/Free Full Text]
|
| 27.
|
Esterbauer, H.,
Oberkofler, H.,
Krempler, F.,
and Patsch, W.
(1999)
Genomics
62,
98-102[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Zilberfarb, V.,
Pietri-Rouxel, F.,
Jockers, R.,
Krief, S.,
Delouis, C.,
Issad, T.,
and Strosberg, A. D.
(1997)
J. Cell Sci.
110,
801-807[Abstract]
|
| 29.
|
Esterbauer, H.,
Schneitler, C.,
Oberkofler, H.,
Ebenbichler, C.,
Paulweber, B.,
Sandhofer, F.,
Ladurner, G.,
Hell, E.,
Strosberg, A. D.,
Patsch, J. R.,
Krempler, F.,
and Patsch, W.
(2001)
Nat. Genet.
28,
178-183[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Wu, Y.,
Delerive, P.,
Chin, W. W.,
and Burris, T. P.
(2002)
J. Biol. Chem.
277,
8898-8905[Abstract/Free Full Text]
|
| 31.
|
Heery, D. M.,
Kalkhoven, E.,
Hoare, S.,
and Parker, M. G.
(1997)
Nature
387,
733-736[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Barger, P. M.,
Browning, A. C.,
Garner, A. N.,
and Kelly, D. P.
(2001)
J. Biol. Chem.
276,
44495-44501[Abstract/Free Full Text]
|
| 33.
|
Wu, Z.,
Puigserver, P.,
Andersson, U.,
Zhang, C.,
Adelmant, G.,
Mootha, V.,
Troy, A.,
Cinti, S.,
Lowell, B.,
Scarpulla, R. C.,
and Spiegelman, B. M.
(1999)
Cell
98,
115-124[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Ek, J.,
Andersen, G.,
Urhammer, S. A.,
Gaede, P. H.,
Drivsholm, T.,
Borch-Johnsen, K.,
Hansen, T.,
and Pedersen, O.
(2002)
Diabetologia
44,
2220-2226
|
| 35.
|
Esterbauer, H.,
Oberkofler, H.,
Linnemayer, V.,
Iglseder, B.,
Hedegger, M.,
Wolfsgruber, P.,
Paulweber, B.,
Fastner, G.,
Krempler, F.,
and Patsch, W.
(2002)
Diabetes
51,
1281-1286[Abstract/Free Full Text]
|
| 36.
|
Michael, L. F., Wu, Z.,
Cheatham, R. B.,
Puigserver, P.,
Adelmant, G.,
Lehman, J. J.,
Kelly, D. P.,
and Spiegelman, B. M.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
3820-3825[Abstract/Free Full Text]
|
| 37.
|
Cao, W.,
Medvedev, A. V.,
Daniel, K. W.,
and Collins, S.
(2001)
J. Biol. Chem.
276,
27077-27082[Abstract/Free Full Text]
|
| 38.
|
Puigserver, P.,
Rhee, J.,
Lin, J., Wu, Z.,
Yoon, J. C.,
Zhang, C. Y.,
Krauss, S.,
Mootha, V. K.,
Lowell, B. B.,
and Spiegelman, B. M.
(2001)
Mol. Cell
8,
971-982[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Mangelsdorf, D. J.,
Thummel, C.,
Beato, M.,
Herrlich, P.,
Schutz, G.,
Umesono, K.,
Blumberg, B.,
Kastner, P.,
Mark, M.,
Chambon, P.,
and Evans, R. M.
(1995)
Cell
83,
835-839[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Mark, M.,
Ghyselinck, N. B.,
Wendling, O.,
Dupe, V.,
Mascrez, B.,
Kastner, P.,
and Chambon, P.
(1999)
Proc. Nutr. Soc.
58,
609-613[Medline]
[Order article via Infotrieve]
|
| 41.
|
Safonova, I.,
Darimont, C.,
Amri, E. Z.,
Grimaldi, P.,
Ailhaud, G.,
Reichert, U.,
and Shroot, B.
(1994)
Mol. Cell. Endocrinol.
104,
201-211[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Larose, M.,
Cassard-Doulcier, A. M.,
Fleury, C.,
Serra, F.,
Champigny, O.,
Bouillaud, F.,
and Ricquier, D.
(1996)
J. Biol. Chem.
271,
31533-31542[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Haramizu, A. Nagasawa, N. Ota, T. Hase, I. Tokimitsu, and T. Murase
Different contribution of muscle and liver lipid metabolism to endurance capacity and obesity susceptibility of mice
J Appl Physiol,
March 1, 2009;
106(3):
871 - 879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Talukdar, S. Bhatnagar, S. Dridi, and F. B. Hillgartner
Chenodeoxycholic acid suppresses the activation of acetyl-coenzyme A carboxylase-{alpha} gene transcription by the liver X receptor agonist T0-901317
J. Lipid Res.,
December 1, 2007;
48(12):
2647 - 2663.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Michalik, J. Auwerx, J. P. Berger, V. K. Chatterjee, C. K. Glass, F. J. Gonzalez, P. A. Grimaldi, T. Kadowaki, M. A. Lazar, S. O'Rahilly, et al.
International Union of Pharmacology. LXI. Peroxisome Proliferator-Activated Receptors
Pharmacol. Rev.,
December 1, 2006;
58(4):
726 - 741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Chang, K. H. Lin, C. H. Shih, Y. J. Chang, H. C. Chi, and S. L. Chen
Myogenic Basic Helix-Loop-Helix Proteins Regulate the Expression of Peroxisomal Proliferator Activated Receptor-{gamma} Coactivator-1{alpha}
Endocrinology,
June 1, 2006;
147(6):
3093 - 3106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Burgermeister, A. Schnoebelen, A. Flament, J. Benz, M. Stihle, B. Gsell, A. Rufer, A. Ruf, B. Kuhn, H. P. Marki, et al.
A Novel Partial Agonist of Peroxisome Proliferator-Activated Receptor-{gamma} (PPAR{gamma}) Recruits PPAR{gamma}-Coactivator-1{alpha}, Prevents Triglyceride Accumulation, and Potentiates Insulin Signaling in Vitro
Mol. Endocrinol.,
April 1, 2006;
20(4):
809 - 830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Oberkofler, K. Klein, T. K. Felder, F. Krempler, and W. Patsch
Role of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} in the Transcriptional Regulation of the Human Uncoupling Protein 2 Gene in INS-1E Cells
Endocrinology,
February 1, 2006;
147(2):
966 - 976.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Corton and H. M. Brown-Borg
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 in Caloric Restriction and Other Models of Longevity
J. Gerontol. A Biol. Sci. Med. Sci.,
December 1, 2005;
60(12):
1494 - 1509.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Oberkofler, B. Iglseder, K. Klein, J. Unger, M. Haltmayer, F. Krempler, B. Paulweber, and W. Patsch
Associations of the UCP2 Gene Locus With Asymptomatic Carotid Atherosclerosis in Middle-Aged Women
Arterioscler. Thromb. Vasc. Biol.,
March 1, 2005;
25(3):
604 - 610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Oberkofler, V. Linnemayr, R. Weitgasser, K. Klein, M. Xie, B. Iglseder, F. Krempler, B. Paulweber, and W. Patsch
Complex Haplotypes of the PGC-1{alpha} Gene Are Associated With Carbohydrate Metabolism and Type 2 Diabetes
Diabetes,
May 1, 2004;
53(5):
1385 - 1393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Tiraby, G. Tavernier, C. Lefort, D. Larrouy, F. Bouillaud, D. Ricquier, and D. Langin
Acquirement of Brown Fat Cell Features by Human White Adipocytes
J. Biol. Chem.,
August 29, 2003;
278(35):
33370 - 33376.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. A. Coulter, C. M. Bearden, X. Liu, R. A. Koza, and L. P. Kozak
Dietary fat interacts with QTLs controlling induction of Pgc-1{alpha} and Ucp1 during conversion of white to brown fat
Physiol Genomics,
July 7, 2003;
14(2):
139 - 147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Moore, E. A. Park, and J. B. McMillin
Upstream Stimulatory Factor Represses the Induction of Carnitine Palmitoyltransferase-Ibeta Expression by PGC-1
J. Biol. Chem.,
May 2, 2003;
278(19):
17263 - 17268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Oberkofler, B. Holzl, H. Esterbauer, M. Xie, B. Iglseder, F. Krempler, B. Paulweber, and W. Patsch
Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1 Gene Locus: Associations with Hypertension in Middle-Aged Men
Hypertension,
February 1, 2003;
41(2):
368 - 372.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Teruel, R. Hernandez, M. Benito, and M. Lorenzo
Rosiglitazone and Retinoic Acid Induce Uncoupling Protein-1 (UCP-1) in a p38 Mitogen-activated Protein Kinase-dependent Manner in Fetal Primary Brown Adipocytes
J. Biol. Chem.,
January 3, 2003;
278(1):
263 - 269.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ichida, S. Nemoto, and T. Finkel
Identification of a Specific Molecular Repressor of the Peroxisome Proliferator-activated Receptor gamma Coactivator-1 alpha (PGC-1alpha )
J. Biol. Chem.,
December 20, 2002;
277(52):
50991 - 50995.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|