|
Originally published In Press as doi:10.1074/jbc.M106611200 on October 19, 2001
J. Biol. Chem., Vol. 277, Issue 2, 1316-1323, January 11, 2002
CCAAT/Enhancer-binding Proteins (C/EBP) and Activate Osteocalcin Gene Transcription and Synergize with Runx2 at the
C/EBP Element to Regulate Bone-specific Expression*
Soraya
Gutierrez §,
Amjad
Javed §,
Daniel K.
Tennant ,
Monique
van Rees ,
Martin
Montecino¶,
Gary S.
Stein ,
Janet
L.
Stein , and
Jane B.
Lian
From the Department of Cell Biology, University of
Massachusetts Medical School, Worcester, Massachusetts 01655-0106 and
the ¶ Departmento de Biologia Molecular, Universidad de
Concepcion, Casilla 160-C Concepcion, Chile
Received for publication, July 13, 2001, and in revised form, October 17, 2001
 |
ABSTRACT |
CCAAT/enhancer-binding proteins
(C/EBP) are critical determinants for cellular differentiation and cell
type-specific gene expression. Their functional roles in osteoblast
development have not been determined. We addressed a key component of
the mechanisms by which C/EBP factors regulate transcription of a
tissue-specific gene during osteoblast differentiation. Expression of
both C/EBP and C/EBP increases from the growth to maturation
developmental stages and, like the bone-specific osteocalcin (OC) gene,
is also stimulated 3-6-fold by vitamin D3, a
regulator of osteoblast differentiation. We characterized a C/EBP
enhancer element in the proximal promoter of the rat osteocalcin gene,
which resides in close proximity to a Runx2 (Cbfa1) element, essential
for tissue-specific activation. We find that C/EBP and Runx2 factors
interact together in a synergistic manner to enhance OC transcription
(35-40-fold) in cell culture systems. We show by mutational analysis
that this synergism is mediated through the C/EBP-responsive element in
the OC promoter and by a direct interaction between Runx2 and C/EBP .
Furthermore, we have mapped a domain in Runx2 necessary for this
interaction by immunoprecipitation. A Runx2 mutant lacking this
interaction domain does not exhibit functional synergism. We conclude
that, in addition to Runx2 DNA binding functions, Runx2 can also form a
protein complex at C/EBP sites to regulate transcription. Taken together, our findings indicate that C/EBP is a principal
transactivator of the OC gene and the synergism with Runx2 suggests
that a combinatorial interaction of these factors is a principal
mechanism for regulating tissue-specific expression during osteoblast differentiation.
 |
INTRODUCTION |
The CCAAT/enhancer-binding proteins
(C/EBPs)1 comprise a family
of transcription factors that are critical for normal cellular differentiation and metabolic functions in a variety of tissues. There
are currently six members of the C/EBP family designated as C/EBP ,
- , - , - , - , and - (1), most of which are expressed in
liver, spleen, and adipocytic tissues. However, more selective expression in other tissues has been observed among the family members
(2-7). Isoforms of the C/EBP proteins are known, and all function by
homo- or heterodimerization with one another and interaction with other
transcriptional activators or co-activators such as NF- B, Stat3,
c-Myb, PU.1, SP-1, ATF-2, PPAR , and Runx-1 (8-14).
Very little is known about the role of C/EBP factors in osteogenesis.
Targeted disruptions of C/EBP genes have been performed, but in none of
the studies were gross abnormalities of the skeleton observed (6,
15-17). However, recent studies have identified C/EBP regulation of
genes expressed in osteoblasts. The insulin-like growth factor 1 is a
key regulator of osteoblast growth and differentiation (18). C/EBP
enhances either basal or prostaglandin E2-activated transcription of the insulin-like growth factor 1 promoter in osteoblasts (19, 20). Expression of COX-2 and the 1 subunit of type
I collagen is also regulated in osteoblasts by C/EBP factors (21, 22).
The interaction of C/EBP with a Runx1 factor (23) is also
particularly relevant for postulating a role for C/EBP factors in
osteoblast differentiation.
The Runt-related transcription factors (Runx/AML/CBF /PEBP2 )
represent essential gene regulatory proteins that control lineage commitment for hematopoiesis (24-26) and osteogenesis (27, 28). Runx2
(AML3/Cbfa1/PEBP2 A) is the most abundant Runt-related protein in
osteogenic and chondrogenic cell lineages (29-31). Genetic ablation of
the Runx2 gene causes developmental defects in osteogenesis (27), and
hereditary mutations in the Runx2 gene are linked to specific
ossification defects as observed in cleidocranial dysplasia (32). Runx2
is essential for osteoblast differentiation (27, 29, 30) and regulates
expression of numerous bone-related genes (29, 31, 33-35). The
importance of Runx2 in expression of the bone-specific osteocalcin (OC)
gene is well documented (36, 37). Thus, Runx2 performs specialized
functions during bone-tissue development and differentiation in
vivo. However, it is noteworthy that osteoblast-specific
transcription of osteocalcin occurs even in the absence of Runx sites
in the rat OC promoter (38), suggesting a tissue-specific role for
other regulatory factors in osteoblasts.
Activation of tissue-specific genes is controlled by combinatorial
mechanisms that rely on local features of the promoters, including
organization of control elements in the target genes and/or the
interplay between DNA-binding proteins and various transcriptional
co-regulators (39). Both C/EBP and Runx factors have been shown to
cooperate with chromatin remodeling factors (p300, SWI/SNF) and other
enhancer-binding proteins (40, 41). For example, Ets-1, c-Myb, Sp1, and
C/EBP, together with Runx factors, stimulate the transcription of
hematopoietic and osteogenic genes (13, 14, 23, 42-44), whereas
PPAR and Stat3 interactions with C/EBP are driving forces for
adipocyte differentiation (45). Given these observations,
i.e. the presence of both C/EBP and - and Runx2 in
osteoblasts (29, 30, 46) and C/EBP -Runx1 protein-protein
interactions in regulation of a hematopoietic specific gene
(13), we addressed the possible role of C/EBP factors in osteoblasts
and in the regulation of a bone-specific gene, osteocalcin.
Here we report that C/EBP and - , but not - , are
developmentally expressed during osteoblast differentiation and are
up-regulated in response to 1,25(OH)2 D3, a
hormone that promotes osteoblast differentiation. We have identified a
C/EBP-responsive regulatory element in the proximal promoter of the
bone-specific osteocalcin gene. Deletion or mutation of this motif
abrogates transcriptional enhancement by C/EBP factors. Furthermore, we
provide the first demonstration that Runx2 and C/EBP physically
interact and that C/EBP and Runx proteins act synergistically to
activate the OC promoter. Importantly, this functional synergism is
mediated through the C/EBP element. These findings establish for the
first time a role of C/EBP in the regulation of an osteoblast-specific
gene and define a novel mechanism for C/EBP in the regulation of cell type-specific gene transcription.
 |
MATERIALS AND METHODS |
Site-directed Mutagenesis and Expression
Constructs--
Constructs containing the rat OC ( 1097/+23 or
208/+23) promoter fused to the chloramphenicol acetyltransferase
(CAT) gene have been described previously (47). The 208 OC-CAT C/EBP
mt plasmid, containing mutation of the C/EBP binding site in the 208
OC promoter (shown in lowercase) was generated by a PCR-based approach
(48) with the following synthetic oligonucleotides: 5'-GGTTTGACCTAgactagtCATGACCCCCAA-3', pUC/M13 reverse primer: 5'-TCACACAGGAAACAGCTATGAC-3' (PCR 1),
5'-TTGGGGGTCATGactagtcTAGGTCAAACC-3', pUC/M13 forward primer:
5'CGCCAGGGTTTTCCCAGTCACGAC 3' (PCR 2), and 208 OC-CAT as
template; this mutation introduced a unique site for the
SpeI restriction enzyme. The PCR products were digested with
BamHI-SpeI (PCR1) and
ApaI-SpeI (PCR2). A three-way ligation reaction
was set using ApaI-BamHI-digested 208 OC-CAT as backbone.
The 208 OC-CAT Runx mt plasmid was generated by digestion of the mC
CAT plasmid (36) with SphI-PpMU, followed by blunt ending
and self-ligation. To generate the plasmid with mutations in both
binding sites, two PCR reactions were set as above, but in this case
208 OC-CAT Runx mt was used as template. All plasmids were sequenced
using the pUC/M13 forward primer. The expression constructs encoding
the wild type Runx2 and Runx2 361 are as reported previously (29,
31). Runx2 230 was prepared by PCR amplification of the coding
sequences using the forward primer 5'-CGGGATCCATGCGTATTCC-3' and a reverse primer with an
engineered stop codon 5'-GGCTCGAGTCATTTAGAGTCATCAGGC-3'.
Nonencoded nucleotides are underlined. The PCR fragment was digested
with BamHI-XhoI and ligated to similarly digested
pcDNA 3.1 His C vector (Invitrogen Inc., San Diego, CA). In-frame
ligation of these constructs was confirmed by DNA sequencing.
Expression constructs of C/EBP , - , and - were obtained from
Dr. Alan Friedman (Johns Hopkins Hospital, Baltimore, MD).
Cell Cultures, Transient Transfection, and Reporter
Assays--
Normal rat diploid osteoblasts obtained from 21-day fetal
rat calvariae were isolated and maintained as described (49). HeLa
cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Rat osteosarcoma (ROS 17/2.8)
cells were grown in F-12 supplemented with 5% fetal calf serum. HeLa
and ROS 17/2.8 cells plated in six-well plates were transiently
transfected with 1-2.5 µg of OC promoter-CAT and 0.1-0.75 µg of
cytomegalovirus empty vector, C/EBP , C/EBP , or Runx expression constructs. Cells were transfected using SuperFect transfection reagent
as described previously (50). RSV-luciferase plasmid (100 ng) was
included as an internal control for transfection efficiency. Cells were
harvested 24-36 h after transfection and assayed for CAT activity. The
data were normalized to luciferase values obtained from the same samples.
Isolation of Total Cellular RNA and Northern Blot
Analysis--
Total cellular RNA was isolated from normal rat fetal
calvarial osteoblasts or adult rat tissues as described previously
(51). Cells at different stages of differentiation were washed and
scraped in phosphate-buffered saline. Frozen cell pellets from each
time point were thawed and processed together. RNA pellets were briefly air-dried and dissolved in 400 µl of diethyl pyrocarbonate-treated water and stored at 70 °C until further usage. RNA samples from different stages of differentiation were electrophoresed in 1% formaldehyde-agarose gels and transferred to Hybond-N+
membrane (Amersham Biosciences, Inc.) in 20× SSC. Blots were hybridized with random primed (Prime-It kit; Stratagene, La Jolla, CA),
32P-labeled cDNA probes for C/EBP (NcoI
fragment), C/EBP (EcoRI-XhoI fragment),
C/EBP (BamHI-EcoRI fragment), human
glyceraldehyde-3-phosphate dehydrogenase
(EcoRI-HindIII fragment), human histone H4
(HindIII-XbaI fragment of FO108), alkaline
phosphatase (EcoRI fragment), Runx2 (BamHI-XbaI fragment), and rat OC
(EcoRI-BamHI fragment) at 42 °C overnight. The
blots were washed and subjected to autoradiography.
Oligonucleotides and Electrophoretic Mobility Shift
Assay--
Oligonucleotides spanning the C/EBP motif from the rat
osteocalcin promoter ( 117/-88) were synthesized: wild type,
5'-GGTTTGACCTATTGCGCACATGACCCCCAA-3'; and mutant,
5'-GGTTTGACCTAgactagtCATGACCCCCAA-3'. The C/EBP motif is shown in bold,
and the mutated sequences in lowercase. Nuclear extracts from ROS
17/2.8, HeLa, and primary rat osteoblast cells at different stages of
culture (days 7, 14, and 20) were prepared by a modified Dignam method
(52) with 0.42 M KCl for extraction. ROS 17/2.8 and HeLa
cells were plated in 100-mm plates at a density of 0.5 × 106. Cells were collected at 95% confluence by washing
twice with ice-cold phosphate-buffered saline. The whole isolation
procedure was carried out on ice. Cells from five plates were pooled
into a 50-ml polypropylene tube and pelleted by centrifugation at
165 × g for 5 min at 4 °C. Cells were gently
resuspended in 5-10 volumes of Nonidet P-40 lysis buffer (10 mM Tris, pH 7.4, 3 mM MgCl2, 10 mM NaCl, 0.5% Nonidet P-40) supplemented with 1×
CompleteTM protease inhibitor mixture (Roche Molecular Biochemicals)
and incubated on ice for 20 min. Aliquots (25 µl) of the nuclear
extracts were snap-frozen in liquid nitrogen and stored at 80 °C
until further use. Protein concentration of nuclear extracts was
determined by Bradford assay. A polyclonal Runx2-specific antibody
(Oncogene Research Products, Boston, MA) was used in supershift assays.
Immunoprecipitation--
HeLa cells were transfected with Runx2
and C/EBP ; ~107 cells/immunoprecipitation were lysed
in 800 µl of Nonidet P-40 buffer (150 mM NaCl, 50 mM Tris, pH 8.0, 1% Nonidet P-40, 1× CompleteTM (Roche
Molecular Biochemicals), 25 µM MG132 (Sigma-Aldrich)) and extracted at 4 °C for 15 min, followed by centrifugation at
16,000 × g for 15 min. The supernatant was transferred
to a clean microcentrifuge tube and precleared with 20 µl of protein
A/G Plus-agarose beads (Santa Cruz Biotechnology, Inc., Santa Cruz,
CA), at 4 °C for 30 min. The beads were collected by centrifugation
at 1000 × g for 5 min at 4 °C. Xpress antibody (3 µg, Invitrogen Corp., Carlsbad, CA) was added to the precleared cell
lysate followed by incubation at 4 °C for 1 h. To precipitate
the immunocomplexes, 50 µl of protein A/G Plus-agarose beads were
added and further incubated at 4 °C with agitation for 1 h. The
beads were washed twice with 1 ml of washing buffer (20 mM
Tris, pH 8.3, 0.5% sodium deoxycholate, 0.5% Nonidet P-40, 50 mM NaCl, 2 mM EDTA, 1× CompleteTM , 25 µM MG 132), suspended in 1× SDS sample buffer, and
analyzed by Western blotting.
Western Blot Analysis--
Transfected or untransfected HeLa and
ROS 17/2.8 cells cultured on 100-mm dishes were lysed on the plate by
adding 300 µl of SDS lysis buffer (2% SDS, 10 mM
dithiothreitol, 10% glycerol, 2 M urea, 1.0 mM
phenylmethylsulfonyl fluoride, 10 mM Tris-HCl, pH 6.8, 0.002% bromphenol blue, 1× protease inhibitor mixture). Proteins
(30-40 µg) were resolved in 10% SDS-PAGE and transferred to
Trans-Blot membrane (Bio-Rad). Antibodies against C/EBP , C/EBP , and lamin B were purchased from Santa Cruz Biotechnology, Inc. (Santa
Cruz, CA). Epitope-tagged Runx proteins were detected by mouse
monoclonal horseradish peroxidase-conjugated Xpress antibody (Invitrogen Corp., Carlsbad, CA). Monoclonal antisera for tubulin was
purchased from Sigma-Aldrich.
 |
RESULTS |
C/EBP Family Members Are Expressed during Osteoblast
Differentiation and Are Regulated by Vitamin D3--
We
initially assessed the expression of C/EBP factors in various bone
tissues and during development of the osteoblast phenotype. Fig.
1A shows that C/EBP and
- mRNAs are present in calvarial tissue (lane 2) and
in cortical and trabecular bone (data not shown) at levels similar to
those in a representative soft tissue, muscle (lane 1).
C/EBP is not detected in bone tissue, consistent with its pivotal
role for adipogenesis. Osteoblast markers (OC, Runx), which are not
present in soft tissues, are shown for comparison. The abundance of
C/EBP and - in bone prompted examination of expression of the
C/EBP family members from growth to differentiation stages of
osteoblasts in vitro, representing proliferation (days 3-5), matrix maturation (days 7-12), and the mineralization stage (days 19-22), reflected by peak levels of histone H4, alkaline phosphatase (ALP), and OC, respectively (Fig.
1B).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Biphasic expression and vitamin D regulation
of C/EBP transcription factors during rat osteoblast differentiation
and presence in bone tissues. A, total RNA was isolated
from various skeletal and soft rat tissues as described under
"Materials and Methods." RNA (10 µg) was resolved in a 1%
formaldehyde gel and transferred to nylon membrane. The blots were
hybridized with NcoI fragment for C/EBP ,
EcoRI-XhoI fragment for C/EBP ,
BamHI-EcoRI fragment for C/EBP ,
EcoRI fragment for alkaline phosphatase,
HindIII-XbaI fragment for histone H4,
BamHI-XhoI fragment for Runx2,
EcoRI-HindIII fragment for
glyceraldehyde-3-phosphate dehydrogenase, and
EcoRI-BamHI fragment for the detection of rat OC.
C/EBP and - mRNAs are expressed in both soft and skeletal
tissues. Lane 1, muscle; lane 2, day 21 fetal
calvaria. B, primary rat osteoblasts were cultured for the
indicated time (days) and total RNA (10 µg) was resolved in a 1%
agarose gel and probed with the above mentioned cDNA fragments. The
relative positions of 28, 18, and 5 S ribosomal RNA are indicated for
reference. C, enhancement of C/EBP factors by vitamin D
during osteoblast differentiation. Primary rat calvarial osteoblasts
were cultured in vitro and collected at three stages of
development: proliferation (day 7), matrix maturation (day 12), and
mineralization (day 19). Cells were treated with 10 8
M vitamin D3 for 24 h prior to harvesting.
Total RNA was isolated as described under "Materials and Methods."
The Northern blotting and probing were performed essentially as
described above. Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) is shown as control for loading of RNA.
|
|
Both C/EBP and - mRNAs are detected from the growth to
maturation stages and are expressed in a biphasic pattern. In contrast, C/EBP expression is not detected at any stage of osteoblast
differentiation, consistent with its absence in bone tissue. Two sizes
of C/EBP mRNA are present with the larger species appearing more
constitutive, whereas the smaller transcript is expressed during the
growth period (days 3-5). The latter transcript is decreased markedly during the matrix maturation stage (days 7-12, when alkaline
phosphatase-positive cells are forming nodules), followed by a
4-5-fold increase in expression concomitant with mineral deposition
and peak levels of osteocalcin and Runx2 expression (Fig.
1B). C/EBP mRNA is expressed in a manner similar to
that for C/EBP , but the larger transcript is detected at very low
levels. A significant (5-fold) temporal increase in C/EBP mRNA
expression is observed during osteoblast differentiation from
confluence (day 7) to the mature osteoblasts (day 22). Several Runx2
isoforms that result from utilization of alternative promoters and
differential splicing are expressed (Fig. 1B). The increase
in expression of the major Runx2 transcript during later stages of
differentiation is consistent with increased Runx2 DNA binding activity
in mature osteoblasts (29). Thus, the increases in C/EBP and
C/EBP in the late stages of osteoblast differentiation appear to
parallel peak expression levels for the osteoblast-related osteocalcin
gene and the Runx2 transcription factor.
We further assessed the relationship of C/EBP factors to osteoblast
differentiation. Vitamin D3, a hormone that promotes
osteoblast differentiation, is a known enhancer of many
osteoblast-related genes (53). Expression of C/EBP is stimulated by
vitamin D3 at each stage of osteoblast maturation, 6-fold
during growth (day 7) and nodule development (day 12) and 3-fold during
mineralization (day 19). Vitamin D3-dependent
enhancement of C/EBP is similar to that of C/EBP except the -fold
stimulation is lower (3-fold at all stages). Treatment of cells with
vitamin D3 has no effect on the expression of C/EBP at
any stage of differentiation (data not shown). The
differentiation-promoting properties of vitamin D3 are
reflected by the decrease in histone H4 and the increase in OC
expression (Fig. 1C). Thus, expression of both C/EBP and C/EBP is strongly enhanced upon treatment with vitamin
D3 in relation to osteoblast differentiation. Taken
together, these data demonstrate that C/EBP transcription factors are
expressed at significant levels in bone tissue, they increase during
osteoblast differentiation in vitro, and their expression is
up-regulated by 1,25(OH)2 D3.
C/EBP Proteins Activate the Osteocalcin Gene through a
C/EBP-responsive Element in the Proximal Promoter--
The enhanced
expression of C/EBP and - during mineralization relative to the
onset of OC transcription and in response to vitamin D3
suggests that these C/EBP transcription factors may contribute to
osteoblast-specific expression of the OC gene. Previous studies using
promoter deletion constructs of the rat OC gene have shown that the
initial 200 bp of the promoter can confer tissue-specific expression
(38). This region contains a Runx-responsive motif and a homeodomain
box that also binds an osteoblast-specific complex (54). Sequence
analysis of this region reveals the presence of a C/EBP motif (Fig.
2A). To determine whether the
C/EBP protein(s) can interact with this element, gel mobility shift
analyses were performed using oligonucleotides (see "Materials and
Methods") containing either wild type or mutated C/EBP binding
sequences (Fig. 2A). Using nuclear extracts from day 20 primary rat osteoblasts in which OC is actively expressed, we observed
two major protein-DNA complexes (Fig. 2B). Specificity of
these protein-DNA interactions was confirmed by oligonucleotide
competition assays. Addition of unlabeled wild type oligonucleotide,
but not mutant oligonucleotide, inhibited the binding of the protein
complexes to the labeled probe (Fig. 2C). Taken together
these results indicate that C/EBP proteins interact in a
sequence-specific manner with their cognate element in the proximal
promoter of the bone-specific rat OC gene.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 2.
A consensus C/EBP-responsive motif is present
in the proximal regulatory region of the rat OC gene.
A, regulatory sequences and their cognate binding factors in
the 1.1 kb OC promoter are shown. A putative C/EBP motif is
contiguous to the OC box, a 24-bp element containing a homeodomain
binding site. Position and nucleotide sequence for the binding of the
C/EBP transcription factors are shown below. Sequence of the
osteocalcin C/EBP motif differs from consensus by a single base.
Recognition motifs for Runx factors (sites A ( 605 to
599), B ( 441 to 435), and C ( 136 to
130)) and the vitamin D response element (VDRE) ( 461 to
441) are shown, and the positioned nucleosome between sites
B and C is indicated. B,
sequence-specific protein-DNA interactions at the rat OC C/EBP element.
Oligonucleotides corresponding to wild type or mutated C/EBP sites (see
"Materials and Methods") from the OC gene were incubated with
increasing concentrations (0-10 µg) of nuclear protein from day 20 primary rat osteoblast cultures. C, the specificity of the
complexes is further demonstrated by competition assays.
Oligonucleotides carrying the wild type C/EBP site from the OC gene
(see "Materials and Methods") were incubated with 6 µg of nuclear
proteins. The concentration ranges of wild type (WT) or
mutant (mt) cold competitors are indicated at the
top of each lane.
|
|
The presence of C/EBP in the protein complex binding to the OC promoter
element suggests transcriptional regulation of the OC gene by C/EBP
factors. This possibility was experimentally addressed by assessing the
effect of forced expression of C/EBP and - on activity of
full-length ( 1.1 kb) and proximal ( 208 bp) OC promoter-CAT reporter
gene constructs in the osteoblastic ROS 17/2.8 cell line (Fig.
3). The results indicate that C/EBP and - significantly enhance OC promoter activity, 4-5-fold on the
full-length promoter (Fig. 3A, left
panel) and 8-fold on the proximal promoter segments (Fig.
3A, right panel). Western blot analysis shows that C/EBP and C/EBP proteins of the expected sizes are expressed (Fig. 3B). A representative CAT
autoradiogram showing basal activity of the 1.1 kb and 208 OC-CAT
and the extent to which these promoters are activated by C/EBP and
- is presented in Fig. 3C. Thus, both C/EBP and -
are potent activators of osteocalcin gene transcription.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 3.
C/EBP class of transcription factors
regulates osteocalcin gene expression. A, ROS 17/2.8
cells were transiently co-transfected with 0.75 µg of C/EBP or
- expression plasmids and 2.5 µg of 1.1 kb OC-CAT
(left panel) or 208 OC-CAT reporter constructs
(right panel). Cells were harvested 24 h
after transfection, and CAT activities were determined. The data were
normalized to values for RSV-luciferase activity as an internal
control. Pooled data from three independent experiments are presented
as percentage of CAT conversions. Each bar represents
the mean ± least square (n = 18). B,
ROS17/2.8 cells plated in 100-mm dishes were transiently transfected in
parallel with 10 µg of either empty vector or C/EBP and -
expression constructs. Thirty µg of protein was resolved on 10%
SDS-PAGE. Lamin B antigen is shown as a loading control. C,
representative CAT autoradiograms of C/EBP-mediated activation of the
1.1 kb and 0.2 kb OC promoter. Cell lysates (50 µl) from
indicated samples were used to determine CAT activity as described
under "Materials and Methods."
|
|
To establish that the C/EBP element in the proximal region directly
mediates the enhancement of promoter activity by C/EBPs, site-directed
mutagenesis was performed. The C/EBP element in 208 OC-CAT was
mutated (see Fig. 2A) using the same oligonucleotides used
in the gel shift assays. The results show that mutation of the C/EBP
element blocks the C/EBP-mediated stimulation (6-8-fold) observed with
the wild type promoter (Fig. 4).
Therefore, responsiveness of the OC promoter to C/EBP transcription
factors is dependent on the integrity of the C/EBP element in the basal
promoter region.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
C/EBP-mediated activation of the rat OC
promoter requires the integrity of the C/EBP-responsive motif.
Constructs carrying wild type or mutated (mt) C/EBP elements
in the proximal promoter of the rat OC gene ( 208 OC-CAT) or empty
vector control (pGEM-CAT) were transiently co-transfected with C/EBP
expression plasmid into ROS 17/2.8 cells. Reporter activities were
determined 24 h after transfection and normalized to luciferase
values used for transfection control (n = 6).
|
|
Functional Synergism between Runx and C/EBP Proteins Is Mediated
through the C/EBP Element--
Runx2 is a well characterized regulator
of OC gene transcription and a Runx-responsive motif is located in
close proximity to the C/EBP element in the proximal OC promoter.
Therefore, functional interaction between these proteins in
transcriptional regulation of the OC gene was tested. For these studies
we selected HeLa cells, which lack Runx2 (Fig.
5A) and have no Runx DNA
binding activity (Ref. 55 and data not shown). Consistent with these observations, we find low basal activity of the 208 OC promoter in
HeLa cells compared with osteoblastic ROS 17/2.8 cells, which express
both C/EBP and Runx2 (Fig. 5). Interestingly, HeLa cells have
significant levels of C/EBP (Fig. 5A). Based upon
preliminary examination of dose-dependent effects of Runx2
and C/EBP individually on activity of the 208 OC promoter (data
not shown), we used a suboptimal concentration of each expression
plasmid (0.4 µg) for these studies. Expression of either C/EBP or
Runx2 in HeLa cells stimulates OC promoter activity 2-4-fold. However,
co-expression of Runx2 and C/EBP results in a massive activation
(30-40-fold) of the OC promoter (Fig.
6), demonstrating a functional synergism between these two proteins. We also observed a synergistic interaction of Runx2 and C/EBP on the OC promoter in osteoblastic ROS 17/2.8 cells (20-25-fold stimulation compared with 3-5-fold for each protein
alone; data not shown). This functional synergy between two positive
regulators of OC transcription is consistent with increased expression
of C/EBP and - , Runx2, and OC during late stages of osteoblast
differentiation.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 5.
Expression of the rat OC promoter in osseous
and non-osseous cells. A, total cellular protein
(30 µg) from HeLa or ROS 17/2.8 cells was resolved on 10% SDS-PAGE.
Levels of endogenous C/EBP and Runx2 proteins were determined by
probing the blots with anti-C/EBP and anti-Runx2 antibodies. Lamin B
is shown as loading control. B, HeLa or ROS 17/2.8 cells
were transfected with 2 µg of 208 OC-CAT constructs. CAT activities
were determined 24 h after transfection and presented as
percentage of CAT conversion. C, representative
autoradiogram shows the extent of basal promoter activity in HeLa and
ROS 17/2.8 cells.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 6.
C/EBP and Runx2
synergistically activate the osteocalcin promoter. Functional
interaction between C/EBP and Runx2 was determined by transient
co-expression of C/EBP and Runx2 constructs (0.4 µg each) with 1 µg of indicated CAT reporter along with RSV-luciferase construct (100 ng) into HeLa cells. CAT activities were determined 24 h after
transfection and normalized to luciferase values. Data are presented as
percentage of CAT conversions (n = 18, from three
independent experiments).
|
|
To investigate the specific contribution of the Runx and C/EBP elements
and their cognate factors to synergistic activation of the OC promoter,
a series of promoter constructs bearing mutations in either Runx or
C/EBP binding sites were generated (Fig.
7A). Each of these constructs
was tested for responsiveness to C/EBP and/or Runx2. Data pooled from
four independent experiments show a consistent 30-40-fold synergistic
enhancement of the wild type OC promoter by C/EBP and Runx2 (Fig.
7B). Mutation of the Runx site did not affect the
synergistic response (23-26-fold enhancement). In contrast, we
observed a loss of this functional synergism upon mutation of the C/EBP
motif. A similar loss of synergistic activity was observed when both
C/EBP and Runx sites were mutated (Fig. 7B). Co-expression
of C/EBP and Runx2 resulted in a similar pattern of activation of
these OC promoter constructs (data not shown). These findings suggest
that the C/EBP regulatory element is required for the synergistic
enhancer activity involving Runx2.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Functional synergism between Runx2 and C/EBP
factors is mediated by a C/EBP-responsive motif in the rat OC
promoter. A, illustration of mutations in the proximal
OC promoter. Top line diagram shows
the relative positions and sequences of Runx- and C/EBP-responsive
elements with mutated sequences shown in lowercase.
Constructs carrying mutation in either Runx or C/EBP elements alone or
combined are indicated. B, HeLa cells were transiently
co-transfected with 1 µg of either wild type or mutated OC promoter
constructs (carrying mutation in either C/EBP or Runx sites
individually or together) and 0.4 µg of C/EBP or Runx2 expression
constructs as indicated. Reporter activities were determined 24 h
after transfection and normalized to luciferase values used for
transfection control. WT, wild type; mt,
mutant.
|
|
For further insight into the mechanisms involved in Runx2-C/EBP
functional synergism, we tested a series of carboxyl-terminal deletion
mutants of Runx2 (Fig. 8A).
Both mutant Runx2 proteins (1-361 and 1-230) are expressed (Fig.
8B), enter the nucleus and retain DNA binding activity (data
not shown). Fig. 8C shows that both mutants also retain
functional activity on the OC promoter but at a lower level than wild
type Runx2. When the mutant Runx2-(1-361) was co-expressed with either
C/EBP or - , synergistic activation (40-80-fold) of the OC
promoter was observed. However, this synergism did not occur with the
mutant Runx2-(1-230). These Runx mutational studies clearly
demonstrate that a Runx2-C/EBP interaction is required to support
synergistic activation of the OC promoter.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 8.
Functional synergy between C/EBP and Runx2
requires C/EBP interacting motif. A, deletion mutants
of Runx2 are shown diagrammatically. The RHD, nuclear localization
(NLS), and putative C/EBP interacting region are indicated.
Panel B shows Western blot analysis of
Xpress-tagged Runx2 protein expressed in HeLa cells. Tubulin is shown
as a loading control. C, functional synergism is
demonstrated in HeLa cells, which were transiently co-transfected with
0.4 µg each of cytomegalovirus empty vector, C/EBP , C/EBP ,
Runx2 full-length and deletion mutant expression plasmid, and 1 µg of
the 208 OC-CAT constructs, as well as 100 ng of a RSV-luciferase
plasmid. Cells were harvested 24 h after transfection and assayed
as described under "Materials and Methods." Data are presented as
-fold induction (expression constructs/empty vector control,
n = 12 from four independent experiments).
D, direct interaction between Runx2 and C/EBP is shown by
co-immunoprecipitation. HeLa cells were co-transfected with C/EBP
and the Xpress-tagged deletion constructs of Runx2 (as indicated) lysed
24 h later and immunoprecipitated (Ip) with Xpress
antibody or mouse IgG as described under "Materials and Methods."
Immunoprecipitated complexes were resolved on 12% SDS-PAGE followed by
Western blotting using either XpressHRP or C/EBP .
E, electrophoretic mobility shift analysis shows a
Runx2-C/EBP interaction at the C/EBP element. A C/EBP oligonucleotide
(see Fig. 2 legend) was incubated with 10 µg of nuclear extracts from
HeLa cells (lanes 1 and 2) or day 20 rat
osteoblasts (lanes 3 and 4). Nuclear extracts
(N. extract) were preincubated with 1 µl of Runx2 antibody
(Ab) for 20 min at 37 °C (lanes 2,
4, and 5). Bracket shows C/EBP
complexes; arrowhead indicates supershifted band.
|
|
To determine whether functional synergism between Runx2 and C/EBP
requires a physical interaction, we performed co-immunoprecipitation studies. Wild type Runx2 and Runx2-(1-361), which lacks the carboxyl terminus, each form a complex with C/EBP , whereas Runx2-(1-230) fails to interact (Fig. 8D). The absence of C/EBP in the
immunoprecipitated Runx2-(1-230) complex indicates that amino acids
230-361 of Runx2 are required for this interaction, consistent with
the functional activity data (Fig. 8C). It was shown
previously that the runt homology domain (RHD) of Runx1 supports
interaction with C/EBP (13, 23). However, our Runx2 deletion
analysis reveals that the RHD of Runx2 is not sufficient for C/EBP
interaction (Fig. 8D). Our findings are consistent with the
recent co-crystal structure of the RHD with C/EBP (bZIP), which
demonstrates a lack of interaction of these two domains (56). Taken
together our results demonstrate that the synergism observed on the OC
promoter requires an interaction between Runx2 and C/EBP that involves
a region of Runx2 outside the DNA binding domain.
To establish that the Runx2-C/EBP protein-protein interaction can occur
when C/EBP proteins are bound to its regulatory element, we performed
gel mobility shift assays with the C/EBP motif of the OC promoter. We
compared nuclear extracts from HeLa cells lacking Runx2 and mature
osteoblasts, which contain both Runx and C/EBP factors (see Fig.
5A). We find similar C/EBP complexes formed with both
nuclear extracts; however, addition of antibody against Runx2 resulted
in a supershift only with the bone cell extracts. These results provide
evidence for a Runx2-C/EBP interaction that is independent of a Runx
DNA binding site.
 |
DISCUSSION |
Our studies demonstrate that the C/EBP transcription factors
support osteoblast-specific gene expression and may play an important regulatory role during osteoblast differentiation. C/EBP and - ,
but not C/EBP , are expressed in skeletal tissues and are developmentally regulated during osteoblast maturation. Vitamin D3, a positive regulator of osteoblast differentiation and
of the bone-specific osteocalcin gene, also increases expression of
C/EBP factors. We find that osteocalcin is a downstream C/EBP target
gene, strongly up-regulated in response to forced expression of C/EBP
family members. The level of enhancement is equivalent to that observed
for the bone-related Runx2 transcription factor. More importantly, we
also demonstrate that Runx2 and C/EBP and - functionally
cooperate for positive regulation of the OC gene and that the synergism
is mediated through a physical interaction between Runx and C/EBP at
the C/EBP element. We propose that C/EBP activity may be
physiologically relevant to the spatio-temporal regulation of
Runx2-dependent genes in mature osteoblasts.
Transcription of the OC gene is stringently regulated during osteoblast
differentiation (12), but the mechanisms involved have not been
completely elucidated. OC gene induction is coupled to a
post-proliferative increase in Runx2 DNA binding activity (29, 30).
However, Runx proteins are present in skeletal progenitor cells and
immature proliferating osteoblasts, in which OC gene expression is not
activated (29). Thus, other factors are contributing to strong
suppression of OC transcription in such cells, as well as to maximal
levels of OC expression in mature osteoblasts. Our studies indicate
that the activities of Runx proteins and transcriptional activation of
Runx-responsive genes during skeletal development may be regulated in
part by controlling cellular levels of Runx or C/EBP proteins and/or
functional cooperation between Runx and C/EBP transcription factors. In
support of this mechanism are the relative expression levels of each
factor during osteoblast differentiation. Although C/EBP and -
are present in proliferating osteoblasts (consistent with their role in
cell growth), the low Runx levels may be insufficient to produce a
synergistic effect. In contrast, when the cellular levels of both
factors are elevated during the mineralization stage, synergy may
account for the massive and tissue-specific induction of OC gene
expression. Notably, C/EBP expression is positively regulated by
Runx2 (46), which may provide the biological assurance of high C/EBP
levels during osteoblast differentiation when bone-specific gene
expression is required.
For definitive assessment of the contribution of Runx2 and C/EBP
proteins and their synergistic effect on the OC promoter, we carried
out studies not only in bone cells, but also in HeLa cells, which have
a zero background for Runx factors (55). Synergistic activation of the
OC promoter occurred only when both factors were expressed in HeLa
cells. This situation is analogous to mature osteoblasts, where both
proteins are maximally present. Based upon previous observations of the
critical role of the Runx site in maintaining active chromatin
conformation of the OC promoter (36), we anticipated that synergism
would involve the Runx element located 30 bp upstream of the C/EBP
site. Our transient transfection studies of the OC promoter with
mutated elements indicate a role for the C/EBP element in mediating
synergistic activation with Runx2. However, these studies do not
exclude the contribution of the Runx2 binding site to regulation of OC
transcription in osteoblasts.
The mechanisms by which C/EBP and Runx factors together result in a
synergistic activation of tissue-specific genes may involve modifications in chromatin structure. Several studies have shown that
the Runx and C/EBP classes of transcription factors can each form
regulatory complexes with proteins that influence chromatin remodeling.
Runx factors facilitate the formation and maintenance of
transcriptionally active chromatin (36, 57-60) and are known to
interact with co-regulatory proteins possessing histone
acetyltransferase (40) or histone deacetylase activity (57, 61). Recent
studies from our laboratories indicate that Runx factors regulate
tissue-specific and vitamin D-mediated gene expression of osteocalcin
by modifying chromatin organization (36). More importantly, C/EBP
has recently been shown to recruit the SWI/SNF complex to modify
chromatin and regulate transcription of myeloid genes (41). Numerous
studies have established that chromatin remodeling and modifications in nucleosomal organization are necessary for bone-specific activation of
the osteocalcin gene (36, 62-64). Hence, C/EBP-dependent
Runx synergism during development of the osteoblast phenotype may
result from temporal modifications in the chromatin-related
interactions among C/EBP, Runx, SWI/SNF, and/or other components of the
nuclear architecture.
In summary, the data presented here address the mechanisms critical for
the robust activation of the osteocalcin gene during osteoblast
differentiation. Our studies indicate that these mechanisms require a
C/EBP response element and synergism of C/EBP and Runx factors that may
be facilitated by their regulated levels of expression in mature
osteoblasts. The concept that lineage-specific gene expression depends
on the combination of factors, rather than being controlled by a single
master regulator, is reinforced by these studies.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants DE12528, AR39588, and AR45689.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Both authors contributed equally to this study.
To whom correspondence should be addressed: Dept. of Cell
Biology, University of Massachusetts Medical School, 55 Lake Ave. N.,
Worcester, MA 01655-0106. Tel.: 508-856-5625; Fax: 508-856-6800; E-mail: jane.lian@umassmed.edu.
Published, JBC Papers in Press, October 19, 2001, DOI 10.1074/jbc.M106611200
 |
ABBREVIATIONS |
The abbreviations used are:
C/EBP, CCAAT/enhancer-binding protein;
OC, osteocalcin;
CAT, chloramphenicol
acetyltransferase;
ROS, rat osteosarcoma;
RSV, Rous sarcoma virus;
RHD, runt homology domain.
 |
REFERENCES |
| 1.
|
Lekstrom-Himes, J.,
and Xanthopoulos, K. G.
(1998)
J. Biol. Chem.
273,
28545-28548
|
| 2.
|
Alam, T., An, M. R.,
and Papaconstantinou, J.
(1992)
J. Biol. Chem.
267,
5021-5024
|
| 3.
|
Antonson, P.,
and Xanthopoulos, K. G.
(1995)
Biochem. Biophys. Res. Commun.
215,
106-113
|
| 4.
|
Birkenmeier, E. H.,
Gwynn, B.,
Howard, S.,
Jerry, J.,
Gordon, J. I.,
Landschulz, W. H.,
and McKnight, S. L.
(1989)
Genes Dev.
3,
1146-1156
|
| 5.
|
Morosetti, R.,
Park, D. J.,
Chumakov, A. M.,
Grillier, I.,
Shiohara, M.,
Gombart, A. F.,
Nakamaki, T.,
Weinberg, K.,
and Koeffler, H. P.
(1997)
Blood
90,
2591-2600
|
| 6.
|
Wang, N. D.,
Finegold, M. J.,
Bradley, A., Ou, C. N.,
Abdelsayed, S. V.,
Wilde, M. D.,
Taylor, L. R.,
Wilson, D. R.,
and Darlington, G. J.
(1995)
Science
269,
1108-1112
|
| 7.
|
Yamanaka, R.,
Kim, G. D.,
Radomska, H. S.,
Lekstrom-Himes, J.,
Smith, L. T.,
Antonson, P.,
Tenen, D. G.,
and Xanthopoulos, K. G.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6462-6467
|
| 8.
|
Lopez-Rodriguez, C.,
Botella, L.,
and Corbi, A. L.
(1997)
J. Biol. Chem.
272,
29120-29126
|
| 9.
|
Oelgeschlager, M.,
Nuchprayoon, I.,
Luscher, B.,
and Friedman, A. D.
(1996)
Mol. Cell. Biol.
16,
4717-4725
|
| 10.
|
Shuman, J. D.,
Cheong, J.,
and Coligan, J. E.
(1997)
J. Biol. Chem.
272,
12793-12800
|
| 11.
|
Spiegelman, B. M.,
Puigserver, P.,
and Wu, Z.
(2000)
Int. J Obes. Relat. Metab. Disord.
24 Suppl. 4,
S8-S10
|
| 12.
|
Stein, G. S.,
and Lian, J. B.
(1993)
Endocr. Rev.
14,
424-442
|
| 13.
|
Zhang, D. E.,
Hetherington, C. J.,
Meyers, S.,
Rhoades, K. L.,
Larson, C. J.,
Chen, H. M.,
Hiebert, S. W.,
and Tenen, D. G.
(1996)
Mol. Cell. Biol.
16,
1231-1240
|
| 14.
|
Zhang, D. E.,
Hohaus, S.,
Voso, M. T.,
Chen, H. M.,
Smith, L. T.,
Hetherington, C. J.,
and Tenen, D. G.
(1996)
Curr. Top. Microbiol. Immunol.
211,
137-147
|
| 15.
|
Tanaka, T.,
Akira, S.,
Yoshida, K.,
Umemoto, M.,
Yoneda, Y.,
Shirafuji, N.,
Fujiwara, H.,
Suematsu, S.,
Yoshida, N.,
and Kishimoto, T.
(1995)
Cell
80,
353-361
|
| 16.
|
Sterneck, E.,
Tessarollo, L.,
and Johnson, P. F.
(1997)
Genes Dev.
11,
2153-2162
|
| 17.
|
Tanaka, T.,
Yoshida, N.,
Kishimoto, T.,
and Akira, S.
(1997)
EMBO J.
16,
7432-7443
|
| 18.
|
Gabbitas, B.,
and Canalis, E.
(1998)
Am. J. Physiol.
275,
E222-E228
|
| 19.
|
Umayahara, Y., Ji, C.,
Centrella, M.,
Rotwein, P.,
and McCarthy, T. L.
(1997)
J. Biol. Chem.
272,
31793-31800
|
| 20.
|
Harrison, J. R.,
Kelly, P. L.,
and Pilbeam, C. C.
(2000)
J. Bone Miner. Res.
15,
1138-1146
|
| 21.
|
Attard, F. A.,
Wang, L.,
Potter, J. J.,
Rennie-Tankersley, L.,
and Mezey, E.
(2000)
Arch. Biochem. Biophys.
378,
57-64
|
| 22.
|
Ogasawara, A.,
Arakawa, T.,
Kaneda, T.,
Takuma, T.,
Sato, T.,
Kaneko, H.,
Kumegawa, M.,
and Hakeda, Y.
(2001)
J. Biol. Chem.
276,
7048-7054
|
| 23.
|
Petrovick, M. S.,
Hiebert, S. W.,
Friedman, A. D.,
Hetherington, C. J.,
Tenen, D. G.,
and Zhang, D. E.
(1998)
Mol. Cell. Biol.
18,
3915-3925
|
| 24.
|
Okuda, T.,
van Deursen, J.,
Hiebert, S. W.,
Grosveld, G.,
and Downing, J. R.
(1996)
Cell
84,
321-330
|
| 25.
|
Speck, N. A.,
Stacy, T.,
Wang, Q.,
North, T., Gu, T. L.,
Miller, J.,
Binder, M.,
and Marin-Padilla, M.
(1999)
Cancer Res.
59,
1789s-1793s
|
| 26.
|
Wang, Q.,
Stacy, T.,
Miller, J. D.,
Lewis, A. F., Gu, T. L.,
Huang, X.,
Bushweller, J. H.,
Bories, J. C.,
Alt, F. W.,
Ryan, G.,
Liu, P. P.,
Wynshaw-Boris, A.,
Binder, M.,
Marin-Padilla, M.,
Sharpe, A. H.,
and Speck, N. A.
(1996)
Cell
87,
697-708
|
| 27.
|
Komori, T.,
Yagi, H.,
Nomura, S.,
Yamaguchi, A.,
Sasaki, K.,
Deguchi, K.,
Shimizu, Y.,
Bronson, R. T.,
Gao, Y.-H.,
Inada, M.,
Sato, M.,
Okamoto, R.,
Kitamura, Y.,
Yoshiki, S.,
and Kishimoto, T.
(1997)
Cell
89,
755-764
|
| 28.
|
Mundlos, S.,
Otto, F.,
Mundlos, C.,
Mulliken, J. B.,
Aylsworth, A. S.,
Albright, S.,
Lindhout, D.,
Cole, W. G.,
Henn, W.,
Knoll, J. H. M.,
Owen, M. J.,
Mertelsmann, R.,
Zabel, B. U.,
and Olsen, B. R.
(1997)
Cell
89,
773-779
|
| 29.
|
Banerjee, C.,
McCabe, L. R.,
Choi, J.-Y.,
Hiebert, S. W.,
Stein, J. L.,
Stein, G. S.,
and Lian, J. B.
(1997)
J. Cell. Biochem.
66,
1-8
|
| 30.
|
Ducy, P.,
Zhang, R.,
Geoffroy, V.,
Ridall, A. L.,
and Karsenty, G.
(1997)
Cell
89,
747-754
|
| 31.
|
Javed, A.,
Barnes, G. L.,
Jassanya, B. O.,
Stein, J. L.,
Gerstenfeld, L.,
Lian, J. B.,
and Stein, G. S.
(2001)
Mol. Cell. Biol.
21,
2891-2905
|
| 32.
|
Otto, F.,
Thornell, A. P.,
Crompton, T.,
Denzel, A.,
Gilmour, K. C.,
Rosewell, I. R.,
Stamp, G. W. H.,
Beddington, R. S. P.,
Mundlos, S.,
Olsen, B. R.,
Selby, P. B.,
and Owen, M. J.
(1997)
Cell
89,
765-771
|
| 33.
|
Jimenez, M. J.,
Balbin, M.,
Lopez, J. M.,
Alvarez, J.,
Komori, T.,
and Lopez-Otin, C.
(1999)
Mol. Cell. Biol.
19,
4431-4442
|
| 34.
|
Ji, C.,
Casinghino, S.,
Chang, D. J.,
Chen, Y.,
Javed, A.,
Ito, Y.,
Hiebert, S. W.,
Lian, J. B.,
Stein, G. S.,
McCarthy, T. L.,
and Centrella, M.
(1998)
J. Cell. Biochem.
69,
353-363
|
| 35.
|
Sato, M.,
Morii, E.,
Komori, T.,
Kawahata, H.,
Sugimoto, M.,
Terai, K.,
Shimizu, H.,
Yasui, T.,
Ogihara, H.,
Yasui, N.,
Ochi, T.,
Kitamura, Y.,
Ito, Y.,
and Nomura, S.
(1998)
Oncogene
17,
1517-1525
|
| 36.
|
Javed, A.,
Gutierrez, S.,
Montecino, M.,
van Wijnen, A. J.,
Stein, J. L.,
Stein, G. S.,
and Lian, J. B.
(1999)
Mol. Cell. Biol.
19,
7491-7500
|
| 37.
|
Frendo, J. L.,
Xiao, G.,
Fuchs, S.,
Franceschi, R. T.,
Karsenty, G.,
and Ducy, P.
(1998)
J. Biol. Chem.
273,
30509-30516
|
| 38.
|
Hoffmann, H. M.,
Beumer, T. L.,
Rahman, S.,
McCabe, L. R.,
Banerjee, C.,
Aslam, F.,
Tiro, J. A.,
van Wijnen, A. J.,
Stein, J. L.,
Stein, G. S.,
and Lian, J. B.
(1996)
J. Cell. Biochem.
61,
310-324
|
| 39.
|
Graves, B. J.
(1998)
Science
279,
1000-1002
|
| 40.
|
Kitabayashi, I.,
Yokoyama, A.,
Shimizu, K.,
and Ohki, M.
(1998)
EMBO J.
17,
2994-3004
|
| 41.
|
Kowenz-Leutz, E.,
and Leutz, A.
(1999)
Mol. Cell
4,
735-743
|
| 42.
|
Sun, W.,
Graves, B. J.,
and Speck, N. A.
(1995)
J. Virol.
69,
4941-4949
|
| 43.
|
Zaiman, A. L.,
and Lenz, J.
(1996)
J. Virol.
70,
5618-5629
|
| 44.
|
Gu, T. L.,
Goetz, T. L.,
Graves, B. J.,
and Speck, N. A.
(2000)
Mol. Cell. Biol.
20,
91-103
|
| 45.
|
Rosen, E. D.,
Walkey, C. J.,
Puigserver, P.,
and Spiegelman, B. M.
(2000)
Genes Dev.
14,
1293-1307
|
| 46.
|
McCarthy, T. L., Ji, C.,
Chen, Y.,
Kim, K. K.,
Imagawa, M.,
Ito, Y.,
and Centrella, M.
(2000)
J. Biol. Chem.
275,
21746-21753
|
| 47.
|
Banerjee, C.,
Stein, J. L.,
van Wijnen, A. J.,
Frenkel, B.,
Lian, J. B.,
and Stein, G. S.
(1996)
Endocrinology
137,
1991-2000
|
| 48.
|
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Struhl, K.
(1997)
Current Protocols in Molecular Biology
, pp. 8.5.1-8.5.9, John Wiley & Sons, New York
|
| 49.
|
Owen, T. A.,
Aronow, M.,
Shalhoub, V.,
Barone, L. M.,
Wilming, L.,
Tassinari, M. S.,
Kennedy, M. B.,
Pockwinse, S.,
Lian, J. B.,
and Stein, G. S.
(1990)
J. Cell. Physiol.
143,
420-430
|
| 50.
|
Javed, A.,
Guo, B.,
Hiebert, S.,
Choi, J.-Y.,
Green, J.,
Zhao, S.-C.,
Osborne, M. A.,
Stifani, S.,
Stein, J. L.,
Lian, J. B.,
van Wijnen, A. J.,
and Stein, G. S.
(2000)
J. Cell Sci.
113,
2221-2231
|
| 51.
|
Chomczynski, P.,
and Sacchi, N.
(1987)
Anal. Biochem.
162,
156-159
|
| 52.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489
|
| 53.
|
Lian, J. B.,
Stein, G. S.,
Stein, J. L.,
and van Wijnen, A. J.
(1999)
in
Vitamins and Hormones
(Litwack, G., ed)
, pp. 443-509, Academic Press, San Diego
|
| 54.
|
Hoffmann, H.,
Green, J.,
van Wijnen, A. J.,
Stein, J. L.,
Stein, G. S.,
and Lian, J. B.
(2000)
J. Cell. Biochem.
80,
156-168
|
| 55.
|
Armesilla, A. L.,
Calvo, D.,
and Vega, M. A.
(1996)
J. Biol. Chem.
271,
7781-7787
|
| 56.
|
Tahirov, T. H.,
Inoue-Bungo, T.,
Morii, H.,
Fujikawa, A.,
Sasaki, M.,
Kimura, K.,
Shiina, M.,
Sato, K.,
Kumasaka, T.,
Yamamoto, M.,
Ishii, S.,
and Ogata, K.
(2001)
Cell
104,
755-767
|
| 57.
|
Lutterbach, B.,
Westendorf, J. J.,
Linggi, B.,
Patten, A.,
Moniwa, M.,
Davie, J. R.,
Huynh, K. D.,
Bardwell, V. J.,
Lavinsky, R. M.,
Rosenfeld, M. G.,
Glass, C.,
Seto, E.,
and Hiebert, S. W.
(1998)
Mol. Cell. Biol.
18,
7176-7184
|
| 58.
|
Guo, B.,
Odgren, P. R.,
van Wijnen, A. J.,
Last, T. J.,
Nickerson, J.,
Penman, S.,
Lian, J. B.,
Stein, J. L.,
and Stein, G. S.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
10526-10530
|
| 59.
|
Zeng, C.,
McNeil, S.,
Pockwinse, S.,
Nickerson, J. A.,
Shopland, L.,
Lawrence, J. B.,
Penman, S.,
Hiebert, S. W.,
Lian, J. B.,
van Wijnen, A. J.,
Stein, J. L.,
and Stein, G. S.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
1585-1589
|
| 60.
|
Lian, J. B.,
Stein, J. L.,
Stein, G. S.,
Montecino, M.,
van Wijnen, A. J.,
Javed, A.,
and Gutierrez, S.
(2001)
Steroids
66,
159-170
|
| 61.
|
Chen, G.,
Fernandez, J.,
Mische, S.,
and Courey, A. J.
(1999)
Genes Dev.
13,
2218-2230
|
| 62.
|
Montecino, M.,
Lian, J.,
Stein, G.,
and Stein, J.
(1996)
Biochemistry
35,
5093-5102
|
| 63.
|
Montecino, M.,
Frenkel, B.,
van Wijnen, A. J.,
Lian, J. B.,
Stein, G. S.,
and Stein, J. L.
(1999)
Biochemistry
38,
1338-1345
|
| 64.
|
Montecino, M.,
van Wijnen, A. J.,
Lian, J. B.,
Stein, J. L.,
and Stein, G. S.
(1999)
J. Cell. Biochem.
72,
586-594
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Liu, E.-S. Park, and M. Jo
Runt-Related Transcription Factor 1 Regulates Luteinized Hormone-Induced Prostaglandin-Endoperoxide Synthase 2 Expression in Rat Periovulatory Granulosa Cells
Endocrinology,
July 1, 2009;
150(7):
3291 - 3300.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Zanotti, L. Stadmeyer, A. Smerdel-Ramoya, D. Durant, and E. Canalis
Misexpression of CCAAT/enhancer binding protein beta causes osteopenia
J. Endocrinol.,
May 1, 2009;
201(2):
263 - 274.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Moenning, R. Jager, A. Egert, W. Kress, E. Wardelmann, and H. Schorle
Sustained Platelet-Derived Growth Factor Receptor {alpha} Signaling in Osteoblasts Results in Craniosynostosis by Overactivating the Phospholipase C-{gamma} Pathway
Mol. Cell. Biol.,
February 1, 2009;
29(3):
881 - 891.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dhawan, R. Weider, and S. Christakos
CCAAT Enhancer-binding Protein {alpha} Is a Molecular Target of 1,25-Dihydroxyvitamin D3 in MCF-7 Breast Cancer Cells
J. Biol. Chem.,
January 30, 2009;
284(5):
3086 - 3095.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tominaga, S. Maeda, M. Hayashi, S. Takeda, S. Akira, S. Komiya, T. Nakamura, H. Akiyama, and T. Imamura
CCAAT/Enhancer-binding Protein {beta} Promotes Osteoblast Differentiation by Enhancing Runx2 Activity with ATF4
Mol. Biol. Cell,
December 1, 2008;
19(12):
5373 - 5386.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-Y. Ko, H.-C. Hsu, M.-R. Shen, W.-C. Chang, and J.-M. Wang
Epigenetic Silencing of CCAAT/Enhancer-binding Protein {delta} Activity by YY1/Polycomb Group/DNA Methyltransferase Complex
J. Biol. Chem.,
November 7, 2008;
283(45):
30919 - 30932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. V. Arcidiacono, T. Sato, D. Alvarez-Hernandez, J. Yang, M. Tokumoto, I. Gonzalez-Suarez, Y. Lu, Y. Tominaga, J. Cannata-Andia, E. Slatopolsky, et al.
EGFR Activation Increases Parathyroid Hyperplasia and Calcitriol Resistance in Kidney Disease
J. Am. Soc. Nephrol.,
February 1, 2008;
19(2):
310 - 320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. E. Pennini, Y. Liu, J. Yang, C. M. Croniger, W. H. Boom, and C. V. Harding
CCAAT/Enhancer-Binding Protein beta and {delta} Binding to CIITA Promoters Is Associated with the Inhibition of CIITA Expression in Response to Mycobacterium tuberculosis 19-kDa Lipoprotein
J. Immunol.,
November 15, 2007;
179(10):
6910 - 6918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Aubin, R. Bouillon, T. A. Guise, and I. R. Reid
Meeting Report from the 17th Scientific Meeting of the International Bone and Mineral Society: June 24-29, 2007 in Montreal, Quebec, Canada
IBMS BoneKEy,
November 1, 2007;
4(11):
299 - 313.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Wiper-Bergeron, C. St-Louis, and J. M. Lee
CCAAT/Enhancer Binding Protein {beta} Abrogates Retinoic Acid-Induced Osteoblast Differentiation via Repression of Runx2 Transcription
Mol. Endocrinol.,
September 1, 2007;
21(9):
2124 - 2135.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Luan, X.-P. Yu, K. Xu, B. Ding, J. Yu, Y. Huang, N. Yang, P. Lengyel, P. E. Di Cesare, and C.-j. Liu
The Retinoblastoma Protein Is an Essential Mediator of Osteogenesis That Links the p204 Protein to the Cbfa1 Transcription Factor Thereby Increasing Its Activity
J. Biol. Chem.,
June 8, 2007;
282(23):
16860 - 16870.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Q. Hassan, R. Tare, S. H. Lee, M. Mandeville, B. Weiner, M. Montecino, A. J. van Wijnen, J. L. Stein, G. S. Stein, and J. B. Lian
HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes
Mol. Cell. Biol.,
May 1, 2007;
27(9):
3337 - 3352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Broderick, T. Zhang, H. Rangaswami, Y. Zeng, X. Zhao, G. R. Boss, and R. B. Pilz
Guanosine 3',5'-Cyclic Monophosphate (cGMP)/cGMP-Dependent Protein Kinase Induce Interleukin-6 Transcription in Osteoblasts
Mol. Endocrinol.,
May 1, 2007;
21(5):
1148 - 1162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gutierrez, R. Paredes, F. Cruzat, D. A. Hill, A. J. van Wijnen, J. B. Lian, G. S. Stein, J. L. Stein, A. N. Imbalzano, and M. Montecino
Chromatin Remodeling by SWI/SNF Results in Nucleosome Mobilization to Preferential Positions in the Rat Osteocalcin Gene Promoter
J. Biol. Chem.,
March 30, 2007;
282(13):
9445 - 9457.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Villagra, F. Cruzat, L. Carvallo, R. Paredes, J. Olate, A. J. van Wijnen, G. S. Stein, J. B. Lian, J. L. Stein, A. N. Imbalzano, et al.
Chromatin Remodeling and Transcriptional Activity of the Bone-specific Osteocalcin Gene Require CCAAT/Enhancer-binding Protein beta-dependent Recruitment of SWI/SNF Activity
J. Biol. Chem.,
August 11, 2006;
281(32):
22695 - 22706.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Shirakawa, S. Maeda, T. Gotoh, M. Hayashi, K. Shinomiya, S. Ehata, R. Nishimura, M. Mori, K. Onozaki, H. Hayashi, et al.
CCAAT/Enhancer-Binding Protein Homologous Protein (CHOP) Regulates Osteoblast Differentiation.
Mol. Cell. Biol.,
August 1, 2006;
26(16):
6105 - 6116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Shin, M. J. Jeon, J.-Y. Yang, S.-J. Her, D. Kim, S. W. Kim, and S. Y. Kim
CCAAT/enhancer-binding protein {delta} activates the Runx2-mediated transcription of mouse osteocalcin II promoter.
J. Mol. Endocrinol.,
June 1, 2006;
36(3):
531 - 546.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. Phillips, C. A. Gersbach, A. M. Wojtowicz, and A. J. Garcia
Glucocorticoid-induced osteogenesis is negatively regulated by Runx2/Cbfa1 serine phosphorylation
J. Cell Sci.,
February 1, 2006;
119(3):
581 - 591.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Zhao, S. Zhuang, Y. Chen, G. R. Boss, and R. B. Pilz
Cyclic GMP-dependent Protein Kinase Regulates CCAAT Enhancer-binding Protein {beta} Functions through Inhibition of Glycogen Synthase Kinase-3
J. Biol. Chem.,
September 23, 2005;
280(38):
32683 - 32692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Dusso, A. J. Brown, and E. Slatopolsky
Vitamin D
Am J Physiol Renal Physiol,
July 1, 2005;
289(1):
F8 - F28.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. R. Harrison, Y.-F. Huang, K. A. Wilson, P. L. Kelly, D. J. Adams, G. A. Gronowicz, and S. H. Clark
Col1a1 Promoter-targeted Expression of p20 CCAAT Enhancer-binding Protein {beta} (C/EBP{beta}), a Truncated C/EBP{beta} Isoform, Causes Osteopenia in Transgenic Mice
J. Biol. Chem.,
March 4, 2005;
280(9):
8117 - 8124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hata, R. Nishimura, M. Ueda, F. Ikeda, T. Matsubara, F. Ichida, K. Hisada, T. Nokubi, A. Yamaguchi, and T. Yoneda
A CCAAT/Enhancer Binding Protein {beta} Isoform, Liver-Enriched Inhibitory Protein, Regulates Commitment of Osteoblasts and Adipocytes
Mol. Cell. Biol.,
March 1, 2005;
25(5):
1971 - 1979.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Javed, G. L. Barnes, J. Pratap, T. Antkowiak, L. C. Gerstenfeld, A. J. van Wijnen, J. L. Stein, J. B. Lian, and G. S. Stein
Impaired intranuclear trafficking of Runx2 (AML3/CBFA1) transcription factors in breast cancer cells inhibits osteolysis in vivo
PNAS,
February 1, 2005;
102(5):
1454 - 1459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-j. Liu, E. Chang, J. Yu, C. S. Carlson, L. Prazak, X.-P. Yu, B. Ding, P. Lengyel, and P. E. D. Cesare
The Interferon-inducible p204 Protein Acts as a Transcriptional Coactivator of Cbfa1 and Enhances Osteoblast Differentiation
J. Biol. Chem.,
January 28, 2005;
280(4):
2788 - 2796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Dhawan, X. Peng, A. L. M. Sutton, P. N. MacDonald, C. M. Croniger, C. Trautwein, M. Centrella, T. L. McCarthy, and S. Christakos
Functional Cooperation between CCAAT/Enhancer-Binding Proteins and the Vitamin D Receptor in Regulation of 25-Hydroxyvitamin D3 24-Hydroxylase
Mol. Cell. Biol.,
January 1, 2005;
25(1):
472 - 487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Narayanan, A. Ramachandran, M. C. Peterson, J. Hao, A.-B. Kolsto, A. D. Friedman, and A. George
The CCAAT Enhancer-binding Protein (C/EBP){beta} and Nrf1 Interact to Regulate Dentin Sialophosphoprotein (DSPP) Gene Expression during Odontoblast Differentiation
J. Biol. Chem.,
October 29, 2004;
279(44):
45423 - 45432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Paredes, G. Arriagada, F. Cruzat, A. Villagra, J. Olate, K. Zaidi, A. van Wijnen, J. B. Lian, G. S. Stein, J. L. Stein, et al.
Bone-Specific Transcription Factor Runx2 Interacts with the 1{alpha},25-Dihydroxyvitamin D3 Receptor To Up-Regulate Rat Osteocalcin Gene Expression in Osteoblastic Cells
Mol. Cell. Biol.,
October 15, 2004;
24(20):
8847 - 8861.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Q. Hassan, A. Javed, M. I. Morasso, J. Karlin, M. Montecino, A. J. van Wijnen, G. S. Stein, J. L. Stein, and J. B. Lian
Dlx3 Transcriptional Regulation of Osteoblast Differentiation: Temporal Recruitment of Msx2, Dlx3, and Dlx5 Homeodomain Proteins to Chromatin of the Osteocalcin Gene
Mol. Cell. Biol.,
October 15, 2004;
24(20):
9248 - 9261.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Gutierrez, J. Liu, A. Javed, M. Montecino, G. S. Stein, J. B. Lian, and J. L. Stein
The Vitamin D Response Element in the Distal Osteocalcin Promoter Contributes to Chromatin Organization of the Proximal Regulatory Domain
J. Biol. Chem.,
October 15, 2004;
279(42):
43581 - 43588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Chang, A. Rewari, M. Centrella, and T. L. McCarthy
Fos-related Antigen 2 Controls Protein Kinase A-induced CCAAT/Enhancer-binding Protein {beta} Expression in Osteoblasts
J. Biol. Chem.,
October 8, 2004;
279(41):
42438 - 42444.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. L. Barnes, K. E. Hebert, M. Kamal, A. Javed, T. A. Einhorn, J. B. Lian, G. S. Stein, and L. C. Gerstenfeld
Fidelity of Runx2 Activity in Breast Cancer Cells Is Required for the Generation of Metastases-Associated Osteolytic Disease
Cancer Res.,
July 1, 2004;
64(13):
4506 - 4513.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Sevetson, S. Taylor, and Y. Pan
Cbfa1/RUNX2 Directs Specific Expression of the Sclerosteosis Gene (SOST)
J. Biol. Chem.,
April 2, 2004;
279(14):
13849 - 13858.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kveiborg, G. Sabatakos, R. Chiusaroli, M. Wu, W. M. Philbrick, W. C. Horne, and R. Baron
{Delta}FosB Induces Osteosclerosis and Decreases Adipogenesis by Two Independent Cell-Autonomous Mechanisms
Mol. Cell. Biol.,
April 1, 2004;
24(7):
2820 - 2830.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. C. Pereira, A. M. Delany, and E. Canalis
CCAAT/Enhancer Binding Protein Homologous Protein (DDIT3) Induces Osteoblastic Cell Differentiation
Endocrinology,
April 1, 2004;
145(4):
1952 - 1960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS
J. Biol. Chem.,
February 13, 2004;
279(7):
5329 - 5337.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Fux, B. Mitta, B. P. Kramer, and M. Fussenegger
Dual-regulated expression of C/EBP-{alpha} and BMP-2 enables differential differentiation of C2C12 cells into adipocytes and osteoblasts
Nucleic Acids Res.,
January 2, 2004;
32(1):
e1 - e1.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Enomoto, S. Shiojiri, K. Hoshi, T. Furuichi, R. Fukuyama, C. A. Yoshida, N. Kanatani, R. Nakamura, A. Mizuno, A. Zanma, et al.
Induction of Osteoclast Differentiation by Runx2 through Receptor Activator of Nuclear Factor-{kappa}B Ligand (RANKL) and Osteoprotegerin Regulation and Partial Rescue of Osteoclastogenesis in Runx2-/- Mice by RANKL Transgene
J. Biol. Chem.,
June 20, 2003;
278(26):
23971 - 23977.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, S. Zhuang, S. Cassenaer, D. E. Casteel, T. Gudi, G. R. Boss, and R. B. Pilz
Synergism between Calcium and Cyclic GMP in Cyclic AMP Response Element-Dependent Transcriptional Regulation Requires Cooperation between CREB and C/EBP-{beta}
Mol. Cell. Biol.,
June 15, 2003;
23(12):
4066 - 4082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Homme, C. P. Schmitt, R. Himmele, G. F. Hoffmann, O. Mehls, and F. Schaefer
Vitamin D and Dexamethasone Inversely Regulate Parathyroid Hormone-Induced Regulator of G Protein Signaling-2 Expression in Osteoblast-Like Cells
Endocrinology,
June 1, 2003;
144(6):
2496 - 2504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. M. Delany, I. Kalajzic, A. D. Bradshaw, E. H. Sage, and E. Canalis
Osteonectin-Null Mutation Compromises Osteoblast Formation, Maturation, and Survival
Endocrinology,
June 1, 2003;
144(6):
2588 - 2596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Stock, H. Schafer, S. Stricker, G. Gross, S. Mundlos, and F. Otto
Expression of Galectin-3 in Skeletal Tissues Is Controlled by Runx2
J. Biol. Chem.,
May 2, 2003;
278(19):
17360 - 17367.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Sierra, A. Villagra, R. Paredes, F. Cruzat, S. Gutierrez, A. Javed, G. Arriagada, J. Olate, M. Imschenetzky, A. J. van Wijnen, et al.
Regulation of the Bone-Specific Osteocalcin Gene by p300 Requires Runx2/Cbfa1 and the Vitamin D3 Receptor but Not p300 Intrinsic Histone Acetyltransferase Activity
Mol. Cell. Biol.,
May 1, 2003;
23(9):
3339 - 3351.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Hu, E. Chan, S. X. Wang, and B. Li
Activation of p38 Mitogen-Activated Protein Kinase Is Required for Osteoblast Differentiation
Endocrinology,
May 1, 2003;
144(5):
2068 - 2074.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Canalis, A. N. Economides, and E. Gazzerro
Bone Morphogenetic Proteins, Their Antagonists, and the Skeleton
Endocr. Rev.,
April 1, 2003;
24(2):
218 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Canon and U. Banerjee
In vivo analysis of a developmental circuit for direct transcriptional activation and repression in the same cell by a Runx protein
Genes & Dev.,
April 1, 2003;
17(7):
838 - 843.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Cui, L. F. Cooper, X. Yang, G. Karsenty, and I. Aukhil
Transcriptional Coactivation of Bone-Specific Transcription Factor Cbfa1 by TAZ
Mol. Cell. Biol.,
February 1, 2003;
23(3):
1004 - 1013.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H.-J. Kim, J.-H. Kim, S.-C. Bae, J.-Y. Choi, H.-J. Kim, and H.-M. Ryoo
The Protein Kinase C Pathway Plays a Central Role in the Fibroblast Growth Factor-stimulated Expression and Transactivation Activity of Runx2
J. Biol. Chem.,
January 3, 2003;
278(1):
319 - 326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Okazaki, J. Li, H. Yu, N. Fukui, and L. J. Sandell
CCAAT/Enhancer-binding Proteins beta and delta Mediate the Repression of Gene Transcription of Cartilage-derived Retinoic Acid-sensitive Protein Induced by Interleukin-1beta
J. Biol. Chem.,
August 23, 2002;
277(35):
31526 - 31533.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-J. Shen, T. Nakamoto, K. Tsuji, A. Nifuji, K. Miyazono, T. Komori, H. Hirai, and M. Noda
Negative Regulation of Bone Morphogenetic Protein/Smad Signaling by Cas-interacting Zinc Finger Protein in Osteoblasts
J. Biol. Chem.,
August 9, 2002;
277(33):
29840 - 29846.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|