HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 19, 17255-17262, May 10, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/19/17255    most recent M110944200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Melendez, A. J. Articles by Khaw, A. K. Search for Related Content PubMed PubMed Citation Articles by Melendez, A. J. Articles by Khaw, A. K. Social Bookmarking                      What's this?

Dichotomy of Ca²⁺ Signals Triggered by Different Phospholipid Pathways in Antigen Stimulation of Human Mast Cells^*

Alirio J. Melendez and Aik Kia Khaw

From the Department of Physiology, Faculty of Medicine, National University of Singapore, Singapore 117597, Singapore

Received for publication, November 15, 2001, and in revised form, February 18, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Mast cell activation triggers Ca²⁺ signals and the release of enzyme-containing granules, events that play a major role in allergic/hypersensitivity reactions. However, the precise molecular mechanisms that regulate antigen-triggered degranulation and Ca²⁺ fluxes in human mast cells are still poorly understood. Here we show, for the first time, that a receptor can trigger Ca²⁺ via two separate molecular mechanisms. Using an antisense approach, we show that IgE-antigen stimulation of human bone marrow-derived mast cells triggers a sphingosine kinase (SPHK) 1-mediated fast and transient Ca²⁺ release from intracellular stores. However, phospholipase C (PLC) 1 triggers a second (slower) wave of calcium release from intracellular stores, and it is this PLC1-generated signal that is responsible for Ca²⁺ entry. Surprisingly, FcRI (a high affinity receptor for IgE)-triggered mast cell degranulation depends on the first, sphingosine kinase-mediated Ca²⁺ signal. These two pathways act independently because antisense knock down of either enzyme does not interfere with the activity of the other enzyme. Of interest, similar to PLC1, SPHK1 translocates rapidly to the membrane after FcRI cross-linking. Here we also show that SPHK1 activity depends on phospholipase D1 and that FcRI-triggered mast cell degranulation depends primarily on the activation of both phospholipase D1 and SPHK1.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Aggregation of the high affinity receptor for IgE (FcRI) on mast cells triggers the Ca²⁺-dependent release and production of a wide range of mediators responsible for the major symptoms of immediate hypersensitivity reactions (1-3). Although some of the signaling cascades triggered by FcRI have been characterized, the regulatory mechanisms governing mast cell degranulation and calcium release from internal stores are only partially understood. FcRI is a heterotrimeric receptor complex (₂) that contains immunoreceptor tyrosine-based activation motifs in both the  and  subunit cytoplasmic domains (4). The protein-tyrosine kinase Lyn is associated with the  subunit in resting cells (5), and its activation is promoted by FcRI cross-linking (6). Activated Lyn phosphorylates immunoreceptor tyrosine-based activation motifs of the  and  subunits, resulting in the recruitment of other Src-like as well as Syk protein tyrosine kinases through Src homology 2 domain-mediated interactions with phosphotyrosine residues (7, 8). Activation of these newly recruited protein tyrosine kinases, in turn, facilitates the translocation and phosphorylation of multiple signaling molecules, including phospholipase C (PLC)¹  isoforms and phosphoinositide 3-kinases (9). Activated PLC hydrolyses phosphatidylinositol 4,5-bisphosphate to D-myo-inositol 1,4,5-trisphosphate and diacylglycerol, which induce the release of Ca²⁺ from intracellular stores and the activation of protein kinase C isoforms, respectively. The amplitude and duration of the Ca²⁺ response potentially modulate the activation of different transcription factors (10), regulating different gene expression. Ca²⁺ signals are also indispensable for the release of histamine-containing granules (1), the synthesis of arachidonic acid-derived mediators, and the release and generation of various cytokines (2), which together are responsible for the major symptoms of immediate hypersensitivity reactions. Thus, an understanding of mast cell activation and Ca²⁺ signaling therefore has obvious therapeutic implications. It has previously been shown that FcRI, on the rat mast cell line RBL-2H, triggers Ca²⁺ signals via a novel pathway potentially involving sphingosine kinase activity (11) and not phospholipase C, even though IP₃ production was observed (11). We have recently shown that a similar receptor, FcRI in monocytes, triggers intracellular Ca²⁺ via the sequential activation of phospholipase D and sphingosine kinase (12); however, no IP₃ generation was observed in this case (12). Phospholipase D hydrolyses phosphatidylcholine to yield phosphatidic acid and choline (13); phosphatidic acid has been shown to have many intracellular signaling functions (13, 14), including the activation of sphingosine kinase (SPHK) (14-16). SPHK phosphorylates sphingosine to generate sphingosine-1-phosphate (15-17). Sphingosine-1-phosphate has been demonstrated to act as an alternative second messenger to inositol 1,4,5-trisphosphate in the release of Ca²⁺ from intracellular stores (11, 12). In this study, we show for the first time a dual molecular mechanism responsible for triggering different calcium signals. Firstly, a rapid rise in internal calcium is triggered by the sequential activation of phospholipase D (PLD) 1 and SPHK1. Secondly, a prolonged calcium response is triggered by phospholipase C1. Furthermore, mast cell degranulation is triggered by the combined action of PLD1 and SPHK1. However, the PLC1 activation is necessary to trigger calcium entry into the cells.

Understanding the intracellular signaling pathways coupling FcRI activation, by IgE-antigen, to physiological responses triggered by mast cell activation has profound therapeutic implications for allergic/inflammatory diseases.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Unless stated otherwise, all chemicals and reagents were obtained from Sigma.

BMMC Generation and Cell Culture-- Bone marrow was collected from human donors following the protocol approved by the FDA Committee for Research Involving Human Subjects. Normal donor eligibility criteria included healthy males and nonpregnant females between the ages of 18 and 45 years. The donors were required to have a negative medical history for all major diseases. Bone marrow was withdrawn by board-certified physicians from two separate sites of the posterior pelvic bone into syringes containing preservative-free heparin sodium injection (20-50 units heparin/ml bone marrow). BMMCs were generated using the previously described (18) protocol as follows: fresh human bone marrow cells were cultured in complete RPMI 1640 medium supplemented with 10 ng/ml interleukin 3 (Calbiochem) and 100 ng/ml stem cell factor (Calbiochem) for 2 weeks. BMMCs were characterized by flow cytometry as CD45+, CD117+, CD9+, fluorescein isothiocyanate-labeled human IgE-positive, CD4, CD8, CD45, CD11b, CD11c, and major histocompatibility complex class II. Purity was estimated at >95%. All antibodies were fluorescein isothiocyanate- or biotin-labeled (Serotec).

Antisense oligonucleotides were purchased from Oswell DNA Services; 20-mers were synthesized, capped at either end by the phosphorothiorate linkages (the first two and last two linkages), and corresponded to the reverse complement of the first 20 coding nucleotides for PLD1, SPHK1, PLC1, and a scrambled oligonucleotide for control. The sequences of the oligonucleotides were as follows: 5'-CCGTGGCTCGTTTTTCAGTG-3' for PLD1, 5'-CCCGCAGGATCCATAACCTC-3' for SPHK1, 5'-GGGGACGCGGCGCCCGCCAT-3' for PLC1, and 5'-CTGGTGGAAGAAGAGGACGT-3' for the scrambled oligonucleotide control.

Cells were incubated/transfected with oligonucleotides (1 µM) mixed with transfection reagent (FuGENE 6; Roche Molecular Biochemicals) for a total of 48 h (for 36 h prior to sensitization and for the duration of sensitization).

Reverse Transcription-PCR-- mRNA from BMMCs was isolated using the Qiagen midi kit for mRNA extraction. Specific forward (TGAACCCGCGCGGCAAGGGC) and reverse (GGTCAGCCGGCGCCATCCACG) primers were designed for human SPHK1 to yield a 570-bp fragment.

Peptide-derived Polyclonal Antibody Specific for Human SPHK1-- A peptide sequence specific for human SPHK1 was selected for its apparent hydrophobic properties and synthesized.

The peptide used was FIADVDLESEKYRRLGEMRFTLGT. Two rabbits were immunized, giving rise to two peptide-derived antisera. The polyclonal antibodies were purified using protein A-agarose affinity columns. The polyclonal antibodies only recognized one band in Western blots for the correct molecular weight of endogenous or recombinant human SPHK1. The antibody was also successfully used as primary antibody for immunostaining for confocal microscopy analysis.

FcRI Aggregation-- BMMCs were sensitized with 1 µg/ml human dinitrophenol-specific IgE overnight. Then cells were collected, washed, resuspended in RPMI 1640 medium-1% fetal bovine serum, and activated by the antigen dinitrophenol-bovine serum albumin (1 µg/ml), and activation was stopped at the times indicated in the figures.

Cell Lysates and Subcellular Fractionation-- For translocation experiments, cell lysates and subcellular fractions were prepared following the method described previously (19). Briefly, cells were harvested and resuspended in cold nuclear preparation lysis buffer (10 mM Tris-HCl, pH 7.4, 2 mM magnesium chloride, 140 mM sodium chloride, 1% Triton X-100, 0.25% sodium deoxycholate, 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 10 mM sodium orthovanadate, 10 µg/ml chymostatin, 10 µg/ml leupeptin, 10 µg/ml antipain, and 10 µg/ml pepstatin). After lysis by three cycles of freeze-thawing (in liquid nitrogen), the nuclei and cell debris (containing the cytoskeleton) were removed from the total cell lysates by centrifugation at 15,000 × g for 5 min. The supernatant was centrifuged at 100,000 × g and 4 °C for 60 min. The pellet containing the nuclear-free membrane fraction was resuspended in 200 µl of nuclear preparation buffer (without detergents) and stored at 20 °C. The amount of protein recovered in each fraction was quantified using the Bradford reagent system (Bio-Rad).

Gel Electrophoresis and Western Blots-- Unless stated otherwise, 40 µg of lysate for each sample was resolved on 10% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45-µm nitrocellulose membranes. For translocation experiments, 40 µg of lysate for each sample was fractionated as mentioned above, and the supernatant and the membrane fractions for each sample were resolved separately on 10% polyacrylamide gels (SDS-PAGE) under denaturing conditions and then transferred to 0.45-µm nitrocellulose membranes. After blocking overnight at 4 °C with 5% nonfat milk in Tris-buffered saline/0.1% Tween 20 and washing, the membranes were incubated with the relevant antibodies for 4 h at room temperature. The membranes were washed extensively in Tris-buffered saline/0.1% Tween 20 (washing buffer). The blots were probed using specific monoclonal (anti-PLC1; Santa Cruz Biotechnology) or polyclonal (anti-PLD1; Quality Control Biolabs) (anti-SPHK1; made in house as described) primary antibodies. Blots were stripped and reprobed with polyclonal antibodies: an anti-PDGFR antibody (against the  subunit of the PDGFR; Santa Cruz Biotechnology) for membrane loading control or an anti-HSP 90 antibody (H-114; against heat shock protein 90; Santa Cruz Biotechnology) for cytosol loading control. The anti-PDGFR antibody was also used as a loading control for blots containing whole cell lysates. Bands were visualized using the appropriate horseradish peroxidase-conjugated secondary antibody and the ECL Western blotting detection system (Amersham Biosciences).

Phosphatidylcholine-PLD Activity-- PLD activity was measured as described previously (12) using the transphosphatidylation assay. Briefly, BMMCs were labeled (10⁶ cells/ml) with [³H]palmitic acid (5 µCi/ml; Amersham Biosciences) in the cell culture medium for 16 h. After washing, the cells were incubated at 37 °C for 15 min in RPMI 1640 + 1% BSA medium containing butan-1-ol (0.3%, final concentration). After FcRI aggregation, cells were incubated for an additional 30 min and then extracted by Bligh-Dyer phase separation. The accumulated phosphatidyl butanol was assayed as described previously (12).

Inositol 1,4,5-Trisphosphate-- IP₃ was measured as described previously (20), using the BIOTRAK TRK 1000 kit (Amersham Biosciences). Briefly, this is a competition binding assay in which cellular generated (unlabeled) IP₃ competes with a fixed, known amount of [³H]IP₃ for binding to the IP₃ receptor present in homogenates from bovine adrenal glands, which has a high affinity and specificity for IP₃. FcRI aggregation was carried out described above, and activation was stopped at the times indicated in the figures.

Sphingosine Kinase Activity-- Activation of sphingosine kinase was measured as described previously (12, 21). Briefly, cells were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4) containing 20% glycerol, 1 mM mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCl₂, 1 mM sodium orthovanadate, and 15 mM sodium fluoride), protease inhibitors (10 µg/ml leupeptin, 10 µg/ml aprotinin, and 1 mM phenylmethylsulfonyl fluoride), and 0.5 mM 4-deoxypyridoxine, disrupted by freeze-thawing, and centrifuged at 105,000 × g for 90 min at 4 °C. Supernatants (cytosolic) and particulate (membrane) fractions were assayed for sphingosine kinase activity by incubation with sphingosine (Sigma) and [-³²P]ATP (2 µCi, 5 mM) for 30 min at 37 °C, and the products were separated by TLC on Silica Gel G60 (Whatman) using chloroform/methanol/acetic acid/water (90:90:15:6) and visualized by autoradiography. The radioactive spots corresponding to sphingosine phosphate were scraped and counted in a scintillation counter.

Cytosolic Ca²⁺-- Cytosolic calcium was measured as described previously (12, 21), except that for some experiments the buffer was supplemented with Ca²⁺ (final concentration, 1.5 mM Ca²⁺). Briefly, sensitized cells were loaded with 1 µg/ml Fura-2/AM (Molecular Probes, Leiden, The Netherlands) in phosphate-buffered saline, 1.5 mM Ca²⁺, and 1% bovine serum albumin. After removal of excess reagents by dilution and centrifugation, the cells were resuspended in 1.5 mM Ca²⁺-supplemented phosphate-buffered saline and warmed to 37 °C in the cuvette. FcRI was aggregated as described above. Fluorescence was measured at 340 and 380 nm, and the background-corrected 340:380 ratio was calibrated as described previously (12).

Confocal Microscopy-- After receptor aggregation, suspended cells were fixed in 4% paraformaldehyde, deposited on microscope slides in a cytospin centrifuge, and then permeabilized for 5 min in 0.1% Triton X-100 in phosphate-buffered saline. Fluorescence labeling was performed as described previously (22), using anti-PLC1 monoclonal antibody (Santa Cruz Biotechnology) or anti-SPHK1 polyclonal antibody (made in house as described) as primary antibody. Stainings were analyzed in horizontal confocal microscopy sections (50-100 sections of 0.2 µm) and recorded by a Leica TCS NT, and images were deconvoluted. Signals were projected into one image as an extended focus view.

-Hexosaminidase Release-- Degranulation was measured using a previously described (23) colorimetric assay to assess the release of -hexosaminidase. Briefly, 50 µl of the sample supernatant was incubated with 200 µl of 1 mM p-nitrophenyl N-acetyl--D-glucosiaminide for 1 h at 37 °C. The total -hexosaminidase concentration was determined by a 1:1 extraction of the remaining buffer and cells with 1% Triton X-100; a 50-µl aliquot was removed and analyzed as described. Reactions were quenched by the addition of 500 µl of 0.1 M sodium carbonate buffer. The enzyme concentration was determined by measuring the absorbance at 400 nm. -Hexosaminidase release was represented as a percentage of total enzyme.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In this study, we explored the molecular mechanisms regulating receptor coupling to various lipid-modifying enzymes and relate these to the triggering of Ca²⁺ signals and degranulation.

Because SPHK had been shown to play a potential role in triggering Ca²⁺ release from intracellular stores, we decided to investigate whether SPHK is indeed involved in the FcRI triggering of Ca²⁺ signals in human mast cells. Two human sphingosine kinases have recently been cloned and characterized, namely, SPHK1 (15) and SPHK2 (17). First, the presence of specific SPHK isozymes present in the cells was examined. In bone marrow-derived mast cells, only SPHK1 was found by reverse transcription-PCR (Fig. 1A), and by Western blot (Fig. 1B). Western blot analysis showed that SPHK1, in resting cells, is found primarily in the cytosolic fraction of the cells (Fig. 1B, top panel). However, aggregation of FcRI resulted in the rapid translocation of SPHK1 from the cytosol to the nuclear-free membrane fraction (Fig. 1B, bottom panel). In agreement with this, confocal microscopy also shows that SPHK1 is primarily cytosolic in resting cells, but after receptor engagement, it translocates rapidly to the cell periphery (Fig. 1C).

View larger version (34K): [in this window] [in a new window]   Fig. 1.   SPHK1 expression and subcellular localization in human BMMCs. A, reverse transcription-PCR analysis of mRNA expression levels before sensitization (lane 1) and after sensitization (lane 2). Lane 3, without primers. B, Western blot analysis of SPHK1 subcellular localization before and after FcRI cross-linking. Top panel, time course for FcRI cross-linking probing for SPHK1 in the cytosolic fraction: lane 1, resting cells; lane 2, 30 s after FcRI cross-linking; and lane 3, 1 min after FcRI cross-linking. Blots were stripped and reprobed for HSP 90 for cytosol loading control. Bottom panel, time course for FcRI cross-linking probing for SPHK1 in the nuclear-free membrane fraction: lane 1, resting cells; lane 2, 30 s after FcRI cross-linking; lane 3, 1 min after FcRI cross-linking. Blots were stripped and reprobed for PDGFR for membrane loading control. C, confocal microscopy of cells immunostained for SPHK1. Resting cells, cells before FcRI aggregation; XL FcRI, cells 1 min after FcRI cross-linking. Results shown are representative of three separate experiments.

Sphingosine kinase activity and its product, sphingosine-1-phosphate, have been shown to be involved in many cellular processes, including Ca²⁺ signals (11, 12), suppression of ceramide-mediated apoptosis (24), and cell survival and proliferation (24). However, the regulation of SPHK activity is still poorly understood. We have previously shown that a similar receptor, FcRI, in monocytic cells triggers sphingosine kinase activity dependent on PLD activation (11, 21). There is also in vitro evidence for the regulation of SPHK activity by acidic phospholipids (such as phosphatidic acid, the direct product of PLD activity) (16). Here we show that in human bone marrow-derived mast cells, FcRI couples to PLD1 to activate SPHK1. Antisense oligonucleotide to PLD1 blocks FcRI-triggered PLD activity (Fig. 2A, top panel) and considerably reduces endogenous PLD1 expression levels to only 18 ± 5% of the PLD1 expressed in control cells, which was taken as 100% (Fig. 2A, bottom panel). In resting cells, very little SPHK activity is observed; however, after FcRI cross-linking, SPHK activity increases very rapidly (Fig. 2B). In agreement with the translocation experiments (Fig. 1, A and C), very little SPHK activity is observed in the membrane fraction of resting cells; however, after FcRI cross-linking, SPHK activity increases very rapidly in the membrane fraction to levels higher than that observed in the cytosolic fraction (Fig. 2B, right and left panels, respectively). Moreover, antisense oligonucleotide to PLD1 blocked FcRI-triggered SPHK1 activity (Fig. 2B, top panel) but had no effect on SPHK1 expression (Fig. 2B, bottom panel). Furthermore, an antisense oligonucleotide to SPHK1 blocked FcRI-triggered sphingosine kinase activity (Fig. 2B, top panel) and had no effect on PLD activity (Fig. 2A, top panel) or PLD1 expression levels (Fig. 2A, bottom panel) but considerably reduced endogenous SPHK1 expression levels to only 15 ± 5% of the SPHK1 expressed in the control cells, which was taken as 100% (Fig. 2B, bottom panel). The scrambled oligonucleotide used as a control had no effect on the level of expression of either protein. These data suggest that SPHK1 is downstream of PLD1 activity in the FcRI-triggered signal transduction pathways.

View larger version (42K): [in this window] [in a new window]   Fig. 2.   FcRI triggers PLD1 activity upstream of SPHK1. A, top panel: 1, PLD basal activity; 2, PLD activity after FcRI cross-linking in control cells; 3, PLD activity after FcRI cross-linking in cells pretreated with an antisense oligonucleotide to PLD1; 4, PLD activity in cells pretreated with an antisense oligonucleotide to SPHK1. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments. A, bottom panel: PLD1 expression is down-regulated by the antisense against PLD1. The Western blot was probed with anti-PLD1 antibody. Control, extracts from control cells; Scrambled a.s., cells pretreated with a scrambled oligonucleotide; a.s.PLD1, cells pretreated with the antisense oligonucleotide to PLD1; a.s.SPHK1, cells pretreated with the antisense oligonucleotide to SPHK1. For loading control, blots were stripped and reprobed with an anti-PDGFR antibody (edited band). Results shown are representative of three separate experiments. B, top panels: left panel, cytosol; right panel, membrane. FcRI triggers SPHK1 activity downstream of PLD1. Basal, basal SPHK activity control; XL FcRI, SPHK activity after FcRI cross-linking control; XL FcRI a.s.SPHK1, SPHK activity after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to SPHK1; XL FcRI a.s.PLD1, SPHK activity after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to PLD1. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments. B, bottom panel, SPHK1 expression is down-regulated by the antisense against SPHK1 but not by the PLD1 antisense. The Western blot was probed with anti-SPHK1 antibody. Control, cell extracts from control cells; Scrambled a.s., cells pretreated with a scrambled oligonucleotide; a.s.SPHK1, cells pretreated with the antisense oligonucleotide to SPHK1; a.s.PLD1, cells pretreated with the antisense oligonucleotide to PLD1; rSPHK1, cells pretreated with 0.5 ng of purified recombinant SPHK1. For loading control, blots were stripped and reprobed with an anti-PDGFR antibody (edited band). Results are representative of three separate experiments.

In the rat mast cell line RBL-2H, Choi et al. (11) showed that FRI-triggered Ca²⁺ release from intracellular stores was dependent on sphingosine kinase activity by addition of the nonselective sphingosine kinase inhibitor dihydrosphingosine, which reduced the increase in Ca²⁺ in response to antigen, whereas the antigen-induced production of IP₃ was unimpaired. However, IP₃ is widely known to trigger the release of Ca²⁺ from intracellular stores by activating specific receptors on the membranes of these stores (25, 26), and PLC has been shown to be phosphorylated and to translocate after FcRI triggering in rat mast cells (27, 28). To determine whether FcRI triggers IP₃ generation and IP₃-mediated Ca²⁺ release in human mast cells, IP₃ generation was monitored over time. We found that in the human mast cells, PLC is activated by FcRI, as shown by the generation of IP₃ (Fig. 3A). Moreover, PLC1 is the PLC isoform that translocates to the membrane after FcRI engagement (Fig. 3B, top panel). Furthermore, antisense oligonucleotide to PLC1 inhibited IP₃ generation triggered by FcRI (Fig. 3A) and down-regulated the endogenous PLC1 expression levels (Fig. 3B, bottom panel). Antisense oligonucleotide to SPHK1 had no effect on IP₃ production (Fig. 3A) or on PLC1 expression levels (Fig. 3B, bottom panel).

View larger version (49K): [in this window] [in a new window]   Fig. 3.   FcRI triggers PLC1 activity and translocation. A: Basal, IP3 generation basal control; XL FcRI, IP3 generation after FcRI cross-linking control time course; XL FcRI a.s.PLC1, IP3 generation after FcRI cross-linking time course in cells pretreated with an antisense oligonucleotide to PLC1; XL FcRI a.s.SPHK1, IP3 generation after FcRI cross-linking time course in cells pretreated with an antisense oligonucleotide to SPHK1. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments. B, Western blots showing PLC1 translocation and down-regulation by antisense oligonucleotide to PLC1. Top panel, a time course of FcRI cross-linking; top band, cytosolic fraction probed with an anti-PLC1 antibody; bottom band, loading control using an anti-HSP 90 antibody). Middle panel: a time course of FcRI cross-linking; top band, nuclear-free membrane fraction probed with an anti-PLC1 antibody; bottom band, loading control using an anti-PDGFR antibody. Bottom panel: antisense down-regulation of PLC1. The Western blot was probed with an anti-PLC1 antibody; cell extracts were from control cells (Control), cells pretreated with a scrambled oligonucleotide (Scrambled a.s.), cells pretreated with the antisense oligonucleotide to PLC1 (a.s.PLC1), and cells pretreated with the antisense oligonucleotide to SPHK1 (a.s.SPHK1). For loading control, blots were stripped and reprobed with an anti-PDGFR antibody. Results shown are representative of three separate experiments.

For all experiments, the antisense transfection efficiency was very even; an average 85% of the cells treated with any of the antisense oligonucleotides used showed complete down-regulation in expression levels of the targeted protein (fluorescence-activated cell-sorting analysis; data not shown).

To clarify the roles of SPHK1 and/or PLC1 in the Ca²⁺ signals generated after FcRI engagement, we used the antisense oligonucleotides against human SPHK1 and PLC1 to demonstrate which pathway was responsible for Ca²⁺ triggering in the human mast cells. It was found that antisense down-regulation of SPHK1 substantially inhibited the initial rise in Ca²⁺ release from intracellular stores (Fig. 4A); however, Ca²⁺ entry was unaffected (Fig. 4A). In cells pretreated with antisense oligonucleotide to PLC1, the first peak in Ca²⁺ was unaffected (Fig. 4B); however, calcium entry was reduced (Fig. 4B). Experiments without extracellular Ca²⁺ showed that the initial rise in intracellular Ca²⁺ is due to SPHK1 (Fig. 4C), whereas a second, smaller increase in Ca²⁺ release from internal stores was due to PLC1 (Fig. 4C). A combination of both antisense oligonucleotide to SPHK1 and antisense oligonucleotide to PLC1 completely blocked the calcium response triggered by FcRI (Fig. 4D). The use of specific inhibitors for SPHK (N,N-dimethyl-sphingosine) or PLC (ET-18-OCH₃) generated results similar to those observed with the antisense oligonucleotides (data not shown).

View larger version (27K): [in this window] [in a new window]   Fig. 4.   FcRI triggers different cytosolic Ca2+ signals from SPHK1 and PLC1. AD, cytosolic Ca2+ triggered by FcRI aggregation. Cells were in 1.5 M extracellular Ca2+ (A, B, and D) or no extracellular Ca2+ (C). XL Control, time course control. XL a.s.SPHK1, cells pretreated with the antisense oligonucleotide to SPHK1. XL a.s.PLC1, cells pretreated with the antisense oligonucleotide to PLC1. XL a.s.SPHK1 + a.s.PLC1, cells pretreated with both antisense oligonucleotide to SPHK1 and antisense oligonucleotide to PLC1. Results shown are representative of three separate experiments.

These results show that FcRI triggers Ca²⁺ signals by two different pathways: (a) by a novel pathway that uses SPHK1 and is responsible for the initial strong Ca²⁺ release from internal stores, and (b) by a more classical pathway that triggers IP₃ generation via PLC, which triggers a second but smaller peak in Ca²⁺ release from intracellular stores and is responsible for triggering Ca²⁺ entry.

In contrast to previous studies in rat mast cells (11), the nonselective tyrosine kinase inhibitor genistein completely blocked SPHK activity and IP₃ generation (Fig. 5, A and B) as well as FcRI-induced PLD activity but had no effect on phorbol 12-myristate 13-acetate-induced PLD activity, suggesting that the tyrosine kinase inhibitor does not directly inhibit PLD activity (Fig. 5C). The FcRI-triggered membrane translocation of SPHK1 and PLC1 was also inhibited by the tyrosine kinase inhibitor (Fig. 5, D and E, respectively). Moreover, the Ca²⁺ signals triggered by FcRI were also completely blocked in cells pretreated with genistein (Fig. 5D). These data show that SPHK1 and PLC1 activities, as well as all the Ca²⁺ signals triggered by FcRI, are completely tyrosine kinase-dependent.

View larger version (31K): [in this window] [in a new window]   Fig. 5.   FcRI-triggered SPHK activity, PLC activity, PLD activity, Ca2+ signals, and translocation of SPHK1 and PLC1 are completely blocked by the tyrosine kinase inhibitor genistein. A, SPHK activity. Left panel, cytosol; right panel, membrane. Basal, basal SPHK activity in control cells; XL FcRI Control, SPHK activity triggered by FcRI in control cells; Basal + Gen, basal SPHK activity in cells pretreated with 0.35 M genistein; XL FcRI + Gen, SPHK activity triggered by FcRI in cells pretreated with 0.35 M genistein. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments. B, IP3 generation. Basal control, basal IP3 generation in control cells; Basal + Gen, basal IP3 generation in cells pretreated with 0.35 M genistein; XL control, IP3 generation triggered by FcRI in control cells; XL + Gen, IP3 generation triggered by FcRI in cells pretreated with 0.35 M genistein. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments. C, PLD activity. 1, basal PLD activity in control cells; 2, PLD activity triggered by FcRI in control cells; 3, basal PLD activity in cells pretreated with 0.35 M genistein; 4, PLD activity triggered by FcRI in cells pretreated with 0.35 M genistein; 5, PLD activity triggered by 10 µM phorbol 12-myristate 13-acetate in control cells; 6, PLD activity triggered by 10 µM phorbol 12-myristate 13-acetate in cells pretreated with 0.35 M genistein. D, confocal microscopy of cells immunostained for SPHK1. Resting cells, control cells; XL Control, control cells 1 min after FcRI cross-linking; XL + Gen, genistein (0.35 M)-pretreated cells 1 min after FcRI cross-linking. Results shown are representative of three separate experiments. E, confocal microscopy of cells immunostained for PLC1. Resting cells, control cells; XL Control, control cells 1 min after FcRI cross-linking; XL + Gen, genistein (0.35 M)-pretreated cells 1 min after FcRI cross-linking. Results shown are representative of three separate experiments. F, cytosolic Ca2+ signals triggered by FcRI aggregation in control cells (XL Control) or in cells pretreated with 0.35 M genistein (XL + Gen). Results shown are representative of three separate experiments.

Mast cell degranulation has been shown to be Ca²⁺-dependent (2, 3), and linked to phospholipase D activity (23, 29, 30). Antisense down-regulation of different PLD isoforms is proving to be a very useful tool in dissecting the functions of each particular isoenzyme (31). Antisense down-regulation of PLD1 substantially inhibits FcRI-triggered mast cell degranulation (Fig. 6A) but has no effect on IP₃ generation (Fig. 6B). Similarly, antisense oligonucleotide to SPHK1 also inhibited enzyme release (Fig. 6A), and a combination of antisense oligonucleotide to PLD1 and antisense oligonucleotide to SPHK1 almost completely inhibited FcRI-triggered degranulation (Fig. 6A) but had no effect on IP₃ production. Antisense oligonucleotide to PLC1 had no effect on enzyme release (Fig. 6A) but significantly reduced IP₃ generation (Fig. 6B).

View larger version (14K): [in this window] [in a new window]   Fig. 6.   Mast cell degranulation triggered by FcRI is dependent on PLD1 and SPHK1, but not on PLC1. A, -hexosaminidase release. 1, basal; 2, -hexosaminidase release after FcRI cross-linking control; 3, -hexosaminidase release after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to PLC1; 4, -hexosaminidase release after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to SPHK1; 5, -hexosaminidase release after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to PLD1; 6, -hexosaminidase release after FcRI cross-linking in cells pretreated with the combined antisense oligonucleotides to SPHK1 and to PLD1. B, IP3 generation is not inhibited by the combined antisense oligonucleotides to SPHK1 and to PLD1. Basal, basal IP3 generation; XL FcRI, IP3 generation after FcRI cross-linking control; XL FcRI a.s.SPHK1 + a.s.PLD1, IP3 generation after FcRI cross-linking in cells pretreated with the combined antisense oligonucleotides to SPHK1 and to PLD1; XL FcRI a.s.PLC1, IP3 generation after FcRI cross-linking in cells pretreated with the antisense oligonucleotide to PLC1. Results shown are the mean ± S.D. of triplicate measurements and are representative of three separate experiments.

These results show that both PLD1 and SPHK1 are necessary for FcRI to trigger mast cell degranulation.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Taken together, the data presented here demonstrate that the activation of FcRI by surface IgE-antigen complexes on human bone marrow-derived mast cells stimulates two different pathways to trigger Ca²⁺ release from internal stores. A novel pathway, which couples PLD1 to SPHK1 activation, is responsible for the initial peak in the FcRI-generated Ca²⁺ signals as well as the mast cell degranulation, and a more classical pathway triggers PLC1 activity and an IP₃-dependent second wave of Ca²⁺ release from internal stores, as well as Ca²⁺ entry into the cells.

The activation of sphingosine kinase and the generation of sphingosine-1-phosphate have been previously proposed to play a role in mobilizing calcium from intracellular stores (11, 12, 32-34). However, this proposal has proven highly controversial due to the presence of extracellular G protein-coupled receptors for sphingosine-1-phosphate (35, 36), which are able to mobilize calcium through conventional IP₃ receptor-dependent pathways. However, the resent cloning of the SCaMPER receptor (37) provides additional evidence that sphingoid derivatives are able to engage intracellular receptors and effect calcium release from intracellular stores independently of IP₃ generation. The data presented here provide evidence for specific immune receptor triggering of this pathway in mast cells. Thus, aggregation of FcRI resulted in the rapid membrane translocation and activation of SPHK1. The results presented in this report demonstrate that the initial peak in Ca²⁺ release from intracellular stores, triggered by FcRI, is dependent on sphingosine kinase activity. In this respect, aggregation of FcRI in human mast cells is behaving like in the rat mast cell line RBL-2H (11) and like the high affinity IgG receptor, FcRI, in human myeloid cells (12). Of interest, both these receptors use the same signal-transducing molecule (-chain) to recruit soluble tyrosine kinases (38, 39). However, unlike the study in the RBL-2H cells (11) and that of FcRI in human myeloid cells (12), a second peak in Ca²⁺ release from internal stores as well as Ca²⁺ influx to the cells triggered by FcRI in mast cells was dependent on PLC1 activation. The mechanism of coupling of tyrosine kinases to sphingosine kinase activation after FcRI aggregation in the RBL-2H cells was unclear (11). Here, we demonstrate that PLD1 is activated after FcRI aggregation in human mast cells and that SPHK1 activation is dependent on PLD1 activation. The immediate product of phosphatidylcholine-PLD is phosphatidic acid, and this is subsequently converted to diacylglycerol through the action of phosphatidic acid phosphohydrolases (14). Previous studies have shown that sphingosine kinase is activated by phosphatidic acid (16, 40) and not by diacylglycerol (16, 40), a product of both phospholipase D and phospholipase C. Our finding that sphingosine kinase is downstream of PLD is therefore consistent with this in vitro work. Moreover, both components of this novel FcRI-coupled intracellular signaling pathway involving the sequential activation of PLD and sphingosine kinase depend on tyrosine kinase. This finding is consistent with previous in vitro studies demonstrating that v-Src can activate PLD (41).

Aggregation of FcRI in mast cells triggers a number of effector functions. The novel intracellular signaling pathway demonstrated here appears to be functionally associated with these. Thus, previous studies have implicated phospholipase D in modulation of neutrophil, monocyte, and macrophage function, in particular by influencing the respiratory burst/NADPH oxidase cascade (42), vesicular trafficking (6), and phagocytosis (43). In the study reported here, inhibiting this pathway at either the PLD1 or SPHK1 level reduced the ability of this receptor to mobilize Ca²⁺ from intracellular stores. In addition, the inhibition of PLD and/or sphingosine kinase significantly reduced enzyme release/degranulation. Of interest, ADP-ribosylation factor plays a major role in regulating vesicular trafficking (44-46), and this low molecular weight G protein has also been demonstrated to regulate phospholipase D activity (31, 45-47).

This potential diversity of phospholipid signaling pathways offers the opportunity within the cell to very tightly regulate different physiological events of the cell effector mechanisms. The finding that FcRI is coupled to the release of calcium from intracellular stores and enzyme release/degranulation via a novel pathway has profound implications for the development of strategies for therapeutic intervention against different allergic and inflammatory responses.

	ACKNOWLEDGEMENT

We thank Dr. Laszlo Takacs for helpful comments during the preparation of the manuscript.

	FOOTNOTES

^* This work was supported by a start-up grant from the National Medical Research Counsel of Singapore.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Physiology, Faculty of Medicine, National University of Singapore, 2 Medical Dr., MD 9, 03-04, Singapore 117597, Singapore. Tel.: 65-874-1697; Fax: 65-778-8161; E-mail: phsmraj@nus.edu.sg.

Published, JBC Papers in Press, February 20, 2002, DOI 10.1074/jbc.M110944200

	ABBREVIATIONS

The abbreviations used are: PLC, phospholipase C; BMMC, bone marrow-derived mast cell; SPHK, sphingosine kinase; PLD, phospholipase D; IP₃, inositol 1,4,5-trisphosphate; PDGFR, platelet-derived growth factor receptor.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati