| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 2, 1375-1380, January 11, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, September 21, 2001, and in revised form, October 29, 2001
Aceruloplasminemia is an inherited
neurodegenerative disease characterized by parenchymal iron
accumulation secondary to loss-of-function mutations in the
ceruloplasmin gene. To elucidate the molecular pathogenesis of
aceruloplasminemia, the biosynthesis of a missense mutant ceruloplasmin
(P177R) occurring in an affected patient was examined. Chinese hamster
ovary cells transfected with cDNAs encoding secreted and
glycosylphosphatidylinositol (GPI)-linked wild-type or P177R human
ceruloplasmin were examined by pulse-chase metabolic labeling. These
experiments, as well as immunofluorescent analysis and
N-linked glycosylation studies, indicate that both the
secreted and GPI-linked forms of the P177R mutant are retained in the
endoplasmic reticulum (ER). The P177R mutation resides within a novel
motif, which is repeated six times in human ceruloplasmin and is
conserved in the homologous proteins hephaestin and factor VIII.
Analysis of additional mutations in these motifs suggests a critical
role for this region in ceruloplasmin trafficking and indicates that
substitution of the arginine residue is critical to the ER retention of
the P177R mutant. Metabolic labeling of transfected Chinese hamster
ovary cells with 64Cu indicates that the P177R mutant is
retained in the ER as an apoprotein and that copper is incorporated
into both secreted and GPI-linked ceruloplasmin as a late event in the
secretory pathway. Taken together, these studies reveal new insights
into the determinants of holoceruloplasmin biosynthesis and indicate that aceruloplasminemia can result from retention of mutant
ceruloplasmin within the early secretory pathway.
Ceruloplasmin is an abundant serum glycoprotein, which contains
>95% of the copper found in the plasma of all vertebrate species (1).
This protein is synthesized in hepatocytes and secreted into the plasma
as a holoprotein with six atoms of copper incorporated during
biosynthesis. Although copper does not affect the rate of
apoceruloplasmin synthesis or secretion, impairment of copper incorporation results in the secretion of an apoprotein that is devoid
of enzymatic activity and rapidly degraded in the plasma (2, 3).
Consistent with this concept, in patients with Wilson disease, the
absence or dysfunction of a copper-transporting ATPase abrogates copper
transfer into the secretory pathway, resulting in marked diminution in
the serum concentration of ceruloplasmin (4). Extrahepatic synthesis of
human ceruloplasmin has been detected in several tissues, including the
retina and brain (5, 6), and recent studies in rodents suggest that in
brain and testis ceruloplasmin is synthesized as a
glycosylphosphatidylinositol (GPI)1-anchored form via
alternative RNA splicing (7-10).
Ceruloplasmin is a member of the multicopper oxidase family of enzymes,
which use the facile electron chemistry of the bound copper atoms to
couple substrate oxidation to the four-electron reduction of dioxygen
to water (11). Although ceruloplasmin can oxidize multiple substrates
in vitro, recognition of an essential role for this protein
as a ferroxidase came with the identification of patients with
aceruloplasminemia (12, 13). In this disorder, affected individuals
present with diabetes and neurodegeneration in association with
parenchymal iron accumulation and absent serum ceruloplasmin
attributable to inherited loss-of-function mutations in the
ceruloplasmin gene. Studies in a murine model of aceruloplasminemia reveal an essential physiologic role for ceruloplasmin in determining the rate of iron efflux from cells with mobilizable iron stores (14).
The homologous multicopper oxidase hephaestin appears to play an
analogous role in iron efflux from enterocytes (15).
Despite the critical importance of copper for ceruloplasmin function,
little is known about the mechanisms of copper incorporation into this
protein. Furthermore, although a GPI-linked form of ceruloplasmin has
been identified in the rat, no information is available on the
mechanisms of synthesis or copper incorporation into this isoform.
Recent studies have revealed that the delivery of copper to specific
proteins within the cell is mediated by a family of proteins termed
copper chaperones (16). Although it is clear that the atox1 chaperone
plays a critical role in copper delivery to the secretory pathway of
mammalian cells (17), the specific mechanisms of copper incorporation
into any of the known copper proteins in the secretory pathway
including ceruloplasmin remain unknown. In this current study, the
identification of a missense mutation resulting in aceruloplasminemia
provided the opportunity to investigate the molecular basis for
ceruloplasmin deficiency in this disease and to use this mutation to
elucidate the mechanisms of holoceruloplasmin biosynthesis.
Materials--
General chemicals and reagents were purchased
from Sigma. DNA restriction and modifying enzymes were purchased from
Promega and used according to the manufacturer's specifications.
Hybridization membranes and ECL reagents were purchased from Amersham
Biosciences. Polyclonal rabbit antisera to human ceruloplasmin was
purchased from Dako and has previously been shown to recognize
ceruloplasmin from most mammalian species, including hamsters (18).
Monoclonal antisera to human protein disulfide isomerase was from
StressGen. [35S]Methionine and
[35S]Cysteine Translabel were purchased from ICN
Radiochemicals. 64Cu (750 Ci/mmol) was obtained by fast
neutron bombardment of a natural zinc target as described previously
(19). Molecular modeling of the P177R mutation was accomplished using
the software program InSight (Accelrys) using the published x-ray
crystallographic structure of human ceruloplasmin (20). Nucleotide and
amino acid sequence alignments were accomplished using Vector NTI.
Site-directed Mutagenesis of Ceruloplasmin--
The P177R
mutation was identified by sequencing of genomic DNA from an affected
patient with
aceruloplasminemia.2
Site-directed mutagenesis was performed in a pcDNA3 vector
(Invitrogen) containing the entire human ceruloplasmin open reading
frame (pcDNA3Cp) using Klentaq polymerase
(CLONTECH), oligonucleotide primer pairs corresponding to the P177R, P177A, and P432R mutations, and 5' sense
and 3' antisense oligonucleotides (21). The presence of specific
mutations and the fidelity of the entire cDNA sequence were
verified in each case by automated fluorescent sequencing (PerkinElmer
Life Sciences).
Cloning of GPI-linked Isoform of Ceruloplasmin--
A BLAST
search of the human expressed sequence tag data base using the DNA
sequence of exons 16-18 of human ceruloplasmin identified a candidate
GPI-linked isoform (accession number BE065575) with considerable
homology to the published sequence of rat GPI-linked ceruloplasmin
(10). The predicted coding sequence was amplified from a human brain
cDNA library by polymerase chain reaction using 5'
(CACAGGGGAGTTTATAGTTCTGATGTCTTTGACA) and 3' antisense
(ACGTCTCGAGTCATTCCTTGGTAGATATTTGGAATAAAATAATC) oligonucleotides containing an added XhoI site (underlined).
This polymerase chain reaction product was digested with
PmlI and XhoI and subcloned into pcDNA3Cp,
generating a full-length cDNA of the GPI-linked isoform.
Cell Culture, Transfection, and Immunofluorescence--
Chinese
hamster ovary (CHO) and HepG2 cells were obtained from the American
Type Culture Collection and maintained in either Ham's F-12 (CHO) or
Dulbecco's modified Eagle's medium (HepG2), each containing 10%
fetal bovine serum and supplemented with glutamine and
penicillin-streptomycin. Transient transfections were performed with
LipofectAMINE (Invitrogen) according to the manufacturer's instructions. For indirect immunofluorescence, transfected CHO cells
were plated on coverslips, fixed in 4% paraformaldehyde, and quenched
with 1 M ethanolamine. Cells were permeabilized in 0.1%
Triton X-100 and analyzed with a 1:2000 dilution of anti-ceruloplasmin or a 1:200 dilution of anti-protein disulfide isomerase antisera as
described previously (22). In some experiments, cells were resuspended
in Dulbecco's modified Eagle's medium containing 600 milliunits/ml
phosphatidylinositol-specific phospholipase C (Roche Molecular
Biochemicals) in a volume of 4 ml and incubated for 60 min at 37 °C
to release GPI-anchored proteins.
Metabolic Labeling and Immunoprecipitation--
Forty-eight
hours after transfection, CHO cells were pulse-labeled for 20 min with
60 µCi/ml [35S]methionine and
[35S]cysteine and chased with serum-free Ham's F-12
medium for the indicated time points, followed by collection of media
and lysate for immunoprecipitation as described previously (22). In
some experiments, the immunoprecipitate was eluted by boiling in the presence of 5 mM Tris-HCl, pH 8.0, containing 0.2% SDS,
split into two aliquots, and incubated at 37 °C overnight in the
presence or absence of 0.1 milliunits/µl endoglycosidase H (Roche
Molecular Biochemicals). Samples were subjected to 7.5%
SDS-polyacrylamide gel electrophoresis (PAGE) and analyzed by
PhosphorImager or exposure to Eastman Kodak Co. MR film. For
64Cu metabolic labeling, 48 h after transfection cells
were washed in phosphate-buffered saline, pulsed for 2 h with 300 µCi/ml 64Cu in serum-free Ham's F-12 medium, washed in
phosphate-buffered saline, and chased for 2 h with fresh
serum-free Ham's F-12 medium containing 100-fold excess cold copper.
Media were collected and concentrated using Centricon-30 columns
(Millipore). Analysis of cell lysate and media for
64Cu-labeled ceruloplasmin (holoceruloplasmin) was carried
out as described previously (23). Samples were electrophoresed in
4-20% Tris-HCl gradient gels without denaturation before loading and then analyzed by PhosphorImager. 35S and 64Cu
pulse-chase analyses of HepG2 cells were carried out in an identical
fashion with the exception that the pulse period for each was only 5 min.
A cDNA encoding human ceruloplasmin was transfected into a
series of mammalian cell lines followed by metabolic labeling and immunoprecipitation. In transfected CHO cells, the kinetics of ceruloplasmin synthesis and secretion (Fig.
1A) was found to be identical
to that observed for endogenous ceruloplasmin in the hepatoma cell line
HepG2 (23). Using a polyclonal antisera known to recognize hamster
ceruloplasmin, no endogenous ceruloplasmin synthesis was detected in
these CHO cells (data not shown). Furthermore, incubation of
transfected CHO cells with 64Cu revealed copper
incorporation into ceruloplasmin equivalent to that observed in HepG2
cells and primary hepatocytes (see Fig. 6). Taken together, these
results suggested that transfected CHO cells could be used to
investigate the mechanisms of serum ceruloplasmin deficiency resulting
from the P177R missense mutation identified in an affected patient.
Accordingly, a ceruloplasmin cDNA encoding this mutant was
transfected into CHO cells, followed by pulse-chase analysis. These
studies revealed marked intracellular accumulation of newly synthesized
P177R ceruloplasmin with no apparent degradation or secretion of this
mutant protein throughout the time course of the experiment (Fig.
1A). Because ceruloplasmin is a secreted glycoprotein, the
data in Fig. 1A suggest that the P177R mutant protein may be
improperly trafficked within the secretory pathway of the cell.
Recent studies in the rat have revealed that alternative splicing can
result in the synthesis of ceruloplasmin as a plasma membrane-anchored
GPI-linked isoform (10). If a similar situation occurs in humans, the
presence of a GPI-linked isoform would have important implications for
our understanding of the biosynthesis and trafficking of ceruloplasmin
as well as the effects of any patient mutations. To determine whether
there is a GPI-linked isoform of human ceruloplasmin, a BLAST search of
the human expressed sequence tag data base was performed. This approach
identified a ceruloplasmin cDNA with a carboxyl terminus highly
homologous to rat GPI-linked ceruloplasmin, and subsequent analysis of
human genomic DNA revealed the presence of a separate downstream exon encoding this putative GPI-linked sequence (Fig. 1B).
Analysis of RNA using a specific probe derived from this exon revealed that a transcript encoding this putative GPI-linked ceruloplasmin is
expressed in a variety of human tissues in vivo (data not shown).
To characterize this isoform of ceruloplasmin, a full-length cDNA
was generated by polymerase chain reaction of a human brain library and
transfected into CHO cells. Immunofluorescent analysis of transfected
cells with and without prior permeabilization using anti-ceruloplasmin
antisera revealed cell surface expression (Fig. 1C).
Treatment of transfected cells with phosphatidylinositol-specific phospholipase C abrogated this staining, suggesting that the expressed ceruloplasmin was anchored to the plasma membrane via a GPI linkage. Pulse-chase analysis in transfected CHO cells revealed that the GPI-linked form of wild-type ceruloplasmin remained in the cellular fraction for the duration of the experiment, with the gradual appearance of a second higher molecular weight band corresponding to
the mature, fully glycosylated membrane-anchored protein (Fig. 1D). As anticipated, expression of the GPI-linked isoform of
P177R ceruloplasmin revealed no secretion of this mutant into the
media. However, the pattern of intracellular synthesis was distinct
from that of the wild-type GPI-linked ceruloplasmin in that no higher molecular weight band was detected during the later part of the chase
period (Fig. 1D).
The biosynthetic data shown above suggest that the P177R mutation
results in impaired trafficking of both the secreted and GPI-linked
isoforms of ceruloplasmin. Previous studies have revealed that the
secreted form of ceruloplasmin is modified by N-linked glycosylation during biosynthesis (23). To determine whether GPI-linked
ceruloplasmin is also modified in this fashion and to further examine
the possibility of aberrant trafficking of the P177R mutant,
N-linked glycosylation of ceruloplasmin was analyzed in CHO
cells transfected with the GPI-linked form of either wild-type or P177R
ceruloplasmin. Although in both cases an endoglycosidase H-sensitive
form of ceruloplasmin was detected throughout the chase period,
maturation to a higher molecular weight, endoglycosidase H-resistant
form was observed only in the lysates from cells transfected with
wild-type ceruloplasmin (Fig. 2). These
data indicate that the GPI-linked form is modified by
N-linked glycosylation, a modification that accounts at
least in part for the higher molecular weight band observed in Fig. 1D. Similar results with endoglycosidase H were obtained
when these experiments were repeated using the wild-type and
P177R-secreted isoforms of ceruloplasmin (data not shown). Taken
together, these data suggest that trafficking of the P177R mutant is
blocked before the modification of N-linked oligosaccharides
in the cis- or medial-Golgi.
Biochemical Analysis of a Missense Mutation in
Aceruloplasminemia*
,,¶
Edward Mallinckrodt Department of
Pediatrics, Washington University School of Medicine,
St. Louis, Missouri 63110 and § First Department of
Medicine, Hamamatsu University School of Medicine,
Hamamatsu, Japan
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (57K):
[in a new window]
Fig. 1.
Ceruloplasmin biosynthesis and expression in
CHO cells. A, CHO cells transfected with wild-type
(wt) or P177R ceruloplasmin were incubated with
[35S]methionine and [35S]cysteine for 20 min and chased in media containing excess methionine for the indicated
periods of time. Ceruloplasmin was immunoprecipitated from cell lysates
(IC) and media (EC) and analyzed by 7.5%
SDS-PAGE as described under "Experimental Procedures."
B, exon structure and divergent translated amino acid
sequences of GPI-linked and secreted ceruloplasmin (Cp).
C, indirect immunofluorescence localization of ceruloplasmin
in CHO cells transfected with vector (a) or GPI-linked
ceruloplasmin (b-d). In some experiments, cells were
stained either in the absence of membrane permeabilization
(c and d) or after treatment with
phosphatidylinositol-specific phospholipase C (d) as
described under "Experimental Procedures." Magnification, ×600.
D, CHO cells transfected with the secreted form of
ceruloplasmin (wt-S), the GPI-linked form of ceruloplasmin
(wt-GPI), or the GPI-linked P177R ceruloplasmin
(P177R-GPI) were incubated with
[35S]methionine and [35S]cysteine for 20 min and chased in media containing excess methionine for the indicated
periods. Ceruloplasmin was immunoprecipitated from cell lysates
(IC) and media (EC) and analyzed by 7.5%
SDS-PAGE as described under "Experimental Procedures." *, higher
molecular weight band in lysate from wild-type GPI-linked
isoform.
View larger version (41K):
[in a new window]
Fig. 2.
Analysis of N-linked
glycosylation of GPI-linked ceruloplasmin. CHO cells
transfected with either wild-type (wt) or P177R GPI-linked
ceruloplasmin were incubated with [35S]methionine and
[35S]cysteine for 20 min and chased in media containing
excess methionine for the indicated periods. Ceruloplasmin
immunoprecipitates were then incubated in digestion buffer with (+) or
without (-) endoglycosidase H (endoH) for 16 h at
37 °C and analyzed by 7.5% SDS-PAGE as described under
"Experimental Procedures." Arrow, endoglycosidase
H-sensitive ceruloplasmin; arrowhead, endoglycosidase
H-resistant form.
To more directly assess the intracellular location of the P177R mutant,
indirect immunofluorescence was performed in CHO cells transfected with
the wild-type and P177R GPI-linked constructs. As noted previously,
GPI-linked ceruloplasmin displays a staining pattern consistent with
cell surface localization when transfected into CHO cells (Fig.
3A). In contrast, the
GPI-linked form of P177R ceruloplasmin is detected in an intracellular
compartment, which colocalizes with the endoplasmic reticulum (ER)
resident protein disulfide isomerase (Fig. 3, B and
C). Using these same methods, ER retention of P177R
ceruloplasmin was also observed with the secreted isoform of this
mutant, and this location was not altered for either mutant isoform
after growth of transfected cells at 31 °C or pretreatment with the
chemical chaperone glycerol (data not shown), conditions previously
shown to rescue trafficking defects of other proteins within the
secretory pathway (24).
|
Further inspection of the amino acid sequence of human ceruloplasmin
(25) revealed that the P177R mutation resides within a five-amino acid
motif G(FLI)(LI)GP, which is repeated six times throughout the protein
(Fig. 4A). This motif is also
present and repeated in the homologous multicopper oxidase hephaestin
as well as coagulation factor VIII (Fig. 4B). Of interest,
an analogous proline to arginine mutation in this motif has been
identified in the factor VIII gene in a patient with hemophilia A and
undetectable serum factor VIII (26), suggesting a possible role for
this motif in protein structure (Fig. 4B). Consistent with
this possibility, structural modeling reveals that in wild-type
ceruloplasmin, proline 177 projects into a tightly packed hydrophobic
pocket, closely surrounded by the nonpolar residues Leu74,
Ile77, Ile159, Val199, and
Phe267 (Fig. 4C). These data suggest that the
repeat G(FLI)(LI)GP motif may be critical for proper folding and
subsequent trafficking of human ceruloplasmin.
|
To further examine this hypothesis, site-directed mutagenesis was used
to create an analogous proline to arginine mutation in the third motif,
resulting in a P432R mutant ceruloplasmin (Fig. 4A).
Pulse-chase analysis of CHO cells transfected with the secreted isoform
of P432R ceruloplasmin revealed a pattern of synthesis nearly identical
to that seen for the P177R mutation, with little or no intracellular
degradation or secretion during the chase period (Fig.
5). Similar results were obtained using the GPI-linked isoform, and additional experiments with both isoforms revealed that the P432R mutant is also retained in the ER (data not
shown). The aberrant trafficking observed with the P177R and P432R
mutations could result either from loss of the conserved proline
residue or from insertion of the arginine residue. To distinguish
between these possibilities, a P177A ceruloplasmin was generated and
expressed in CHO cells. As can be observed in Fig. 5, the P177A
mutation does not impair the biosynthesis or secretion of ceruloplasmin
under these conditions, suggesting that the ER retention of the
arginine-substituted mutants may primarily result from introducing a
polar, basic guanidino moiety into a highly hydrophobic environment,
leading to protein misfolding.
|
The retention of the P177R mutant in the ER provides the opportunity to
examine the effect of this mislocalization on copper incorporation into
ceruloplasmin. To accomplish this, transfected CHO cells were
metabolically labeled with 64Cu followed by detection of
copper-labeled ceruloplasmin in the cell lysate and media. Using this
method, an 85-kDa band corresponding to holoceruloplasmin was detected
in cell lysate and media of 64Cu labeled HepG2 cells (Fig.
6A, lanes 1 and
7). The apparent size difference of ceruloplasmin observed
here (85 versus 132 kDa) is consistent with previous data
and reflects increased mobility of the holoprotein under these gel
conditions (23). Under these same conditions, no copper-labeled bands
were observed in lysate or media from CHO cells transfected with vector
alone (Fig. 6A, lanes 2 and 8). Both
secreted and GPI-linked holoceruloplasmin were detected in the cellular
lysates of transfected CHO cells (Fig. 6A, lanes
3 and 5), and the secreted form was also detectable in
the media (Fig. 6A, lane 9). The apparent slight
increase in molecular weight of GPI-linked holoceruloplasmin compared
with secreted holoceruloplasmin is consistent with previous
observations on rat GPI-linked ceruloplasmin (10) and presumably
reflects the addition of the GPI anchor to this isoform. In each case, the copper-labeled ceruloplasmin observed in CHO cells transfected with
wild-type ceruloplasmin was similar to that observed for endogenous
ceruloplasmin in HepG2 cells. In contrast, during this same period of
64Cu labeling, neither secreted nor GPI-linked
holoceruloplasmin was detected in cell lysate or media from CHO cells
transfected with the P177R mutant (Fig. 6A, lanes
4, 6, 10, and 12). Examination of
the P177A mutation using these same methods revealed copper incorporation into ceruloplasmin comparable with that observed with
wild-type ceruloplasmin, a finding consistent with the normal kinetics
of synthesis and secretion of this mutant observed in the pulse-chase
studies (Fig. 6B).
|
Taken together, the results of the copper-labeling experiments suggest
that copper is incorporated into both the secreted and GPI-linked
isoforms of ceruloplasmin and that this occurs either in the secretory
pathway beyond the ER or within the ER after protein folding. To
distinguish between these two possibilities, endogenous ceruloplasmin
biosynthesis and secretion were examined in HepG2 cells metabolically
labeled with either [35S]methionine and
[35S]cysteine or 64Cu. This analysis revealed
that although newly synthesized 35S-labeled ceruloplasmin
appears in the media within ~30 min, 64Cu-labeled
ceruloplasmin is detectable under these same conditions within the
first 5 min of the experiment, indicating that copper incorporation
into ceruloplasmin occurs as a late event within the secretory pathway.
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Although more than a dozen unique mutations have been identified in the ceruloplasmin gene in patients with aceruloplasminemia, the majority of these are insertions or deletions predicted to result in a frameshift or termination (1). This current study reports the first functional analysis of a missense mutation in aceruloplasminemia. The kinetics of synthesis, secretion, and copper incorporation into ceruloplasmin in transfected CHO cells (Figs. 1 and 6) are similar to those observed for endogenous ceruloplasmin in hepatocytes and glia (23, 27), a finding that supports the validity of this experimental system. In this regard, the finding that both secreted and GPI-linked P177R ceruloplasmin are retained in the ER of transfected CHO cells (Figs. 2 and 3) is consistent with the clinical observation of absent serum ceruloplasmin and ferroxidase activity in an affected individual with this mutation.2 Although in vivo the Wilson ATPase is required for copper incorporation into ceruloplasmin in hepatocytes, previous studies have revealed that CHO cells express the Menkes ATPase (28). Because copper is incorporated into ceruloplasmin in transfected CHO cells (Figs. 6 and 7), these data support the concept that these ATPases use common biochemical mechanisms to effect cellular copper homeostasis (22).
Alternative splicing of the rat ceruloplasmin gene results in a GPI-linked ceruloplasmin isoform abundantly expressed in the central nervous system (10). The data in this current study reveal that a human GPI-linked ceruloplasmin isoform arises from splicing of a previously unidentified downstream exon (Fig. 1). This finding is of importance for mutation screening of affected patients and raises the possibility that if the GPI-linked isoform is critical for iron homeostasis in the human brain, individuals may be identified with the phenotype of aceruloplasminemia and normal serum ceruloplasmin. Although no GPI-linked ceruloplasmin was detected in the media of transfected CHO cells (Fig. 1), cleavage of the plasma membrane GPI anchor can result in secretion of GPI-linked proteins (29), raising the possibility that ceruloplasmin secretion observed previously in glial cells (27) may result from GPI cleavage. Because these data clearly reveal ER retention of both the secreted and GPI-linked P177R ceruloplasmin in transfected CHO cells (Figs. 1 and 2), further studies will be warranted to identify the sites of expression of human GPI-linked ceruloplasmin and to define the precise role of this isoform in iron homeostasis.
Although the copper transport ATPases required for copper delivery to
the secretory pathway are localized to the trans-Golgi network, the
precise location within this pathway of copper incorporation into
ceruloplasmin is unknown (1). Because the P177R mutation does not
involve any of the six copper binding sites in ceruloplasmin, the lack
of copper incorporation into this ER-retained mutant (Fig. 6) suggests
that retrograde transport of copper to the ER does not occur. Such a
finding is consistent with observations that retention of tyrosinase in
the ER of melanoma cells abrogates copper incorporation into this
protein (30) and that copper incorporation into Fet3, the yeast
homologue of ceruloplasmin, occurs in a late compartment of the
secretory pathway (31). An important caveat to this conclusion is that
the P177R mutant may be incapable of binding copper regardless of
cellular location as a result of misfolding. Although this possibility
could not be directly tested in these studies, further kinetic analysis of copper incorporation into newly synthesized ceruloplasmin in HepG2
cells also suggests that this process occurs only at a point very late
in the secretory pathway, immediately before secretion or membrane
anchoring (Fig. 7). These metabolic
studies accurately reflect newly synthesized holoceruloplasmin, because
previous studies have shown that no copper is incorporated into
previously synthesized apoceruloplasmin (23). The observation that
GPI-linked ceruloplasmin also incorporates copper is consistent with
studies demonstrating oxidase activity of this isoform in the rat (7, 9). Interestingly, recent studies revealed that GPI-anchored proteins
are sorted from other proteins within the ER early in the secretory
pathway (32). Because copper incorporation into both the secreted and
GPI-linked isoforms occurs at a point late in the secretory pathway,
these data suggest that each isoform may be trafficked to a common
compartment for copper incorporation.
|
The ER plays an essential role in the folding and maturation of newly
synthesized proteins in the secretory pathway through the activity of
numerous soluble and membrane-bound enzymes and chaperones (33). The
G(FLI)(LI)GP motif identified in this study may play a role in packing
of hydrophobic side chains and protein folding and assembly in the ER,
perhaps via direct interactions with chaperones. Such a role is
supported by the finding of ER retention of the P432R mutant (Fig. 5)
as well as identification of this same mutation in a nonsecretory
mutant of factor VIII. Regardless of the mechanisms, the data in this
study indicate that aceruloplasminemia should be added to the list of
human diseases that can result from the retention of a mutant protein
within the ER (24). Neither decreased temperature nor chemical
chaperones stimulated movement of P177R ceruloplasmin from the ER, and
no appreciable degradation of this mutant protein was observed during the chase periods examined (Fig. 1). These data raise the possibility that ER accumulation of mutant ceruloplasmin may contribute to neuronal
cytotoxicity in aceruloplasminemia either through activation of ER
stress pathways, as observed in Perlizaues-Merzbacher disease (34) and
Charcot-Marie-Tooth syndrome (35), or via protein aggregation, as seen
in a number of sporadic and inherited neurodegenerative diseases,
including Huntington's disease, amyotrophic lateral sclerosis, and
prion-mediated encephalopathies (36). Further neuropathological studies
in aceruloplasminemic patients with specific genotypes will be useful
in addressing this issue and may provide for novel therapeutic
approaches to modulating ER protein export or degradation in this disease.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Michael Welch for providing 64Cu, Maxwell Krem and Daved Fremont for help with molecular modeling, and Iqbal Hamza, Scott Saunders, and Guojun Bu for critical review of the manuscript.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Research Grants HL 41536 (to J. D. G.) and CA 86307 (to M. Welch).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Recipient of a Burroughs Wellcome scholar award in experimental therapeutics. To whom correspondence should be addressed: Washington University School of Medicine, McDonnell Pediatric Research Bldg., 660 S. Euclid Ave., St. Louis, MO 63110. Tel.: 314-286-2764; Fax: 314-286-2893; E-mail: gitlin@kids.wustl.edu.
Published, JBC Papers in Press, October 31, 2001, DOI 10.1074/jbc.M109123200
2 S. Kohno, H. Miyajima, and J. D. Gitlin, unpublished observations.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: GPI, glycosylphosphatidylinositol; CHO, Chinese hamster ovary; PAGE, polyacrylamide gel electrophoresis; ER, endoplasmic reticulum.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Gitlin, J. D. (1998) Pediatr. Res. 44, 271-276 |
| 2. | Holtzman, N. A., and Gaumnitz, B. M. (1970) J. Biol. Chem. 245, 2350-2353 |
| 3. | Gitlin, J. D., Schroeder, J. J., Lee-Ambrose, L. M., and Cousins, R. J. (1992) Biochem. J. 282, 835-839 |
| 4. | Scheinberg, I. H., and Gitlin, D. (1952) Science 116, 484-485 |
| 5. | Mollgard, K., Dziegielewska, K. M., Saunders, N. R., Zakut, H., and Soreq, H. (1988) Dev. Biol. 128, 207-221 |
| 6. | Klomp, L. W. J., and Gitlin, J. D. (1996) Hum. Mol. Genet. 5, 1989-1996 |
| 7. | Patel, B. N., and David, S. (1997) J. Biol. Chem. 272, 20185-20190 |
| 8. | Salzer, J. L., Lovejoy, L., Linder, M. C., and Rosen, C. (1998) J. Neurosci. Res. 54, 147-157 |
| 9. | Fortna, R. R., Watson, H. A., and Nyquist, S. E. (1999) Biol. Reprod. 61, 1042-1049 |
| 10. | Patel, B. N., Dunn, R. J., and David, S. (2000) J. Biol. Chem. 275, 4305-4310 |
| 11. | Messerschmidt, A., and Huber, R. (1990) Eur. J. Biochem. 187, 341-352 |
| 12. | Yoshida, K., Furihata, K., Takeda, S., Nakamura, A., Yamamoto, K., Morita, H., Hiyamuta, S., Ikeda, S., Shimizu, N., and Yanagisawa, N. (1995) Nat. Genet. 9, 267-272 |
| 13. | Harris, Z. L., Takahashi, Y., Miyajima, H., Serizawa, M., MacGillivray, R. T. A., and Gitlin, J. D. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2539-2543 |
| 14. | Harris, Z. L., Durley, A. P., Man, T. K., and Gitlin, J. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 10812-10817 |
| 15. | Vulpe, C. D., Kuo, Y. M., Murphy, T. L., Cowley, L., Askwith, C., Libina, N., Gitschier, J., and Anderson, G. J. (1999) Nat. Genet. 21, 195-199 |
| 16. | O'Halloran, T. V., and Culotta, V. C. (2000) J. Biol. Chem. 275, 25057-25060 |
| 17. | Hamza, I., Faisst, A., Prohaska, J., Chen, J., Gruss, P., and Gitlin, J. D. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 6848-6852 |
| 18. | Gitlin, J. D. (1988) J. Biol. Chem. 263, 2681-2687 |
| 19. | Connett, J. M., Anderson, C. J., Guo, L. W., Schwarz, S. W., Zinn, K. R., Rogers, B. E., Siegels, B. A., Philpott, G. W., and Welch, M. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6814-6818 |
| 20. | Zaitseva, I., Zaitseva, V., Card, G., Moshkov, K., Bax, B., Ralph, A., and Lindley, P. (1996) J. Biol. Inorg. Chem. 1, 15-23 |
| 21. | Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. T., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239, 487-491 |
| 22. | Payne, A., and Gitlin, J. D. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10854-10859 |
| 23. | Sato, M., and Gitlin, J. D. (1991) J. Biol. Chem. 266, 5128-5134 |
| 24. | Aridor, M., and Balch, W. E. (1999) Nat. Med. 5, 745-751 |
| 25. | Takahashi, N., Ortel, T. L., and Putnam, F. W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 390-394 |
| 26. | Antonarakis, S. E., Kazazian, H. H., and Tuddenham, E. G. D. (1995) Hum. Mutat. 5, 1-22 |
| 27. | Klomp, L. W., Farhangrazi, Z. S., Dugan, L. L., and Gitlin, J. D. (1996) J. Clin. Invest. 98, 207-215 |
| 28. | Camakaris, J., Petris, M. J., Bailey, L., Shen, P., Lockhart, P., Glover, T. W., Barcroft, C., Patton, J., and Mercer, J. F. (1995) Hum. Mol. Genet. 4, 2117-2123 |
| 29. | Muniz, M., and Riezman, H. (2000) EMBO J. 19, 10-15 |
| 30. | Petrescu, S. M., Petrescu, A. J., Titu, H. N., Dwek, R. A., and Platt, F. M. (1997) J. Biol. Chem. 272, 15796-15803 |
| 31. | Yuan, D. S., Dancis, A., and Klausner, R. D. (1997) J. Biol. Chem. 272, 25787-25793 |
| 32. | Muniz, M., Morsomme, P., and Riezman, H. (2001) Cell 104, 313-320 |
| 33. | Ellgaard, L., and Helenius, A. (2001) Curr. Opin. Cell Biol. 13, 431-437 |
| 34. | Gow, A., and Lazzarini, R. A. (1996) Nat. Genet. 13, 422-428 |
| 35. | De Jonghe, P., Timmerman, V., Nelis, E., Martin, J., and Van Broeckhoven, C. (1997) J. Peripher. Nerv. Syst. 2, 370-387 |
| 36. | Kopito, R. R., and Ron, D. (2000) Nat. Cell Biol. 2, 207-209 |
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Chen, G. Huang, T. Su, H. Gao, Z. K. Attieh, A. T. McKie, G. J. Anderson, and C. D. Vulpe Decreased Hephaestin Activity in the Intestine of Copper-Deficient Mice Causes Systemic Iron Deficiency J. Nutr., May 1, 2006; 136(5): 1236 - 1241. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Nittis and J. D. Gitlin Role of Copper in the Proteosome-mediated Degradation of the Multicopper Oxidase Hephaestin J. Biol. Chem., June 11, 2004; 279(24): 25696 - 25702. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Mariani, C Arosio, S Pelucchi, M Grisoli, A Piga, P Trombini, and A Piperno Iron chelation therapy in aceruloplasminaemia: study of a patient with a novel missense mutation Gut, May 1, 2004; 53(5): 756 - 758. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. B. Bartnikas and J. D. Gitlin Mechanisms of Biosynthesis of Mammalian Copper/Zinc Superoxide Dismutase J. Biol. Chem., August 29, 2003; 278(35): 33602 - 33608. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Y. Jeong and S. David Glycosylphosphatidylinositol-anchored Ceruloplasmin Is Required for Iron Efflux from Cells in the Central Nervous System J. Biol. Chem., July 11, 2003; 278(29): 27144 - 27148. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Powanda and W. R. Beisel Metabolic Effects of Infection on Protein and Energy Status J. Nutr., January 1, 2003; 133(1): 322S - 327. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. E. Hellman, S. Kono, G. M. Mancini, A. J. Hoogeboom, G. J. de Jong, and J. D. Gitlin Mechanisms of Copper Incorporation into Human Ceruloplasmin J. Biol. Chem., November 22, 2002; 277(48): 46632 - 46638. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Argyropoulos, T. Rankinen, D. R. Neufeld, T. Rice, M. A. Province, A. S. Leon, J. S. Skinner, J. H. Wilmore, D. C. Rao, and C. Bouchard A Polymorphism in the Human Agouti-Related Protein Is Associated with Late-Onset Obesity J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4198 - 4202. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. N. Patel, R. J. Dunn, S. Y. Jeong, Q. Zhu, J.-P. Julien, and S. David Ceruloplasmin Regulates Iron Levels in the CNS and Prevents Free Radical Injury J. Neurosci., August 1, 2002; 22(15): 6578 - 6586. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
