JBC Focus on PI3-Kinase with Echelon

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M106375200 on October 29, 2001

J. Biol. Chem., Vol. 277, Issue 2, 1324-1331, January 11, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/2/1324    most recent
M106375200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zaghini, I.
Right arrow Articles by Besnard, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zaghini, I.
Right arrow Articles by Besnard, P.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Sterol Regulatory Element-binding Protein-1c Is Responsible for Cholesterol Regulation of Ileal Bile Acid-binding Protein Gene in Vivo

POSSIBLE INVOLVEMENT OF LIVER-X-RECEPTOR*

Isabelle ZaghiniDagger §, Jean-François LandrierDagger §, Jacques GroberDagger , Stéphane Krief, Stacey A. Jones||, Marie-Claude MonnotDagger , Isabelle Lefrère, Michael A. Watson||, Jon L. Collins**, Hiroshi FujiiDagger Dagger , and Philippe BesnardDagger §§

From the Dagger  Physiologie de la Nutrition, Ecole Nationale Supérieure de Biologie Appliquée à la Nutrition et à l'Alimentation (ENSBANA), FRE 2049 CNRS/Université de Bourgogne, F-21000, Dijon, France,  Bioprojet Biotech, 4, rue du Chesnay-Beauregard F-35760 Saint Grégoire, France, || Systems Research, GlaxoSmithKline Research and Development, Research Triangle Park, North Carolina 27709, ** Medicinal Chemistry, GlaxoSmithKline Research and Development, Research Triangle Park, North Carolina 27709, the Dagger Dagger  Department of Biochemistry, Niigata University School of Medecine, 1-757 Asahimashi-dori, Niigata 951, Japan

Received for publication, July 9, 2001, and in revised form, October 19, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Ileal bile acid-binding protein (I-BABP) is a cytosolic protein that binds bile acid (BA) specifically. In the ileum, it is thought to be implied in their enterohepatic circulation. Because the fecal excretion of BA represents the main physiological way of elimination for cholesterol (CS), the I-BABP gene could have a major function in CS homeostasis. Therefore, the I-BABP gene expression might be controlled by CS. I-BABP mRNA levels were significatively increased when the human enterocyte-like CaCo-2 cells were CS-deprived and repressed when CS were added to the medium. A highly conserved sterol regularory element-like sequence (SRE) and a putative GC box were found in human I-BABP gene promoter. Different constructs of human I-BABP promoter, cloned upstream of a chloramphenicol acetyltransferase (CAT) reporter gene, have been used in transfections studies. CAT activity of the wild type promoter was increased in presence of CS-deprived medium, and conversely, decreased by a CS-supplemented medium. The inductive effect of CS depletion was fully abolished when the putative SRE sequence and/or GC box were mutated or deleted. Co-transfections experiments with the mature isoforms of human sterol responsive element-binding proteins (SREBPs) and Sp1 demonstrate that the CS-mediated regulation of I-BABP gene was dependent of these transcriptional factors. Paradoxically, mice subjected to a standard chow supplemented with 2% CS for 14 days exhibited a significant rise in both I-BABP and SREBP1c mRNA levels. We show that in vivo, this up-regulation could be explained by a recently described regulatory pathway involving a positive regulation of SREBP1c by liver-X-receptor following a high CS diet.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cholesterol (CS)1 exerts essential physiological functions as a constituent of biological membranes and precursor of steroid hormones and bile acids (BAs). CS balance is the result of an equilibrium between dietary and biliary CS absorption, cellular de novo synthesis, and hepatic catabolism into BAs. A dysregulation of these input and output pathways produces metabolic disorders leading to gallstones formation and the development of atherosclerosis. Molecular mechanisms contributing to CS homeostasis are progressively elucidated. They are supported by a set of transcriptional factors directly activated by both CS and its metabolic derivatives, BA and oxysterols. CS modulates the transcription rate of target genes through the action of specific transcriptional factors termed sterol regulatory element-binding proteins (SREBPs) (1). In contrast to the other members of the basic helix-loop-helix zipper family, SREBPs are synthesized as inactive precursors bound to endoplasmic reticulum membrane and nucleus envelope. In cultured cells, CS depletion triggers the proteolytic release of an active NH2-terminal domain, which after translocation into the nucleus, induces the transcription rate of sterol target genes. Conversely, the proteolytic activation of SREBPs and the transcriptional activity of target genes are low, when the cellular CS levels are increased (1, 2). BAs and oxysterols also affect the CS balance through regulatory pathways recently depicted that involve different nuclear hormone receptors. BAs are the natural agonists of the farnesoid-X-receptor (FXR) (NR1H4) (3, 4), whereas oxysterols specifically activate the liver-X-receptor alpha  and beta  (LXRs) (NR1H3 and NR1H2) (5). Once activated, these nuclear receptors bind, as heterodimers with 9-cis-retinoic acid receptor (RXR), specific responsive elements located in the promoter of target genes (6, 7).

BA synthesis and elimination are major determinants for body CS homeostasis. Primary BAs are synthesized from CS in the liver where they are conjugated with glycine or taurine prior to be secreted into bile. More than 90% BAs are reabsorbed along the small intestine and return to the liver to be secreted again into bile. This enterohepatic BAs circulation is essential for the maintenance of CS balance. Indeed, BAs not reclaimed by intestinal absorption constitute the main way to eliminate a CS excess. If the regulation of hepatic BA biosynthetic pathway is presently well understood (7), by contrast, the molecular mechanisms responsible for intestinal BA reabsorption/elimination are poorly known. Conjugated BA are efficiently reabsorbed in the ileum by an active transport system constituted by a couple of BA transporters, the ileal sodium-dependent bile acid transporter (I-BAT) and ileal bile acid-binding protein (I-BABP). I-BAT is a 38-kDa integral brush border membrane protein that co-transports sodium and BAs (8). The expression of I-BAT is restricted to the ileum, the biliary ductal system, and the proximal tubules of the kidney. Its involvment in ileal BA absorption is supported by the fact that patients with a mutation in the I-BAT gene or with a diminished expression level of I-BAT, as in familial hypertriglyceridemia, fail to absorb BAs efficiently (9, 10). Once into the cell, BAs are reversibly bound to I-BABP, also termed ileal lipid-binding protein. It is an abundant soluble 14-kDa protein that belongs to the fatty acid-binding protein superfamily (11). As with the other members of this multigenic family, the tertiary structure of I-BABP consists of 10 antiparallel beta  strands organized into two orthogonal beta  sheets forming an hydrophobic pocket (12). Specificities in the I-BABP structure (high volume cavity, great flexibility of the backbone structure) account for its preferential binding of bulky hydrophobic and rigid ligands such as unconjugated and conjugated BAs (13). In the digestive tract, I-BABP is found in both small intestine and liver, in which its expression is strictly restricted to the ileocytes (14, 15) and large cholangiocytes (16), respectively. The physiological function of I-BABP is not yet clearly established. However, its ligand binding properties, its abundance and strict localization in cells in which BA flux is substantial, and its physical interactions with I-BAT (17, 18) strongly suggest that I-BABP plays a role in cellular BA uptake, trafficking, and/or protection against the detergent effect of free BAs. Such functions suggest that the expression of I-BABP gene is crucial for the BAs circulation and hence for CS balance. Therefore, it was tempting to speculate that the expression of I-BABP gene is subjected to a tight regulation. In agreement with this assumption, we have recently demonstrated that BAs up-regulate the human I-BABP gene expression (19) through the interaction of FXR/RXR heterodimer with a BA-responsive element located in the proximal part of promoter (20). In the current report, we show that the positive feedback of the I-BABP gene in response to CS feeding is because of an indirect pathway involving the LXR-mediated induction of SREBP1c. The implication of different CS sensors (FXR, LXR/SREBP1c) in the regulation of the I-BABP gene in the ileum strongly suggest that this soluble BA carrier contributes to CS balance.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and Experimental Treatments-- French guidelines for the use and care of laboratory animals were followed. Male Swiss mice (30 ± 2 g) from the Center d'Elevage Dépré (Saint Doulchard, France) were used. Animals were housed individually in a controlled environment (constant temperature and humidity, darkness from 8 p.m. to 8 a.m.) and fed ad libitum a standard chow (UAR A04, Usine d'Alimentation Rationnelle, France). To explore the effects of a high CS diet on I-BABP gene expression, mice were fed for 14 days a standard chow supplemented with 2% CS (w/w). Controls were fed the standard chow containing <0.02% CS. In the second set of experiments, mice were either sacrified 24 h after a gavage with a specific LXR agonist (36 mg/kg GW3965). Controls received by force feeding the vehicle alone (0.9% carboxymethylcellulose, 9% polyethylene glycol 400, and 0.05% Tween 80). After sacrifice, the ileal mucosa corresponding to the 5-cm intestinal segment before the cecum were scraped, snap-frozen in liquid nitrogen, then stored at -80 °C until RNAs extraction.

Cell Culture-- Caco-2 cells (passages 55-60) were cultured in controlled environment (37 °C, 5% CO2) in medium A (Dulbecco's modified Eagle's medium (DMEM), 4 mM glutamine, 1% non-essential amino acids, 100 units/ml penicillin, 100 µg/ml streptomycin) supplemented with 20% fetal calf serum (FCS). Medium was changed every 2 days. At the first day of confluence, cells were incubated for 24 h in the medium A containing 10% fetal calf serum (v/v) in presence of 50 µM chenodeoxycholic acid (CDCA) alone (control) or associated with either 5 µg/ml simvastatin (sterols -) or 10 µg/ml CS and 1 µg/ml 25-hydroxy-cholesterol (25-(OH)CS) (sterols +). Control cultures received the vehicle alone (2 µl/ml ethanol).

Organ Culture of Ileal Explants-- Male Swiss mice were fasted overnight and ileal explants were prepared then cultured as described previously (21). In brief, ileal samples were rapidly removed, washed, then sliced into strips whom serosa was stripped off. Ileal explants were precultured for 4 h at 37 °C under an oxygenated atmosphere in Hepes-buffered DMEM containing 10% NCTC-135, 10% fetal calf serum, 1% fungizone, and 0.1 mg/ml gentamycin (all from Invitrogen). Then, the explants were cultured for 16 h in the same medium supplemented with 5% in lipoprotein free medium in presence of 50 µM GW3965 (LXR agonist). Control cultures received the vehicle alone (2 µl/ml Me2SO).

Northern Blot Analysis-- Total RNAs were isolated following the method of Chomczynski and Sacchi (22) or with RNeasy mini kit (Qiagen) for organ cultures of ileal explants. The RNAs (10-30 µg) were electrophoresed on a 1% agarose gel and transferred to GeneScreen membrane (PerkinElmer Life Sciences) using previously published procedures (20). cDNA from human I-BABP were used as probes (23). The cDNA from murine 18 S rRNA was used to ensure that equivalent amounts of RNAs were loaded and transferred. Probes were labeled with [alpha -32P]dCTP (3000 Ci/mmol; ICN) by a megaprime kit (Amersham Biosciences, Inc.).

Real-time Quantitative RT-PCR-- cDNA was synthesized from 5 µg of total RNA in 20 µl using random hexamers and murine Moloney leukemia virus reverse transcriptase (Invitrogen). Real-time quantitative RT-PCR analyzes were performed starting with 50 ng of reverse-transcribed total RNA (diluted in 5 µl of 1× Sybr Green buffer), with 200 nM of both sense and antisense primers (Genset) in a final volume of 25 µl using the Sybr Green PCR core reagents in a ABI PRISM 7700 Sequence Detection System instrument (Applied Biosystems). Because we used Sybr Green in measurements of amplification-associated fluorescence for real-time quantitative RT-PCR, it was important to verify that generated fluorescence was not overestimated by contaminations resulting from residual genomic DNA amplification (using controls without reverse transcriptase) and/or from primer dimers formation (controls with no DNA template nor reverse transcriptase). RT-PCR products were also analyzed on ethidium bromide stained agarose to ensure that a single amplicon of the expected size was indeed obtained. 18 S rRNA and GAPDH amplifications were used to account for variability in the initial quantities of cDNA. Relative quantitation for any given gene, expressed as-fold variation over control, was calculated after determination of the difference between cycle threshold (CT) of the given gene in both control (A) and treated (B) samples using the 2-Delta (CTA - CTB) formula according to manufacturer's protocol. Individual CT values are means of triplicate measurements. Sense and antisense primers were: GGCCATCCACAGTCTTCTGG and ACCACAGTCCATGCCATCACTGCCA for GAPDH, GGGAGCCTGAGAAACGGC and GGGTCGGGAGTGGGTAATTT for 18 S, GCGCCATGGACGAGCTG and TTGGCACCTGGGCTGCT for SREBP1a, GGAGCCATGGATTGCACATT and GCTTCCAGAGAGGAGGCCAG for SREBP1c, CCCTTGACTTCCTTGCTGCA and GCGTGAGTGTGGGCGAATC for SREBP2, GGGAAGGACATTCGCTCGG and TTGCTTTTCAGCTTGCTCGG for ABCA1, GAGTGGCAGGACCCCTTTG and GTTTCGAGCCAGGCTTTCAC for HMG-CoA reductase.

Plasmid Construction-- Wild type -2769/+44 (2769 I-BABPwt) and -148/+44 (148 I-BABPwt) bp fragments of the human I-BABP promoter were cloned upstream from the chloramphenicol acetyltransferase (CAT) gene in the pCAT3-basic vector (Promega, Madison, WI). Mutations of the sterol-responsive element (SRE; 148 I-BABPmut1) and the GC box (148 I-BABPmut2) were generated by site-directed mutagenesis (QuickchangeTM site-directed mutagenesis kit, Stratagene) using the following oligonucleotides 5'-ggagggagaagaaGTGGGATATCttaggggctgagcc-3' (SRE sequence in capital letters, mutations in bold letters) and 5' ggagaagaagtggggtgacttCTAGACtgagcctcagcaactggg-3' (CG box sequence in capital letters, mutation in bold letters). Deletion of these sequences (148 I-BABPdel) was realized using the following primer 5'-caggacaggagggagaagaagcctcagcaactgggagag-3'. All constructs were confirmed prior to use by restriction digestions.

Transfection Assays-- CaCo-2 cells were used for the transfection studies. They were plated in six-well plates in DMEM supplemented with 10% FCS at 40-50% confluence. Transfection mixes contained 4 µg of I-BABP-CAT reporter plasmid and 500 ng of beta -galactosidase expression vector. Co-transfection mixes contained 4 µg of I-BABP-CAT reporter plasmid, 10 or 100 ng of human SREBP1a, SREBP1c, or SREBP2 expression vectors (generous gift from Dr T. F. Osborne, University of California, Irvine, CA) or 4 µg of human Sp1 expression vector (generous gift from Dr R. Tjian, Howard Hughes Medical Institute, Department of Molecular and Cell Biology, University of California, Berkeley, CA) and 500 ng of beta -galactosidase expression vector. Cells were transfected overnight by the calcium phosphate precipitation method. In transfection studies, the medium was changed by DMEM supplemented with 1% of lipoprotein-depleted serum (sterols -) or 10 µg/ml CS and 1 µg/ml 25-(OH)CS (sterols +). In co-transfections studies, the medium was changed by DMEM supplemented with 10% FCS associated with 10 µg/ml CS and 1 µg/ml 25-(OH)CS to inhibit maturation of endogenous SREBPs. The cells were incubated for an additional 24 h. Cell extracts were prepared and assayed for CAT and beta -galactosidase activities.

Band Shift Assays-- SREBP1c (24) was synthesized in vitro using the TNT rabbit reticulocyte lysate coupled in vitro transcription/translation system (Promega) according to the manufacturer's instructions. Gel mobility shift assays (20 µl) contained 20 mM HEPES (pH 7.8), 120 mM KCl, 0.4% Nonidet P-40, 12% glycerol, 2 mM dithiothreitol, 0.2 µg of poly(dI-dC), and freshly synthesized SREBP1c protein (5 µl). Competitor oligonucleotides, including the wild type SRELDL (gatcaaaATCACCCCACtgc), wild type SREI-BABP (gatcccctaaGTCACCCCACttcttc), mutated SREI-BABP (gatcccctaaGATATCCCACttcttc, mutations indicated in bold letters), were included at a 500-fold excess. After a 10-min incubation on ice, 10 ng of 5' end-labeled [gamma -32P]ATP oligonucleotide (wild type SREI-BABP) was added and the incubation continued for an additional 10 min. DNA-protein complexes were resolved on a 4% polyacrylamide gel in 0.5 M TBE (90 mM Tris, 90 mM boric acid, 2 mM EDTA). Gels were dried and subjected to autoradiography at -70 °C.

Statistical Analysis-- The results were expressed as means ± S.E. The significance of the differences between groups was determined by Student's t test. Statistical significance for real-time quantitative RT-PCR was assessed by analysis of variance followed by Newman-Keuls comparison tests (Statistica, StatSoft Inc.).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Sterols Regulate I-BABP mRNA Levels in Vitro-- In undifferentiated Caco-2 cells cultured under standard conditions, I-BABP mRNA levels are too low to detect a putative inhibitory effect. Because CDCA is known to be a strong I-BABP gene inducer (19), the effect of a sterol addition (10 µg/ml CS + 1 µg/ml 25-(OH)CS) or depletion (5 µg/ml HMG-CoA reductase inhibitor, simvastatin) on I-BABP mRNA levels was studied on cells simultaneously subjected to 50 µM CDCA. According to previously published data (19), CDCA alone led to a 2-fold increase in I-BABP transcripts as compared with the control culture (data not shown). As shown in the Fig. 1, the I-BABP mRNA levels were significantly increased when Caco-2 were sterol-deprived and repressed when the sterols were added to the medium. Similar modifications in mRNA levels have also been found for the 3-HMG-CoA reductase, which is known to be a typical sterol target gene (data not shown).


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 1.   I-BABP expression is regulated by sterols in vitro. CaCo-2 cells were cultured for 24 h in a medium containing 50 µM CDCA, in the presence or in absence of sterols. Condition sterol (+) = 10 µg/ml CS + 1 µg/ml 25-(OH)CS; condition sterol (-) = 50 µM simvastatin. A, Northern blotting hybridization of I-BABP mRNA and 18 S rRNA levels. 30 µg of total RNA from CaCo-2 cells were resolved on a 1% agarose gel containing 2.2 M formaldehyde, transferred to a nylon membrane, and fixed by UV irradiation. B, quantification by densitometric scanning. Means ± S.E., n = 3; **, p < 0.01; ***, p < 0.001.

Identification of a SRE in the Human I-BABP Promoter-- To determine whether the sterol-mediated effects on I-BABP mRNA levels might be secondary to a direct gene regulation, Caco-2 cells were transiently transfected either with a long (2769 I-BABPwt) or a short (148 I-BABPwt) human I-BABP promoter fragments cloned into a CAT reporter vector in presence or in absence of sterols. Lipoprotein deprivation resulted in a 4-fold rise in CAT activity as compared with sterol-treated cells. Additional transactivation occurred in cells cultured in sterol-depleted medium in which cholesterol synthesis was inhibited by the HMG-CoA reductase inhibitor, simvastatin (Fig. 2). This finding brings the first demonstration that the human I-BABP gene is a sterol target gene. The fact that the short promoter construct was always sterol-sensitive strongly suggests a proximal localization for the sterol-responsive sequence. According with this assumption, the sequence inspection of human I-BABP promoter revealed the decamer (5'-GTGGGGTGAC-3') at the position -72/-62 exhibiting a high homology with the SREBP-binding site-1 (SRE-1) found in the promoters of LDL receptor (25), HMG-CoA synthase (26), and glycerol-3-phosphate acyltransferase (27). To function efficiently, SREBPs require the additional transcription factors NF-Y or Sp-1 (28). A putative Sp-1-binding site (GC box-58/-54) flanking the SRE-72/-62 sequence was also identified in the human I-BABP promoter. Sequence alignment of the proximal promoter of human, rabbit, and mouse I-BABP genes demonstrated that the SRE sequence and GC box are highly conserved in these different mammalian species (Fig. 3). Deletion/mutation analyzes of the short promoter confirmed the importance of these sequences (Fig. 4). Indeed, the strong induction of the CAT activity triggered by sterol depletion in the wild type promoter (148 I-BABPwt) was fully abolished when SRE-72/-62 or GC box-58/-54 were mutated (148 I-BABPmut1 and 148 I-BABPmut2) or deleted (148 I-BABPdel). Interestingly, similar results were also found in the context of the large promoter (2800 bp), demonstrating that only the proximal sequence -72/-54 is critical for CS response (data not shown).


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 2.   The I-BABP promoter is activated by sterol depletion. CaCo-2 cells were transiently transfected with either the 2769 I-BABPwt-CAT or 148 I-BABPwt-CAT promoter-reporter gene constructs. 4 µg of constructs and 500 ng of pCMV-beta gal were used. The cells were transfected in a 10% FCS medium. 12 h after the transfection, the cells were treated for 24 h with the following media: condition sterol (+) = DMEM + 1% lipoprotein free serum + 10 µg/ml CS + 1 µg/ml 25-(OH)CS; condition sterol (-) = DMEM + 1% lipoprotein free serum; sterol (-) + simvastatin = DMEM + 1% lipoprotein free serum + 5 µg/ml simvastatin. Means ± S.E., n = 3; ***, p < 0.001.


View larger version (38K):
[in this window]
[in a new window]
  		Fig. 3.   A conserved putative SRE sequence in the human, rabbit and mouse I-BABP gene promoters. The first 200 bp of the human, rabbit, and mouse gene I-BABP promoters were aligned using the Multalin algorithm. Numbering starts from the transcription start site of each promoter.


View larger version (9K):
[in this window]
[in a new window]
  		Fig. 4.   Characterization of a SRE sequence in the human I-BABP gene reporter by mutation-deletion analysis. CaCo-2 cells were transiently tranfected with the different I-BABP promoter-reporter gene constructs and then cultured for 24 h in presence or in absence of sterols. Lane 1, 148 I-BABPwt construct containing the native SRE-72/-62 and GC box-58/-54 sequence; lane 2, 148 I-BABPmut1 construct containing a muted SRE-72/-62 and native GC box-58/-54 sequence; lane 3, 148 I-BABPmut2 construct containing a native SRE-72/-62 and a muted GC box-58/-54 sequence; lane 4, 148 I-BABPdel construct in which SRE-72/-62 and GC box-58/-54 sequence was deleted. Condition sterols (+) = DMEM + 1% lipoprotein free serum + 10 µg/ml CS + 1 µg/ml 25-(OH)CS; condition sterols (-) = DMEM + 1% lipoprotein-free serum. Means ± S.E., n = 3.

SREBPs and Sp-1 Transactivate the I-BABP Promoter-Reporter Gene-- In cultured cells sterol-depleted conditions lead to the proteolytic activation of SREBPs that bind to SRE in the promoter of sterol target genes. To determine the involvment of SREBPs on sterol-mediated regulation of I-BABP gene, Caco-2 cells were co-transfected with the wild type version of the short I-BABP promoter-CAT plasmid and expression vectors expressing mature SREBP1a, SREBP1c, or SREBP2. As shown in Fig. 5A, CAT activity driven by the 148 I-BABPwt promoter was similarly induced by both SREBP1a and SREBP2 in dose-dependent manner. A lower, but significant, effect was also found in presence of 100 ng of SREBP1c expression vector (Fig. 5A). This observation is in good agreement with the fact that SREBP1c isoform is a much weaker transcription activator than SREBP1a in cultured cells (29). Constructs in which SRE-72/-62 was mutated or deleted were unresponsive to SREBPs (Fig. 5B). To function efficiently SREBPs must be activated by co-factors such as Sp-1 or NF-Y. To explore the functional role of the putative Sp-1-binding site (GC box-58/-54) identified in the close proximity of the SRE-1 (Fig. 3), Caco-2 cells were co-transfected with different constructs of the short I-BABP promoter in the presence of a Sp-1 expression vector or empty plasmid (CMV5). The 4-fold induction of CAT activity mediated by Sp-1 in wild type promoter was not affected by the mutation of SRE-1 sequence (148 I-BABPmut1). By contrast, it was substantially decreased when mutations were introduced in the GC box (148 I-BABP mut2), suggesting that the nucleotide sequence -58/-54 is a Sp-1-binding site (Fig. 5C). It is noteworthy that the different modifications introduced in the sequence of the proximal promoter of human I-BABP gene do not alter its functional activity. Indeed, the mutation or deletion of the SRE-72/-62 sequence and GC box-58/-54 in a promoter construct containing the BA-responsive element did not abrogate the FXR/CDCA-mediated transactivation of the CAT reporter gene (data not shown).


View larger version (21K):
[in this window]
[in a new window]
  		Fig. 5.   Transactivation of the native (-148/+44) I-BABP promoter-reporter gene by SREBPs. A, dose-dependent effect of the different SREBPs isoforms on the transactivation of human I-BABP promoter-reporter gene. Caco-2 cells were transiently co-tranfected with 4 µg of 148 I-BABPwt-CAT construct; 0, 10, or 100 ng expression vectors for human mature SREBP1a, SREBP1c, or SREBP2; and 500 ng of pCMV-beta gal. B, effect of SRE-72/-62 mutation or deletion on transactivation of CAT gene by SREBPs. CaCo-2 cells were transiently co-tranfected with 4 µg of the different I-BABP promoter constructs as indicated (148 I-BABPwt, 148 I-BABPmut1, 148 I-BABPdel), SREBP expression vectors (10 ng of SREBP1a or SREBP2 or 100 ng of SREBP1c) and 500 ng of pCMV-beta gal. C, effect of SRE-72/-62 mutation or deletion on transactivation of CAT gene by Sp-1. CaCo-2 cells were transiently co-tranfected with 4 µg of the different I-BABP promoter constructs as indicated (148 I-BABPwt, 148I-BABPmut1, 148I-BABPmut2, 148 I-BABPdel), 4 µg of Sp-1 expression vector, and 500 ng of pCMV-beta gal. In the experiments A, B, and C 12 h after the transfection, the cells were cultured for additional 24 h in medium supplemented with 10 µg/ml CS + 1 µg/ml 25-(OH)CS to inhibit maturation of endogenous SREBPs. Means ± S.E., n = 3.

CS-enriched Diet Up-regulates the I-BABP Gene through a LXR/SREBP1c Pathway-- Taken together, the current in vitro experiments demonstrate that I-BABP gene expression might be regulated by SREBPs in response to alteration of cellular sterol levels. To assess the physiological pertinence of this finding, I-BABP expression was explored in mice fed for 14 days a standard chow supplemented with 2% CS. Surprisingly, the I-BABP mRNA levels were significantly higher in the ileum from mice subjected to the CS supplementation than in animal fed the control diet (Fig. 6A). Interestingly, ileal SREBP1c mRNA levels were also significantly increased by the high CS diet, whereas the transcripts encoding SREBP1a were unchanged (Fig. 6B), and as previously reported, SREBP2 mRNA levels were reduced by the CS feeding (30, 31). To determine whether the SREBP1c isoform can specifically bind to the SREI-BABP motif, electrophoretic mobility shift assays were performed using the 32P-labeled SRE from the human I-BABP promoter as probe. In the presence of SREBP1c, a shift was found (Fig. 7, lane 12). The binding specificity of SREBP1c to wild type SREI-BABP was demonstrated by the existence of a competitive inhibition in presence of an excess of either wild type SREI-BABP or SRELDL sequences (Fig. 7, lanes 13 and 14), not reproduced with mutated SREI-BABP (Fig. 7, lane 15). No binding was obtained when mutated SREI-BABP was used as probe (Fig. 7, lanes 15-20). LDL receptor SRE was also used as positive control probe (Fig. 7, lanes 1-10).


View larger version (19K):
[in this window]
[in a new window]
  		Fig. 6.   Cholesterol-enriched diet induces the I-BABP mRNA levels. Male Swiss mice were fed ad libitum for 14 days either a standard laboratory chow diet containing 0.2% (w/w) cholesterol (control diet) or 2% CS. A, representative results obtained with 30 µg of total RNA from ileal mucosa are shown in the upper panel. The bar graph represents I-BABP data normalized to 18 S rRNa for differences in total RNA loading. B, quantification of different SREBPs isoforms by the Sybr Green method. Means ± S.E., n = 5. *, p < 0.05; **, p < 0.01; ***, p < 0.001.


View larger version (75K):
[in this window]
[in a new window]
  		Fig. 7.   SREBP1c specifically binds the human SRE. Electrophoretic mobility shift assay was performed in presence of in vitro translated SREBP1c and wild type (WT) I-BABP SRE (WT SREI-BABP) as probe. LDL receptor SRE (WT SRELDL and Mut SRELDL) were used as control probes. Competition analysis was performed with an excess of WT SREI-BABP, WT SRELDL, or mutated I-BABP SRE (Mut SREI-BABP).

Because, first, it has been recently demonstrated that mouse SREBP1c is a LXR target gene (31), and second, I-BABP gene expression may be regulated by SREBPs (present data), we hypothesized that LXR activation by CS-derived oxysterols leads to an increase in SREBP1c expression and maturation producing, in turn, a rise in I-BABP mRNA levels. To support this assumption, mice were force-fed with the specific LXR agonist GW3965 (32, 33). As shown in Fig. 8A, I-BABP and SREBP1c mRNA levels were significantly increased 24 h after treatment. In vivo, this change might be due, at least in part, to a LXR-mediated induction of BA biosynthesis (34). To explore whether the I-BABP gene may be up-regulated by LXR independently to the BA/FXR pathway (20), this experiment was reproduced in vitro using ileal explants in culture (21). Despite these BA-deprived conditions, GW3965 led to a slight but significant increase in both I-BABP and SREBP1c (Fig. 8B).


View larger version (37K):
[in this window]
[in a new window]
  		Fig. 8.   LXR agonist GW3965 induces the I-BABP and SREBP1c mRNA levels both in vivo (A) and in vitro (B). A, male Swiss mice were force-fed with 36 mg/kg LXR agonist, GW3965. Controls received the vehicle alone. Mice were sacrified 24 h after treatment. Means ± S.E., n = 6; *, p < 0.05. B, ileal explants from male Swiss mice were prepared as described under "Materials and Methods," and cultured for 16 h in medium supplemented with 5% lipoprotein-free serum in the presence of 50 µM LXR agonist. Control cultures received the vehicle alone. Data presented are representative of two independant experiments, n = 6 for each. Means ± S.E.; *, p < 0.05. I-BABP mRNA levels were evaluated by Northern blotting using 15 or 10 µg of total RNA from ileal mucosa or ileal explants. SREBP1c mRNA levels were evaluated by real-time quantitative RT-PCR using 0.5 µg of total RNA. mRNA levels were normalized to 18 S rRNA (bar graph).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the digestive tract, the expression of the soluble BA carrier I-BABP is strictly restricted to cells responsible for the active reabsorption of BAs, i.e. ileocytes (14, 15) and large cholangiocytes (16). This characteristic strongly suggests that I-BABP plays an important role in BA circulation and, hence, in CS homeostasis. Therefore, the pharmacological modulation of I-BABP gene might be envisioned to act on CS balance. Despite this perspective, little is known on the molecular mechanisms involved in the regulation of I-BABP gene. We have recently demonstrated that BAs induce the expression of the I-BABP gene (19, 35) through the interaction of FXR/RXR heterodimer with a specific BA-responsive element located in the proximal sequence of human I-BABP promoter (20). Moreover, the targeted disruption of the nuclear receptor FXR has provided the direct evidence that I-BABP gene expression is FXR-dependent (36). The present report strongly suggests that sterols, through the activation of the LXR/SREBP1c regulatory pathway (31), are also able to modulate the expression of the I-BABP gene. Indeed, a SREBP-responsive element exhibiting a high homology (9/10) with the typical SRE-1 sequence previously found in the promoter of LDL receptor (25) has been identified in the proximal sequence of human I-BABP promoter. To function efficiently, SREBPs require the additional transcription factors NF-Y or Sp-1 (28). In agreement with this observation, a Sp-1-binding site (GC box) flanking the SRE-1 sequence has also been found in the human I-BABP promoter. Mutation and deletion of SRE-1 sequence and/or GC box fully suppress the transactivation of the CAT reporter gene triggered, in wild type promoter, by both sterol depletion and co-expression of mature SREBPs or of Sp-1. Taken together, these data strongly suggest that the SRE/Sp-1-72/-54 sequence plays a basic role in the regulation of the human I-BABP gene by CS. It is noteworthy that the sequence alignment of the proximal promoter of human, rabbit, and mouse I-BABP genes reveals a high conservation of these SRE-1 and Sp-1 motifs in mammals. According to the sterol-dependent maturation of SREBPs reported in cultured cells (1), we have found that I-BABP mRNA levels were increased when the human enterocyte-like Caco-2 cells were cultured in sterol-depleted conditions and decreased following a sterol load. The fact that a typical SREBP target gene such as HMG-CoA reductase (37) exhibits the same expression pattern than I-BABP gene confirms the functionality of SREBP pathway in undifferentiated CaCo-2 cells cultured under these conditions.

In contrast to these in vitro data, a CS-enriched diet led to a significant rise in I-BABP mRNA levels in the mouse ileum (Fig. 6A). Although a BA-mediated up-regulation of I-BABP secondary to CS feeding cannot be excluded, it is noteworthy that a similar apparent discrepancy between the in vitro and in vivo effects of sterols on gene expression has been already reported for the stearoyl-CoA desaturase-I gene (SCD-I). Indeed, similar to the I-BABP, the transactivation of the SCD-I promoter-reporter gene was repressed by an excess of sterols (38), whereas the SCD-I mRNA levels were increased in liver from mice subjected to a high CS diet (31). The fact that the pattern of SREBPs expression and regulation greatly differ in vivo and in cultured cells may explain these paradoxical findings. Indeed, the expression of the SREBP1a isoform is predominant in various cultured cell lines, including CaCo-2 (39), whereas SREBP1c is the major form found in mouse and human liver, adipose tissue, and adrenal glands (40). The sequential isolation of intestinal cells along the crypt-to-villus axis in hamster demonstrates that SREBP1c transcripts are also predominantly expressed throughout the small intestine, the higher levels being found in the villus tip, i.e. in the fully differentiated enterocytes (41). Similarly, the coordinate regulation of different SREBPs isoforms by sterols found in cultured cells is not reproduced in vivo. For instance in hamster, when hepatic CS levels is lowered, the amount of SREBP2 transcripts and nuclear form of the protein increase, but SREBP1c mRNA and mature protein fall (30, 42). The origin of this differential sterol-mediated regulation of SREBP1c in liver and cultured cells is explained by recent findings showing that SREBP1c is a direct LXR target gene in contrast to other SREBP isoforms (31, 43). In mice, CS feeding, which is a source of oxysterols ligands for LXR (5), leads to the hepatic up-regulation of SREBP1c gene through an LXRE located in its proximal promoter (31). In the present data, a similar CS supplementation (i.e. 2% CS for 14 days) also produces the rise of SREBP1c mRNA levels in the mouse ileum (Fig. 6B). Because SREBP1c and I-BABP are co-located in mature ileocytes (41, 44), it is likely that the CS-mediated I-BABP increase reported here is, at least in part, the result of the induction of SREBP1c gene expression. Because LXR agonist GW3965 treatment leads both in vivo and in vitro to an increase in I-BABP and SREBP1c transcripts in the mouse ileum (Fig. 8), we postulate that CS feeding results in oxysterol-dependent activation of LXR in ileum from mice leading to the up-regulation of SREBP1c that, in turn, induces the expression of I-BABP gene. Similar regulatory pathway has just been depicted in the mouse liver for SCD-I (31). It is clear from previous work that I-BABP expression is tightly dependent on the simultaneous presence of both FXR and BA (20, 36). This observation could explain why the induction of I-BABP expression is weaker in organ cultures in which BAs are lacking than in ileum from mice force-fed with LXR agonist.

A direct regulation of I-BABP by LXR has been envisioned. However, computer analysis of the human I-BABP promoter (-2769/+44 bp) sequence has not revealed the existence of a LXR response element-like sequence.

The CS-mediated induction of the I-BABP gene expression might present, at least, two immediate physiological interests: first, the increased BA binding capacity of ileocytes might protect the ileal mucosa against the cytotoxic effect of the large quantity of BAs produced during CS feeding ensuring the maintain of its functional integrity. Second, the rise in the ileal BA uptake might further enhance the fecal elimination of CS induced by the reverse CS transporter ABCA1 (45). Indeed, it was recently shown that a high CS feeding induces the ABCA1 expression throughout the small intestine increasing the CS efflux from enterocytes (45). An induction of ABCA1 expression also occurs in ileal mucosa following the treatment with LXR agonist (data not shown). Because CS absorption depends on the BA levels in intestinal lumen, the CS-mediated rise in I-BABP levels ensuring a quantitative extraction of BA from lumen might lead to a failure in CS solubilization and, hence, to favor the fecal CS elimination. Moreover, the driving force for ileal BA uptake secondary to the up-regulation of I-BABP gene is reinforced by the fact that BAs enhance also the binding affinity and capacity of I-BABP leading to a nearly quantitative extraction of BA from ileal lumen (46). Such a system, which associates gene regulation and change in binding properties of I-BABP, would allow a efficient adaptation of ileal BA transport to change in substrate levels.

In conclusion, the expression of the I-BABP gene in the small intestine appears to be under control of different cellular CS sensor systems (FXR, LRX/SREBP1c). These new data support the idea that the I-BABP gene plays a role in the whole body CS balance.

    ACKNOWLEDGEMENTS

We thank Timothy M. Willson for fruitfull discussions during the redaction of the manuscript and Isabelle Lefrère for expert technical assistance.

    FOOTNOTES

* This work was supported by funds from GlaxoSmithKline, Arcol, Conseil Régional de Bourgogne (to P. B.), and by a fellowship of the Ministère de l'Education Nationale, de la Recherche et de la Technologie (to J.-F. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ These authors should be considered as equal first authors.

§§ To whom correspondence should be addressed: Physiologie de la Nutrition, ENSBANA, 1 Esplanade Erasme, F-21000 Dijon, France. Tel.:/Fax: 33-3-80-39-66-91; E-mail: pbesnard@u-bourgogne.fr.

Published, JBC Papers in Press, October 29, 2001, DOI 10.1074/jbc.M106375200

    ABBREVIATIONS

The abbreviations used are: CS, cholesterol; BA, bile acid; 25-(OH)CS, 25-hydroxycholesterol; CDCA, chenodeoxycholic acid; I-BABP, ileal bile acid-binding protein; I-BAT, ileal sodium-dependent bile acid transporter; HMG-CoA, 3-hydroxy-3-methylglutaryl coenzyme A; FXR, farnesoid-X-receptor; LXR, liver-X-receptor; RXR, 9-cis-retinoic acid receptor; SREBP, sterol regulatory element-binding proteins; SRE, sterol-responsive element; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; RT, reverse transcriptase; CAT, chloramphenicol acetyltransferase; wt (or WT), wild type.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Brown, M. S., and Goldstein, J. L. (1997) Cell 89, 331-340
2. Horton, J. D., and Shimomura, I. (1999) Curr. Opin. Lipidol. 10, 143-150
3. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362-1365
4. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365-1368
5. Peet, J., Janowski, B. A., and Mangelsdorf, D. J. (1998) Curr. Opin. Genet. Dev. 8, 571-575
6. Repa, J. J., and Mangelsdorf, D. J. (1999) Curr. Opin. Biotechnol. 10, 557-563
7. Repa, J. J., and Mangelsdorf, D. J. (2000) Annu. Rev. Cell Dev. Biol. 16, 459-481
8. Wong, M. H., Oelkers, P., and Dawson, P. A. (1995) J. Biol. Chem. 270, 27228-27234
9. Oelkers, P., Kirby, L. C., Heubi, J. E., and Dawson, P. A. (1997) J. Clin. Invest. 99, 1880-1887
10. Duane, W. C., Hartich, L. A., Bartman, A. E., and Ho, S. B. (2000) J. Lipid Res. 41, 1384-1389
11. Bernlohr, D. A., Simpson, M. A., Hertzel, A. V., and Banaszak, L. J. (1997) Annu. Rev. Nutr. 17, 277-303
12. Lücke, C., Zhang, F., Rüterjans, H., Hamilton, J. A., and Sacchettini, J. C. (1996) Structure (Lond.) 4, 785-800
13. Lucke, C., Zhang, F., Hamilton, J. A., Sacchettini, J. C., and Ruterjans, H. (2000) Eur. J. Biochem. 267, 2929-2938
14. Sacchettini, J. C., Hauft, S. M., Van Camp, S. L., Cistola, D. P., and Gordon, J. I. (1990) J. Biol. Chem. 265, 19199-19207
15. Gong, Y. Z., Everett, E. T., Schwartz, D. A., Norris, J. S., and Wilson, F. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4741-4745
16. Alpini, G., Glaser, S. S., Rodgers, R., Phinizy, J. L., Robertson, W. E., Lasater, J., Caligiuri, A., Tretjak, Z., and LeSage, G. D. (1997) Gastroenterology 113, 1734-1740
17. Kramer, W., Girbig, F., Gutjahr, U., Kowalewski, S., Jouvenal, K., Müller, G., Tripier, D., and Wess, G. (1993) J. Biol. Chem. 268, 18035-18046
18. Kramer, W. (1995) Biochim. Biophys. Acta 1257, 230-238
19. Kanda, T., Foucaud, L., Nakamura, Y., Niot, I., Besnard, P., Fujita, M., Sakai, Y., Hatakeyama, K., Ono, T., and Fujii, H. (1998) Biochem. J. 330, 261-265
20. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 29749-29754
21. Mallordy, A., Poirier, H., Besnard, P., Niot, I., and Carlier, H. (1995) Eur. J. Biochem. 227, 801-807
22. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159
23. Fujita, M., Fujii, H., Kanda, T., Sato, E., Hatakeyama, K., and Ono, T. (1995) Eur. J. Biochem. 233, 406-413
24. Tontonoz, P., Kim, J. B., Graves, R. A., and Spiegelman, B. M. (1993) Mol. Cell. Biol. 13, 4753-4759
25. Yokoyama, C., Wang, X., Briggs, M. R., Admon, A., Wu, J., Hua, X., Goldstein, J. L., and Brown, M. S. (1993) Cell 75, 187-197
26. Wang, X., Sato, R., Brown, M. S., Hua, X., and Goldstein, J. L. (1994) Cell 77, 53-62
27. Ericsson, J., Jackson, S. M., Kim, J. B., Spiegelman, B. M., and Edwards, P. A. (1997) J. Biol. Chem. 272, 7298-7305
28. Schoonjans, K., Brendel, C., Mangelsdorf, D., and Auwerx, J. (2000) Biochim. Biophys. Acta 1529, 114-125
29. Shimano, H., Horton, J. D., Shimomura, I., Hammer, R. E., Brown, M. S., and Goldstein, J. L. (1997) J. Clin. Invest. 99, 846-854
30. Shimomura, I., Bashmakov, Y., Shimano, H., Horton, J. D., Goldstein, J. L., and Brown, M. S. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12354-12359
31. Repa, J. J., Liang, G., Ou, J., Bashmakov, Y., Lobaccaro, J. M., Shimomura, I., Shan, B., Brown, M. S., Goldstein, J. L., and Mangelsdorf, D. J. (2000) Genes Dev. 14, 2819-2830
32. Laffitte, K. D., Joseph, S. B., Walczak, R., Pei, L., Wilpitz, D. C., Collins, J. L., and Tontonoz, P. (2001) Mol. Cell. Biol. 21, 7558-7568
33. Whitney, K. D., Watson, M. A., Goodwin, B., Galardi, C. M., Maglich, J. M., Wilson, J. G., Willson, T. M., Collins, J. L., and Kliewer, S. A. (2001) J. Biol. Chem. 276, 43509-43515
34. Peet, D. J., Turley, S. D., Ma, W., Janowski, B. A., Lobaccaro, J. M., Hammer, R. E., and Mangelsdorf, D. J. (1998) Cell 93, 693-704
35. Kanda, T., Niot, I., Foucaud, L., Fujii, H., Bernard, A., Ono, T., and Besnard, P. (1996) FEBS Lett. 384, 131-134
36. Sinal, C. J., Tohkin, M., Miyata, M., Ward, J. M., Lambert, G., and Gonzalez, F. J. (2000) Cell 102, 731-744
37. Vallett, S. M., Sanchez, H. B., Rosenfeld, J. M., and Osborne, T. F. (1996) J. Biol. Chem. 271, 12247-12253
38. Tabor, D. E., Kim, J. B., Spiegelman, B. M., and Edwards, P. A. (1999) J. Biol. Chem. 274, 20603-20610
39. Field, F. J., Born, E., Murthy, S., and Mathur, S. N. (2001) J. Lipid Res. 42, 1687-1698
40. Shimomura, I., Shimano, H., Horton, J. D., Goldstein, J. L., and Brown, M. S. (1997) J. Clin. Invest. 99, 838-845
41. Field, F. J., Born, E., Murthy, S., and Mathur, S. N. (2001) J. Lipid Res. 42, 1-8
42. Sheng, Z., Otani, H., Brown, M. S., and Goldstein, J. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 935-938
43. DeBose-Boyd, R. A., Ou, J., Goldstein, J. L., and Brown, M. S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 1477-1482
44. Amano, O., Kanda, T., Ono, T., and Iseki, S. (1992) Anat. Rec. 234, 215-222
45. Repa, J. J., Turley, S. D., Lobaccaro, J. A., Medina, J., Li, L., Lustig, K., Shan, B., Heyman, R. A., Dietschy, J. M., and Mangelsdorf, D. J. (2000) Science 289, 1524-1529
46. Kramer, W., Corsiero, D., Friedrich, M., Girbig, F., Stengelin, S., and Weyland, C. (1998) Biochem. J. 333, 335-341

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. A. Alrefai, F. Annaba, Z. Sarwar, A. Dwivedi, S. Saksena, A. Singla, P. K. Dudeja, and R. K. Gill
Modulation of human Niemann-Pick C1-like 1 gene expression by sterol: role of sterol regulatory element binding protein 2
Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G369 - G376.
[Abstract] [Full Text] [PDF]

Home page
 GutHome page
C Thomas, J-F Landrier, D Gaillard, J Grober, M-C Monnot, A Athias, and P Besnard
Cholesterol dependent downregulation of mouse and human apical sodium dependent bile acid transporter (ASBT) gene expression: molecular mechanism and physiological consequences
Gut, September 1, 2006; 55(9): 1321 - 1331.
[Abstract] [Full Text] [PDF]

Home page
 J. Lipid Res.Home page
I. Bergheim, S. Harsch, O. Mueller, S. Schimmel, P. Fritz, and E. F. Stange
Apical sodium bile acid transporter and ileal lipid binding protein in gallstone carriers
J. Lipid Res., January 1, 2006; 47(1): 42 - 50.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Nakahara, N. Furuya, K. Takagaki, T. Sugaya, K. Hirota, A. Fukamizu, T. Kanda, H. Fujii, and R. Sato
Ileal Bile Acid-binding Protein, Functionally Associated with the Farnesoid X Receptor or the Ileal Bile Acid Transporter, Regulates Bile Acid Activity in the Small Intestine
J. Biol. Chem., December 23, 2005; 280(51): 42283 - 42289.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. A. Alrefai, Z. Sarwar, S. Tyagi, S. Saksena, P. K. Dudeja, and R. K. Gill
Cholesterol modulates human intestinal sodium-dependent bile acid transporter
Am J Physiol Gastrointest Liver Physiol, May 1, 2005; 288(5): G978 - G985.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Jung, M. Fried, and G. A. Kullak-Ublick
Human Apical Sodium-dependent Bile Salt Transporter Gene (SLC10A2) Is Regulated by the Peroxisome Proliferator-activated Receptor alpha
J. Biol. Chem., August 16, 2002; 277(34): 30559 - 30566.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/2/1324    most recent
M106375200v1