JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M110920200 on February 22, 2002

J. Biol. Chem., Vol. 277, Issue 19, 17209-17216, May 10, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/19/17209    most recent
M110920200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Geha, R. M.
Right arrow Articles by Shih, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Geha, R. M.
Right arrow Articles by Shih, J. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Analysis of Conserved Active Site Residues in Monoamine Oxidase A and B and Their Three-dimensional Molecular Modeling*

Rani Maurice GehaDagger , Kevin ChenDagger , Johan Wouters§, Frédéric Ooms§, and Jean Chen ShihDagger ||

From the Dagger  Department of Molecular Pharmacology and Toxicology, School of Pharmacy, University of Southern California, Los Angeles, California 90089-9121, the  Department of Cell and Neurobiology, School of Medicine, University of Southern California, Los Angeles, California 90089, and § Facultés Universitaires Notre-Dame de la Paix, 61 Rue de Bruxelles, B-5000 Namur, Belgium

Received for publication, November 14, 2001, and in revised form, January 30, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Monoamine oxidase (MAO) is a key enzyme responsible for the degradation of serotonin, norepinephrine, dopamine, and phenylethylamine. It is an outer membrane mitochondrial enzyme existing in two isoforms, A and B. We have recently generated 14 site-directed mutants of human MAO A and B, and we found that four key amino acids, Lys-305, Trp-397, Tyr-407, and Tyr-444, in MAO A and their corresponding amino acids in MAO B, Lys-296, Trp-388, Tyr-398, and Tyr-435, play important roles in MAO catalytic activity. Based on the polyamine oxidase three-dimensional crystal structure, it is suggested that Lys-305, Trp-397, and Tyr-407 in MAO A and Lys-296, Trp-388, and Tyr-398 in MAO B may be involved in the non-covalent binding to FAD. Tyr-407 and Tyr-444 in MAO A (Tyr-398 and Tyr-435 in MAO B) may form an aromatic sandwich that stabilizes the substrate binding. Asp-132 in MAO A (Asp-123 in MAO B) located at the entrance of the U-shaped substrate-binding site has no effect on MAO A nor MAO B catalytic activity. The similar impact of analogous mutants in MAO A and MAO B suggests that these amino acids have the same function in both isoenzymes. Three-dimensional modeling of MAO A and B using polyamine oxidase as template suggests that the overall tertiary structure and the active sites of MAO A and B may be similar.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Monoamine oxidase (MAO,1 EC 1.4.3.4; amine:oxygen oxidoreductase (deaminating, flavin-containing)) is a flavoprotein located at the outer membranes of mitochondria in neuronal, glial, and other cells. It catalyzes the oxidative deamination of monoamine neurotransmitters such as serotonin, norepinephrine, and dopamine and appears to play important roles in several psychiatric and neurological disorders (for review see Refs. 1 and 2). In addition, it is also responsible for the biotransformation of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine into 1-methyl-4-phenylpyridinium, a Parkinsonian producing neurotoxin (3-5). Recently, it has been shown that MAO may contribute to the apoptotic process because inhibition of MAO activity suppressed cell death (6).

MAO exists in two forms, namely MAO A and MAO B. MAO A preferentially oxidizes serotonin (5-hydroxytryptamine) and is irreversibly inhibited by low concentrations of clorgyline (7). MAO B preferentially oxidizes phenylethylamine (PEA) and benzylamine, and it is irreversibly inactivated by low concentrations of pargyline and deprenyl (8). Dopamine, tyramine, and tryptamine are common substrates for both MAOs. MAO A and B consist of 527 and 520 amino acids, respectively, and have a 70% identity (9). Each isoenzyme has a FAD covalently linked to a cysteine residue, Cys-406 in MAO A and Cys-397 in MAO B, through an 8alpha -(cysteinyl)-riboflavin (10-13). They exhibit identical exon-intron organization, and they are probably derived from the duplication of a common ancestral gene (14). Much effort have been made to study the FAD-binding site (15, 16), active site, and the regions that are important for the substrate and inhibitor specificities (17-23). Recently, we have found that switching Ile-335 and Tyr-326 in human MAO A and B, respectively, is able to switch the substrate and inhibitor selectivity in MAO A and B (24). Despite these efforts, there is still a paucity of information on secondary and tertiary structures of this enzyme. Determination of the three-dimensional structure and the architecture of the active site of MAO2 would facilitate design of new potent and selective MAO inhibitors. MAO A inhibitors have been used as antidepressants. MAO B inhibitors have been used for Parkinson's disease. Knowledge of the tertiary structure of MAO A and B will be of great value for the rational design of new effective drugs. Furthermore, there is a large body of biochemical and other data that await interpretation when the three-dimensional structures of MAO A and MAO B are available.

Recently, the x-ray crystal structure of a related enzyme namely polyamine oxidase (PAO) has been obtained (25). PAO catalyzes the oxidation of the secondary amino group of polyamines, such as spermine and spermidine. Polyamines are DNA-binding molecules that play an important role in cell growth and development (26, 27). The role of PAO in polyamine catabolism made it an important drug target because some polyamine analogs have been shown to have an antitumor effect on some cell lines (28). PAO is a monomeric and soluble 500-amino acid protein with a molecular mass of about 53 kDa and contains a non-covalently bound FAD as a cofactor. It has been classified along with MAO as part of a flavoprotein superfamily having a common 50-amino acid FAD-binding signature motif near the N terminus (29). PAO shares a 20% amino acid identity with MAO and catalyzes the same chemical reaction: an oxidation half-reaction of an amine to an imine coupled to the reduction of O2 to H2O2. These properties suggest that MAO and PAO have similar FAD- and substrate-binding sites.

We have used the PAO structure as a guide to study the FAD-binding amino acids and the substrate-binding site of MAO. We have aligned amino acids involved with FAD-binding and the active site of PAO with MAO A and B from several species to identify conserved amino acids. Only conserved amino acids that, according to the PAO structure, mediate their function through their side chain and not their main chain atoms have been mutated.

This criteria allowed us to identify two amino acids, a lysine and a tryptophan (Lys-305 and Trp-397 in MAO A and Lys-296 and Trp-388 in MAO B), which may play an important role in the noncovalent FAD attachment to MAO. These residues have been mutated to alanine and were named MAO A-K305A, MAO A-W397A, MAO B-K296A, and MAO B-W388A, respectively. We have also predicted the existence of a critical feature of the substrate-binding site of MAO based on PAO structure. It is an aromatic sandwich that consists of the side chains of two parallel tyrosine residues facing the substrate-binding pocket on opposite sides. We have mutated these tyrosines to both phenylalanine and to serine in MAO A and B in order to ascertain the validity of this aromatic sandwich structure. A mutation to phenylalanine is to the removal of the hydroxyl group from tyrosine, whereas a mutation to serine represents the removal of the aromatic portion.

An amino acid associated with the active site of PAO but whose function is not well defined, Glu-120, is conserved in all MAOs. We have mutated this amino acid to alanine in MAO A and B. The mutants were expressed, and their activities and sensitivities toward inhibitors were determined.

We have also performed molecular modeling studies of MAO A and B using PAO as a template. This model is supported by the site-directed mutagenesis data and suggests that the overall three-dimensional structure and active sites of MAO A and B may be similar.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction of the Baculovirus Transfer Vector-- Full-length human MAO A and B cDNAs were subcloned into the EcoRI site of pVL1392-transfer vector and named pVL1392-hMAOA and pVL1392-hMAOB, respectively. The clone was verified for proper insertion by restriction digest analysis. Recombinant MAO A and B encoding virus was produced by homologous recombination and cotransfection of Sf21 insect cells with the transfer vector and the linearized baculovirus DNA via the calcium phosphate method. Recombinant baculovirus was isolated by plaque purification and amplified by infection of insect cells with a multiplicity of infection = 1. After 4 passes a viral stock with a titer of 108 plaque-forming units/ml was produced.

Construction of MAO A and B Point Mutants-- The point mutants in MAO A (D132A, K305A, W397A, Y407F, Y407S, Y444F, and Y444S) and MAO B (D123A, K296A, W388A, Y398F, Y398S, Y435F, and Y435S) were made on pVL1392-hMAOA and pVL1392-hMAOB. The QuikChangeTM site-directed mutagenesis kit was used. The protocol of the kit was followed except that an annealing temperature of 52 °C was used. The following complementary 5'-primers for 14 point mutations of MAO A and MAO B were used as follows: 1) MAO A-D132A, GGAGGACAATAGCTAACATGGGGAAGG and CCTTCCCCATGTTAGCTATTGTCCTCC; 2) MAO A-K305A, GGGAGCTGTCATTGCGTGCATGATG and CATCATGCACGCAATGACAGCTCCC; 3) MAO A-W397A, GAAGAGAAGAACGCGTGTGAGGAGCAG and CTGCTCCTCACACGCGTTCTTCTCTTC; 4) MAO A-Y407F, CTGGGGGCTGCTTCACGGCCTACTTC and GAAGTAGGCCGTGAAGCAGCCCCCAG; 5) MAO A-Y407S, CTGGGGGCTGCTCCACGGCCTACTTC and GAAGTAGGCCGTGGAGCAGCCCCCAG; 6) MAO A-Y444F, GTGGAGCGGCTTCATGGAAGGGGC and GCCCCTTCCATGAAGCCGCTCCAC; 7) MAO A-Y444S, GTGGAGCGGCTCCATGGAAGGGGC and GCCCCTTCCATGGAGCCGCTCCAC; 8) MAO B-D123A, GGAGGACAATGGAGGACATGGGGCG and CGCCCCATGTCCTCCATTGTCCTCC; 9) MAO B-K296A, GGGTTCAGTCATCGCGTGTATAGTTTATTATAAAG and CTTTATAATAAACTATACACGCGATGACTGAACCC; 10) MAOB-W388A, TATGAAGAAAAGAACGCGTGTGAGGAGCAGTAC and GTACTGCTCCTCACACGCGTTCTTTTCTTCATA; 11) MAO B-Y398F, CTCTGGGGGCTGCTTCACAACTTATTTCCCCCC and GGGGGGAAATAAGTTGTGAAGCAGCCCCCAGAG; 12) MAO B-Y398S, CTCTGGGGGCTGCTCCACAACTTATTTCCCCCC and GGGGGGAAATAAGTTGTGGAGCAGCCCCCAGAG; 13) MAO B-Y435F, GCCACACACTGGAGCGGCTTCATGGAGGGGGCTG and CAGCCCCCTCCATGAAGCCGCTCCAGTGTGTGGC; 14) MAO B-Y435S, GCCACACACTGGAGCGGCTCCATGGAGGGGGCTG and CAGCCCCCTCCATGGAGCCGCTCCAGTGTGTGGC. The mutagenic bases are underlined. The introduction of the mutation was confirmed by dideoxy sequencing analysis of the region of interest.

Expression in Sf21 Insect Cells-- Small scale expression of various mutants of MAO A and MAO B was carried out in adherent culture of Sf21 cells. 150-mm cell culture dishes were seeded with 20 × 106 Sf21 cells, and recombinant virus was added at a multiplicity of infection of 2. The cells were incubated at 27 °C for 72-80 h and then harvested by centrifugation for 10 min at 5,000 × g.

Determination of the Kinetic Constants-- The kinetic constants for the oxidation of 5-HT and PEA and the inhibition by clorgyline and deprenyl were determined by the radiochemical method as described previously (30) using O2-saturated 50 mM sodium phosphate buffer. For the Km determination, [14C]5-HT and [14C]PEA concentrations ranged from 0.1 to 5 times the Km values that were determined via Eadie-Hofstee plot (v versus v/[S]). The kcat values were calculated from the Vmax values obtained by fitting the [S] versus activity curve to the Michaelis-Menten equation and the calculated concentration of the enzyme from the quantitation assay. The IC50 values for the irreversible inhibitors clorgyline and deprenyl were determined by preincubating the inhibitor with the homogenate for 30 min at 37 °C and assaying for the remaining activity as described above.

Modeling of MAO A and MAO B-- Sequences were retrieved from the Swiss Protein Database. Coordinates of the crystal structure of PAO are available at the Protein Database (code 1b5q). Sequence alignments were performed with Matchbox (31). Comparative modeling of both forms of MAOs was performed using the Homology module (Molecular Simulation Inc., San Diego). Energy minimization (steepest descent and conjugated gradient algorithms; gradient on energies less than 1 kcal/mol used as convergence criteria) was done using the consistent valence force field and the Discover program (Molecular Simulation Inc., San Diego). A distance-dependent dielectric constant (1·r) was used to simulate solvent effects. Geometry was checked with Procheck (32). All calculations were carried out on an Octane SGI Work station running under Irix 6.2.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MAO A Mutants-- We have assayed the seven MAO A mutants and the wild type for activity using the MAO A substrate serotonin (5-HT) (Table I). MAO A-K305A and MAO A-W397A did not show detectable activity even when the amount of protein in the assay was increased to 100 times that of MAO A wild type. These results suggest that Lys-305 and Trp-397 in MAO A play a critical role in enzyme activity.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Activities of MAO A active site mutants
The activity and affinity of MAO A wild type and its mutants towards 5-HT is shown. Data are from at least three experiments ± S.E.

MAO A-Y407S exhibited no activity, whereas MAO A-Y407F had ~50% of wild type activity. The Km value of MAO A-Y407F was slightly increased. Similarly, mutant MAO A-Y444S did not show any catalytic activity, whereas the mutant MAO A-Y407F had low activity. These results indicate that the two tyrosines at positions 407 and 444 can be replaced by phenylalanine to retain some activity but not by serine. This implies an important role for the aromatic ring of tyrosine.

MAO A-D132A had an activity similar to that of the wild type, and the Km value was slightly increased. This suggests that Asp-132 is not important for the catalytic activity of MAO A.

We have also determined the inhibitor sensitivities of all the active mutants toward the MAO A-specific inhibitor clorgyline and the MAO B-specific inhibitor deprenyl (Table II). For clorgyline, MAO A-D132A and MAO A-Y407F had the same sensitivity as the wild type, and MAO A-Y444F showed about a 10-fold decrease in sensitivity. For deprenyl, MAO A-D132A showed a slight decrease in sensitivity, and MAO A-Y407F and MAO A-Y444F showed about a 10-fold decrease. Therefore MAO A-Y444F shows a decreased sensitivity for both inhibitors, whereas MAO A-D132A and MAO A-Y407F show a decreased sensitivity toward deprenyl only. This suggests that these amino acids are not essential but do affect the enzyme activity.

                              
View this table:
[in this window]
[in a new window]
 
Table II
Inhibition constants of MAO A and B active site mutants
Clorgyline and deprenyl IC50 values for MAO A and B wild type and for the active mutants are shown. Data are from at least three experiments ± S.E.

MAO B Mutants-- The seven corresponding mutants were also made on MAO B, and the activity toward the MAO B substrate PEA was assayed (Table III). Interestingly, the results were similar to the MAO A mutants. MAO B-K296A and MAO B-W388A resulted in a complete loss of activity. MAO B-Y398S was also inactive, but MAO B-Y398F retained activity with a slight increase in Km value. Similarly, MAO B-Y435S was inactive, and MAO B-Y435F retained activity with an increase in Km.

                              
View this table:
[in this window]
[in a new window]
 
Table III
Activities of MAO B active site mutants
The activity and affinity of MAO B wild type and mutants toward PEA are shown. Data are from at least three experiments ± S.E.

As for its MAO A counterpart, MAO B-D123A had an activity similar to that of the wild type which suggests that Asp-123 is not important for the catalytic activity of MAO B.

All three active mutants, MAO B-D123A, MAO B-Y398F, and MAO B-Y435F, showed a decrease in sensitivity toward clorgyline and deprenyl. MAO B-Y435F showed an especially marked decrease in sensitivity of about 100-fold toward deprenyl. This suggests that these mutants affect the active site.

Our results show that Lys-305, Trp-397, Tyr-407, and Tyr-444 in MAO A and their corresponding amino acids in MAO B, Lys-296, Trp-388, Tyr-398, and Tyr-435, play an important role in MAO catalytic activity. Based on the polyamine oxidase three-dimensional structure, it is suggested that Lys-305 and Trp-397 in MAO A and their corresponding amino acids in MAO B, Lys-296 and Trp-388, may be involved in the non-covalent binding to FAD. Tyr-407 and Tyr-444 in MAO A (Tyr-398 and Tyr-435 in MAO B) form an aromatic sandwich within the substrate-binding site. Asp-132 in MAO A (Asp-123 in MAO B) located at the entrance of the U-shaped substrate-binding site of PAO has no effect on MAO A and MAO B catalytic activity when mutated to alanine. The high similarity observed between the MAO A and MAO B mutants suggests that these amino acids have the same function in both isoenzymes and that the substrate-binding site of MAO A and B may be similar.

Modeling of MAO A and MAO B-- The sequence identity between PAO and the two forms of MAO is about 20%, thus no automatic homology procedure can be applied. In order to construct three-dimensional models for both MAO A and MAO B, we adopted a modeling procedure that was used with success in the past to model other proteins sharing low homology with template structures (33, 34). This procedure involves careful multiple sequence alignments, secondary structure predictions, assignment of coordinates of the template (PAO) to the target (MAO A and B), modeling of loops, energy minimization, and theoretical evaluation of the geometry.

Sequence alignment is a key step in any homology modeling procedure. It becomes essential when working with proteins sharing low sequence identity. Therefore, extensive multiple sequence alignments have been performed on MAOs and other flavoproteins. They led to an alignment between the MAO A, MAO B, and PAO sequences (Fig. 1). This alignment, similar to the one presented in the literature (25), was retained as input for comparative modeling of MAO A and MAO B. 


View larger version (93K):
[in this window]
[in a new window]
  		Fig. 1.   Alignment between the sequences of PAO and human MAO A and MAO B. The conserved amino acids are shaded. The four key amino acids are marked with *. Predicted secondary structures for MAO A and B are presented (H, helix; E, beta -strand). The amino acid residue numbers are shown at the end of each line.

The C-terminal part of the MAO sequences is predicted as a hydrophobic helix that could be associated to the membrane. This prediction is consistent with experimental data of the literature (35-39). Therefore, no three-dimensional model has been assigned to the last 30 amino acids of the MAO sequences. Secondary structure assignment has also been proposed for both MAO A and B, using a consensus between several algorithms (40), and were taken as a guide in the modeling process. Predicted secondary structure elements on MAO are in good agreement with the observed structure of PAO (Fig. 1).

After coordinates of structurally conserved regions of PAO were assigned to the sequences of MAO A and B, loop regions have been modeled (homology program).

Prior to energy minimization of the resulting models, a covalent bond was imposed between the flavin cofactor (methyl carbon C8alpha ) and the sulfur atom of Cys-406 in MAO A or Cys-397 in MAO B, in accordance with evidence from the literature (10-13). This could easily be done as this cysteine residue (corresponding to Thr-402 in PAO) is very close to the isoalloxazine ring of the flavin. Models for the MAO A Y407F, Y407S, Y444F, and Y444S and MAO B Y398F, Y398S, Y435F, and Y435S mutants were also built and energy-minimized.

The geometry of the final models complies with statistical criteria. In particular, about 95% of the residues in the MAO A and MAO B models are in allowed regions (77 and 18% of phi /psi angles lie, respectively, in the most favored or additional allowed regions) of the Ramachandran plot, and all bond lengths and valence angles correspond to expected values. Final models are available upon request to the authors.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

PAO shares a 20% amino acid identity with MAO, and we have compared amino acids that are conserved between PAO and all the cloned MAOs as follows: human, rat, mouse, and bovine MAO A; human, rat, and mouse MAO B; and trout MAO. According to the PAO structure, there are 15 amino acids associated with FAD binding (Table IV) and 16 other amino acids associated with the substrate-binding pocket (Table V).

                              
View this table:
[in this window]
[in a new window]
 
Table IV
Common FAD binding amino acids in MAO and PAO
The function of the 15 amino acids in PAO associated with FAD binding and their corresponding ones in MAO A and B across various MAO types is shown. Trout MAO (T), human (h-A), rat (r-A), mouse (m-A), and bovine (b-A) MAO A, human (h-B), rat (r-B), and mouse (m-B) MAO B. Identical amino acids are represented by an equal sign. Amino acids selected for mutagenesis are highlighted.

                              
View this table:
[in this window]
[in a new window]
 
Table V
Common substrate binding amino acids in MAO and PAO
The function of the 16 amino acids associated with the substrate binding pocket in PAO and their corresponding ones in MAO A and B across various MAO types is shown. Trout MAO (T), human (h-A), rat (r-A), mouse (m-A), and bovine (b-A) MAO A, human (h-B), rat (r-B), and mouse (m-B) MAO B. Identical amino acids are represented by an equal sign. Amino acids selected for mutagenesis are highlighted.

FAD Binding in MAO A and MAO B-- Of the 15 amino acids associated with FAD in PAO (Fig. 2), 6 (Asn-59, Trp-60, Tyr-399, Thr-402, Glu-430, and Val-440) are non-conserved with MAOs, and 5 (Ser-15, Glu-35, Ala-36, Arg-43, and Gly-57 in PAO) are conserved with MAOs but are within the general FAD signature motif of flavoproteins near the N terminus. Val-237 and Tyr-439 of PAO are conserved with all MAOs but exert their function via their main chain atoms (25) (Fig. 2). Thus, there are only two amino acids in PAO that are conserved among all MAOs and bind to FAD through their side chains. In PAO, Lys-300 makes an indirect bond with N-5 of the isoalloxazine moiety of FAD via a water molecule and Trp-393 binds the dimethylbenzene portion of FAD (Fig. 2).


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2.   The FAD-binding site in PAO. Lys-300 and Trp-393 (marked by arrows) are conserved residues among all MAOs and bind to FAD through their side chains in MAO. The interaction of Lys-300 with the N-5 of FAD in PAO was studied in MAOs by making the mutants of the corresponding amino acid (MAO A-K305A and MAO B-K296A). The interaction of Trp-393 with dimethylbenzene moiety in PAO was studied in MAOs by making mutants of the corresponding amino acid (MAO A-W397A and MAO B-W388A). (Adapted from Binda et al. (25).)

Mutating the corresponding amino acid of Lys-300 in PAO to alanine in MAO A and B to produce A-K305A and B-K296A, respectively, results in the complete inactivation of the enzymes. Therefore, this conserved lysine is necessary for enzyme activity and may therefore have the same interaction with the FAD of MAO A and B as it does in PAO. Mutating the equivalents of Trp-393 in PAO to alanine in MAO A and B also produces inactive enzymes. Trp-393 in PAO has extensive Van der Waals interactions with the dimethylbenzene portion of FAD, and its equivalent in MAO A and B may have the same function.

Taken together, these results suggest that Lys-305 and Trp-397 in MAO A and their corresponding residues in MAO B, Lys-296 and Trp-388, are essential for the activity of the enzyme. They may play an important role in the non-covalent binding or in the incorporation of FAD that is disrupted when they are mutated to alanine. FAD attachment to MAO has been shown to be disrupted when the amino acids for covalent attachment, Cys-406 in MAO A and Cys-397 in MAO B, are mutated to serine (12). It has also been shown that FAD does not get incorporated when noncovalently binding amino acids are mutated (23, 41). This implies that FAD incorporation to MAO requires both covalent and non-covalent interactions with the enzyme.

Substrate Binding in MAO A and B-- Of the 16 amino acids associated with the PAO substrate-binding pocket, only 5 (Glu-120, Phe-171, Phe-403, Gly-438, and Tyr-439) are conserved with MAO A and B from different species (Fig. 3).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 3.   The substrate-binding site of PAO. The three amino acids conserved with MAO within the U-shaped substrate-binding site of PAO are marked by arrows. Glu-120 sits at the entrance of the binding site, and the corresponding amino acids in MAOs are Asp. This aspartic acid was mutated to alanine in MAO A and B (MAO A-D132A, MAO B-D123A). The aromatic sandwich of Phe-403 and Tyr-439 was studied by making mutants of the corresponding amino acid in MAOs: MAO A-Y407F/S, MAO A-Y444F/S, MAO B-Y398F/S, and MAO B-Y435F/S. (Adapted from Binda et al. (25).) The shaded area is the inhibitor of PAO, MDL72527.

Glu-120 is located at the entrance of the substrate-binding site of PAO, which is a U-shaped tunnel but does not appear to have an interaction with either the FAD or the substrate (Fig. 3). The corresponding amino acids are Asp-132 in MAO A and Asp-123 in MAO B. Mutating them to alanine had a negligible effect on enzyme activity indicating that this residue is not essential for enzyme function.

Phe-403 and Tyr-439 are the only two amino acids in the substrate-binding site of PAO that are conserved with MAO. In PAO they form an "aromatic sandwich" that consists of these two residues flanking the opposite sides of the substrate-binding site in a parallel fashion. Furthermore, the hydroxyl group of Tyr-439 interacts directly with the inhibitor (Fig. 3). When their corresponding residues in MAO A, Tyr-407 and Tyr-444, and MAO B, Tyr-398 and Tyr-435, are mutated to serine, the enzyme loses all activity; however, when they are mutated to phenylalanine the enzyme remains active. This indicates that indeed it is the aromatic portion and not the hydroxyl portion that is essential for activity and suggests a similar aromatic sandwich structure in MAO.

Interestingly, A-Y444F and B-Y435F have very low activity compared with the wild type, whereas the A-Y407F and B-Y398F mutants had similar activity to the wild type. This indicates that the hydroxyl groups of Tyr-444 and Tyr-435 are more important than those of Tyr-407 and Tyr-398 for substrate binding. This is in agreement with the structure of the substrate-binding site of PAO in which the hydroxyl group of Tyr-439, the PAO equivalent of Tyr-444 and Tyr-435 in MAO A and B, interacts directly with the bound inhibitor (25).

The mutants A-D132A and B-D123A resulted in only a slight decrease in substrate affinity. Therefore, Asp-132 and Asp-123 in MAO A and B are not important for enzyme activity.

Taken together, these results show that with the exception of two mutants (A-D132A and B-D123A), amino acids conserved between PAO and MAO and whose function is mediated by the amino acid side chain result in inactive MAOs when mutated to non-conserved residues. This suggests that MAO and PAO have the same overall structure and at least one common feature within the substrate-binding site. It is also noteworthy that all the mutations produced a very similar effect in MAO A and MAO B. This suggests that FAD binding and the substrate-binding site between the two MAO isoenzymes are highly similar.

Molecular Modeling-- The structure of the recently crystallized PAO was used as a template to build a three-dimensional structure of both types of MAO (Fig. 4). The modeling procedure includes multiple sequence alignment, secondary structure prediction, energy minimization, and final geometry evaluation.


View larger version (48K):
[in this window]
[in a new window]
  		Fig. 4.   Three-dimensional model of human MAO A and MAO B. Secondary structures are presented using arrows for beta -strands and cylinders for helices. The positions of the FAD cofactor and amino acids depicted are also given using the MAO A numbering. The three-dimensional structure of human MAO B is similar to the structure of MAO A. The three domains of MAO described in the test are presented by different colors on the model: FAD non-covalent binding domain in green, substrate binding domain in blue, and interface domain in red.

The three-dimensional structure of MAO A and B consists of three domains as follows: 1) a FAD (non-covalent) binding domain, 2) a substrate-binding domain, and 3) a helical (interface) domain. The main structural elements of the FAD (non-covalent) binding domain (Fig. 4) are a central parallel beta -sheet flanked by a beta -meander and three alpha -helices. This arrangement orresponds to the classical folding topology observed in several dinucleotide-binding enzymes. The sequence and structure similarity between MAO and PAO is particularly evident in this domain. The validity of the MAO modeling is supported by the site-directed mutagenesis studies (Lys-305, Tyr-397, Tyr-407, Tyr-444, and Asp-132 in MAO A, see Fig. 4). It is also supported by our previous studies (12) in which we have shown that Cys-406 is covalently attached to FAD; and Ile-335 (24) and Phe 208 (22) are important for the substrate and inhibitor specificities in human and rat MAO, respectively.

In spite of the low sequence similarity, the topology of MAO, modeled from PAO, also closely resembles that of L-amino acid oxidase (42) with further similarities to D-amino acid oxidase (43) and p-hydroxybenzoate hydroxylase (44). Within this family of flavoproteins, most structural differences appear in the helical (interface) domain (42).

The FAD cofactor, non-covalently bound in PAO, is placed in such a way that it can easily form a covalent link to Cys-406 of MAO A and Cys-397 of MAO B (Fig. 5).


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 5.   Schematic drawing of FAD-binding site in the model of MAO A. The isoalloxazine ring of the FAD cofactor is covalently bound to Cys-406. Lys-305 is close to the N-5 atom of the FAD. Trp-397 and Tyr-407 stabilize the cofactor by stacking and van der Waals interactions. The corresponding amino acids in MAO B are found at the same positions: Cys-397, Lys-296, Trp-388 and Tyr-398. The influence of all those residues was studied by mutants MAO A-K305A and MAO B-K296A, MAO A-W397A and MAO B-W388A, and MAO A-Y407F/S and MAO B-Y398F/S. Other amino acids are based on the corresponding amino acids in the FAD-binding site of PAO.

Models for the MAO A Y407F, Y407S, Y444F, and Y444S and MAO B Y398F, Y398S, Y435F, and Y435S mutants were also built, and the interaction energies between the FAD cofactor and the enzymes have been computed (Table VI). Although these results must be considered with caution, they underline the important destabilizing effect introduced by substituting a Tyr residue by a Ser. Keeping an aromatic residue in position 407 or 444 in MAO A (398 or 435 in MAO B) by replacing the Tyr residue by a Phe only slightly affects the binding of the cofactor. Docking experiments are now planned in order to transpose those results to substrate and inhibitor complexes.

                              
View this table:
[in this window]
[in a new window]
 
Table VI
Simulated interaction energies between the FAD cofactor and MAO A and B wild type and mutants


    ACKNOWLEDGEMENT

We thank Eric Depiereux for assisting in molecular modeling of MAOs.

    FOOTNOTES

* This work was supported by NIMH Grants R01 MH37020 and R37 MH39085 from the National Institutes of Health and the Boyd and Elsie Welin Professorship.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

|| To whom correspondence should be addressed: 1985 Zonal Ave., Los Angeles, CA 90089-9121. Tel.: 323-442-1441; Fax: 323-224-7473; E-mail: jcshih@hsc.usc.edu.

Published, JBC Papers in Press, February 22, 2002, DOI 10.1074/jbc.M110920200

2 While this manuscript was under review, the structure of MAO B was reported (45), and the active site Tyr-444 of MAO A was identified (46).

    ABBREVIATIONS

The abbreviations used are: MAO, monoamine oxidase; PAO, polyamine oxidase; 5-HT, serotonin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Shih, J. C., Chen, K., and Ridd, M. J. (1999) Annu. Rev. Neurosci. 22, 197-217[CrossRef][Medline] [Order article via Infotrieve]
2. Shih, J. C., and Thompson, R. F. (1999) Am. J. Hum. Genet. 65, 593-598[CrossRef][Medline] [Order article via Infotrieve]
3. Chiba, K., Trevor, A., and Castagnoli, N. (1984) Biochem. Biophys. Res. Commun. 120, 574-578[CrossRef][Medline] [Order article via Infotrieve]
4. Fritz, R. R., Abell, C. W., Patel, N. T., Gessner, W., and Brossi, A. (1985) FEBS Lett. 186, 224-228[CrossRef][Medline] [Order article via Infotrieve]
5. Grimsby, J., Toth, M., Chen, K., Kumazawa, T., Klaidman, L., Adams, J. D., Karoum, F., Gal, J., and Shih, J. C. (1997) Nat. Genet. 17, 1-5[CrossRef][Medline] [Order article via Infotrieve]
6. De Zutter, G. S., and Davis, R. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 6168-6173[Abstract/Free Full Text]
7. Johnson, J. P. (1968) Biochem. Pharmacol. 17, 1285-1297[CrossRef][Medline] [Order article via Infotrieve]
8. Knoll, J., and Magyar, K. (1972) Adv. Biochem. Psychopharmacol. 5, 393-408[Medline] [Order article via Infotrieve]
9. Back, A. W., Lan, N. C., Johnson, D. L., Abell, C. W., Bembenek, M. E., Kwan, S. W., Seeburg, Ph. D., and Shih, J. C. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 4934-4938[Abstract/Free Full Text]
10. Kearney, E. B., Salach, J. I., Walker, W. H., Seng, R. L., Kenny, W., Zeszotek, E., and Singer, T. P. (1971) Eur. J. Biochem. 24, 321-327[Medline] [Order article via Infotrieve]
11. Yu, P. H. (1981) Can. J. Biochem. 59, 30-37[Medline] [Order article via Infotrieve]
12. Wu, H. F., Chen, K., and Shih, J. C. (1993) Mol. Pharmacol. 43, 888-893[Abstract]
13. Wouters, J. (1998) Curr. Med. Chem. 5, 137-162[Medline] [Order article via Infotrieve]
14. Grimsby, J., Chen, K., Wang, L.-J., Lan, N. C., and Shih, J. C. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3637-3641[Abstract/Free Full Text]
15. Nandigama, R. K., and Edmondson, D. E. (2000) J. Biol. Chem. 275 (7), 20527-20532[Abstract/Free Full Text]
16. Miller, J. R., and Edmonson, D. E. (1999) J. Biol. Chem. 274 (13), 23515-23525[Abstract/Free Full Text]
17. Cesura, A. M., Gottowik, J., Lahm, H. W., Lnag, G., Imhof, R., Malberbe, R., Röthlisberger, U., and Da Prada, M. (1996) Eur. J. Biochem. 236, 996-1002[Medline] [Order article via Infotrieve]
18. Chen, K., Wu, H.-F., and Shih, J. C. (1996) J. Neurochem. 66, 797-803[Medline] [Order article via Infotrieve]
19. Gottowik, J., Cesura, A. M., Malherbe, P., Lang, G., and Da Prada, M. (1993) FEBS Lett. 317, 152-156[CrossRef][Medline] [Order article via Infotrieve]
20. Gottowik, J., Malherbe, P., Jang, G., Da, Prada, M., and Cesura, A. M. (1995) Eur. J. Biochem. 230, 934-942[Medline] [Order article via Infotrieve]
21. Tsugeno, Y., Hirashiki, I., Ogata, F., and Ito, A. (1995) J. Biochem. (Tokyo) 118, 974-980[Abstract/Free Full Text]
22. Geha, R. M., Chen, K., and Shih, J. C. (2000) J. Neurochem. 75, 1304-1309[CrossRef][Medline] [Order article via Infotrieve]
23. Zhou, B. P., Wu, B., Kwan, S. W., and Abell, C. W. (1998) J. Biol. Chem. 273, 14862-14868[Abstract/Free Full Text]
24. Geha, R. M., Rebrin, I., Chen, K., and Shih, J. C. (2001) J. Biol. Chem. 276, 9877-9882[Abstract/Free Full Text]
25. Binda, C., Coda, A., Angelini, R., Federico, R., Ascenzi, P., and Mattevi, A. (1999) Struct. Fold Design 7, 265-276
26. Tabor, C. W., and Tabor, H. (1984) Annu. Rev. Biochem. 53, 749-790[CrossRef][Medline] [Order article via Infotrieve]
27. Tiburcio, A. F., Altabella, T., Borrell, A., and Masgrau, C. (1997) Physiol. Plant. 100, 664-674
28. Pegg, A. E., and Hu, R. H. (1995) Cancer Lett. 95, 247-252[CrossRef][Medline] [Order article via Infotrieve]
29. Dailey, T. A., and Dailey, H. A. (1998) J. Biol. Chem. 273, 13658-13662[Abstract/Free Full Text]
30. Wurtman, R. J., and Axelrod, J. (1964) Biochem. Pharmacol. 12, 1439-1441
31. Depiereux, E., Baudoux, G., Briffeuil, P., Reginster, I., De, Bolle, X., Vinals, C., and Feytmans, E. (1997) Comput. Appl. Biosci. 13, 249-256[Abstract/Free Full Text]
32. Laskowski, R. A., MacArthur, M., Moss, D. S., and Thornton, J. M. (1993) J. Appl. Crystallogr. 26, 283-291[CrossRef]
33. de Fays, K., Tibor, A., Lambert, C., Vinals, C., Denoël, P., De, Bolle, X., Wouters, J., Letesson, J. J., and Depiereux, E. (1998) Protein Eng. 12, 217-223
34. Roh, J. H., Wouters, J., Depiereux, E., Yakawa, H., Inui, M., Minami, H., Suzuki, H., and Kumagai, H. (2000) Biochem. Biophys. Res. Commun. 268, 293-297[CrossRef][Medline] [Order article via Infotrieve]
35. Mitoma, J.-Y., and Ito, A. (1992) J. Biochem. (Tokyo) 111, 20-24[Abstract/Free Full Text]
36. Chen, K., Wu, H.-F., Grimsby, J., and Shih, J. C. (1994) Mol. Pharmacol. 268, 1226-1233
37. Weyler, W. (1992) J. Neural Transm. 41 (suppl.), 3-15[Medline] [Order article via Infotrieve]
38. Wouters, J., Ramsay, R., Goormaghtigh, E., Ruysschaert, J., Brasseur, R., and Durant, F. (1995) Biochem. Biophys. Res. Commun. 208, 773-778[CrossRef][Medline] [Order article via Infotrieve]
39. Rebrin, I., Geha, R. M., Chen, K., and Shih, J. C. (2001) J. Biol. Chem. 276, 29499-29506[Abstract/Free Full Text]
40. Wouters, J., and Baudoux, G. (1998) Proteins Struct. Funct. Genet. 32, 97-110[CrossRef][Medline] [Order article via Infotrieve]
41. Kirskey, T. J., Kwan, S.-W., and Abell, C. W. (1998) Biochemistry 37, 12360-12366[CrossRef][Medline] [Order article via Infotrieve]
42. Pawelek, P. D., Cheah, J., Coulombe, R., Macheroux, P., Ghisla, S., and Vrielink, A. (2000) EMBO J. 19, 4204-4215[CrossRef][Medline] [Order article via Infotrieve]
43. Mattevi, A., Vanoni, M. A., Todone, F., Rizzi, M., Teplyakov, A., Coda, A., Bolognesi, M., and Curti, B. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7496-7501[Abstract/Free Full Text]
44. Schreuder, H. A., Van der Laan, J. M., Hol, W. G., and Drenth, J. (1988) J. Mol. Biol. 199, 637-648[CrossRef][Medline] [Order article via Infotrieve]
45. Binda, C., Newton-Vinson, P., Hubalek, F., Edmondson, D. E., and Mattevi, A. (2002) Nat. Struct. Biol 9, 22-26[CrossRef][Medline] [Order article via Infotrieve]
46. Nandigama, R. K., Miller, J. R., and Edmondson, D. E. (2001) Biochemistry 40, 14839-14846[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
M. Gordon, D. G. Holt, A. Panigrahi, B. T. Wilhelm, H. Erdjument-Bromage, P. Tempst, J. Bahler, and B. R. Cairns
Genome-Wide Dynamics of SAPHIRE, an Essential Complex for Gene Activation and Chromatin Boundaries
Mol. Cell. Biol., June 1, 2007; 27(11): 4058 - 4069.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. E. J. Rigby, R. M. G. Hynson, R. R. Ramsay, A. W. Munro, and N. S. Scrutton
A Stable Tyrosyl Radical in Monoamine Oxidase A
J. Biol. Chem., February 11, 2005; 280(6): 4627 - 4631.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Chen, D. P. Holschneider, W. Wu, I. Rebrin, and J. C. Shih
A Spontaneous Point Mutation Produces Monoamine Oxidase A/B Knock-out Mice with Greatly Elevated Monoamines and Anxiety-like Behavior
J. Biol. Chem., September 17, 2004; 279(38): 39645 - 39652.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
W. K. Wong, K. Chen, and J. C. Shih
Decreased Methylation and Transcription Repressor Sp3 Up-regulated Human Monoamine Oxidase (MAO) B Expression during Caco-2 Differentiation
J. Biol. Chem., September 19, 2003; 278(38): 36227 - 36235.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Binda, M. Li, F. Hubalek, N. Restelli, D. E. Edmondson, and A. Mattevi
Insights into the mode of inhibition of human mitochondrial monoamine oxidase B from high-resolution crystal structures
PNAS, August 19, 2003; 100(17): 9750 - 9755.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Cervelli, F. Polticelli, R. Federico, and P. Mariottini
Heterologous Expression and Characterization of Mouse Spermine Oxidase
J. Biol. Chem., February 7, 2003; 278(7): 5271 - 5276.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/19/17209    most recent
M110920200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar