HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 2, 1524-1530, January 11, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/2/1524    most recent M107744200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gasa, R. Articles by Newgard, C. B. Search for Related Content PubMed PubMed Citation Articles by Gasa, R. Articles by Newgard, C. B. Social Bookmarking                      What's this?

Reversal of Diet-induced Glucose Intolerance by Hepatic Expression of a Variant Glycogen-targeting Subunit of Protein Phosphatase-1^*

Rosa Gasa, Catherine Clark, Ruojing Yang, Anna A. DePaoli-Roach^§, and Christopher B. Newgard^¶

From the  Departments of Biochemistry and Internal Medicine and the Touchstone Center for Diabetes Research, University of Texas Southwestern Medical Center, Dallas, Texas 75390 and the ^§ Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana 46202

Received for publication, August 13, 2001, and in revised form, November 7, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Glycogen-targeting subunits of protein phosphatase-1 facilitate interaction of the phosphatase with enzymes of glycogen metabolism. Expression of one family member, PTG, in the liver of normal rats improves glucose tolerance without affecting other plasma variables but leaves animals unable to reduce hepatic glycogen stores in response to fasting. In the current study, we have tested whether expression of other targeting subunit isoforms, such as the liver isoform G_L, the muscle isoform G_M/R_Gl, or a truncated version of G_M/R_Gl termed G_MC in liver ameliorates glucose intolerance in rats fed on a high fat diet (HF). HF animals overexpressing G_MC, but not G_L or G_M/R_Gl, exhibited a decline in blood glucose of 35-44 mg/dl relative to control HF animals during an oral glucose tolerance test (OGTT) such that levels were indistinguishable from those of normal rats fed on standard chow at all but one time point. Hepatic glycogen levels were 2.1-2.4-fold greater in G_L- and G_MC-overexpressing HF rats compared with control HF animals following OGTT. In a second set of studies on fed and 20-h fasted HF animals, G_MC-overexpressing rats lowered their liver glycogen levels by 57% (from 402 ± 54 to 173 ± 27 µg of glycogen/mg of protein) in the fasted versus fed states compared with only 44% in G_L-overexpressing animals (from 740 ± 35 to 413 ± 141 µg of glycogen/mg of protein). Since the OGTT studies were performed on 20-h fasted rats, this meant that G_MC-overexpressing rats synthesized much more glycogen than G_L-overexpressing HF rats during the OGTT (419 versus 117 µg of glycogen/mg of protein, respectively), helping to explain why G_MC preferentially enhanced glucose clearance. We conclude that G_MC has a unique combination of glycogenic potency and responsiveness to glycogenolytic signals that allows it to be used to lower blood glucose levels in diabetes.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Hepatic glycogen storage is impaired in all major forms of diabetes, contributing to the development of hyperglycemia (1-3). This suggests that one possible means of improving glycemic control might be to enhance glucose disposal by stimulating hepatic glycogen synthesis. One method for increasing liver glycogen content is to increase the activity of the glucose phosphorylating enzyme, glucokinase. Indeed, overexpression of this enzyme in liver of normal rats (4) or mice (5, 6) lowers blood glucose levels with a commensurate increase in glycogen stores. However, these changes are accompanied by increases in circulating free fatty acids, triglycerides, and lactate (4), consistent with the large increase in glycolytic flux caused by overexpression of glucokinase in hepatocytes or hepatoma cells (7, 8).

More specific stimulation of glycogen synthesis in liver may be achievable by manipulation of the expression of proteins that function distal to the glucose phosphorylation step. In particular, recent studies have highlighted an important role for glycogen-targeting subunits of protein phosphatase-1 (PP-1)¹ in spatial organization and regulation of glycogen metabolism (9). Prominent members of this gene family include G_M or R_Gl (hereafter referred to as G_M/R_Gl), expressed primarily in striated skeletal muscle (10), G_L, expressed primarily in liver (11), and protein targeting to glycogen (PTG) (12, 13) and PPPR6 (14), expressed in a wide range of tissues. These proteins bind to glycogen and protein phosphatase-1 and have differential capacities for binding to glycogen synthase, glycogen phosphorylase, and phosphorylase kinase (9-14).

It has become apparent that a major challenge inherent in considering glycogen-targeting subunits as molecules for enhancing hepatic glucose disposal is to choose or design a protein with the optimal combination of regulatory features. Thus, overexpression of glycogen-targeting subunits reveals that all family members tested stimulate glycogen deposition in rat hepatocytes but with clear differences in potency in the order G_L > PTG > G_M/R_Gl (15). Cells with overexpressed targeting subunits also exhibit differences in response to glycogenolytic agents such as glucagon and forskolin in the order (from more to less responsive) of G_M/R_Gl > G_L  PTG (15, 16). To date, we have performed one in vivo study in which hepatic overexpression of PTG in normal rats was shown to improve glucose tolerance without perturbation of lipid homeostasis (17). However, these animals also had markedly elevated liver glycogen levels in the fed state and almost no reduction in hepatic glycogen stores in response to an overnight fast, suggesting that they might be more susceptible to perturbations in glycemic control during prolonged fasting, sustained exercise, or other stressful circumstances.

These findings have recently led us to design and test a novel form of glycogen-targeting subunit derived from G_M/R_Gl (16). Native G_M/R_Gl is distinct from other members of its gene family in that it contains two consensus sequences for protein kinase A-mediated serine phosphorylation. One of these sites resides within the PP-1 binding site of G_M/R_Gl, and its phosphorylation leads to dissociation of the phosphatase, contributing to inactivation of glycogen synthesis (10, 18, 19). G_M/R_Gl is also distinguished from other targeting subunits by virtue of its large C terminus that includes a hydrophobic domain that mediates binding of the protein to sarcoplasmic reticulum in muscle (10, 20). Removal of 735 C-terminal amino acids from native G_M/R_Gl yields a 275-amino acid molecule that we have termed G_MC that can be directly aligned with the similarly sized native G_L and PTG proteins. Overexpression of G_MC and native G_M/R_Gl in hepatocytes reveals that the former protein is more effective at stimulating glycogen synthesis (16). Moreover, unlike PTG- or G_L-overexpressing cells, cells with G_MC overexpression retain responsiveness to glycogenolytic signals such as forskolin or lowering of media glucose concentrations. These promising findings have led us, in the current study, to compare the metabolic impact of G_MC, G_L, and G_M/R_Gl overexpression in whole animals. These studies have been performed in rats fed on a high fat diet for 7 weeks to cause a syndrome of insulin resistance and glucose intolerance such as is seen in early stage type 2 diabetes. We find that G_MC is unique among the molecules tested in its capacity to reverse diet-induced glucose intolerance.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Animal Maintenance and Administration of Recombinant Adenoviruses-- All procedures were carried out in accordance with animal care guidelines of the University of Texas Southwestern Medical Center at Dallas and the National Research Council. Male Wistar rats (Charles River Laboratories, Wilmington, MA and Harlan Tekland Laboratory, Winfield, IA) weighing 175-200 g were housed on a 12-h light-dark cycle and were allowed free access to water and either standard laboratory chow (65% carbohydrate, 4% fat, 24% protein; Harlan Tekland Laboratory diet 7001) or high fat diet (19% lard, 1% corn oil; Harlan Tekland Laboratory diet 96001) unless otherwise specified. The rats were housed under these conditions for 7 weeks before adenovirus administration. Rats were treated with cyclosporin (15 mg/kg; Calbiochem) for 3 consecutive days starting on the day prior to adenovirus administration and Depo-Medrol (1.5 mg/kg; Pharmacia & Upjohn, Kalamazoo, MI) on the day of adenoviral treatment. The preparation and testing of recombinant adenoviruses containing the cDNAs encoding G_L (AdCMV-G_L), G_M/R_Gl (AdCMV-G_M/R_Gl), a truncated form of G_M/R_Gl with its 735 C-terminal amino acids deleted (AdCMV-G_MC), or -galactosidase (AdCMV-GAL) have been described previously (15-17, 21). Aliquots of these viruses were amplified and purified for the current study as described previously (22). Between 0.5 and 1.5 × 10¹² recombinant adenovirus particles were administered via tail vein injection to rats anesthetized with Nembutal (50 µg/g of body weight intraperitoneally; Abbott Laboratories, North Chicago, IL) or a 50:5:1 mixture of ketamine (Avoco, Fort Dodge, IA), Rompun (Avoco), and acepromazine (Haver, Shawnee, KS) as described elsewhere (4, 23). After viral administration, animals were individually caged to allow monitoring of food intake and body weight before initiation of experiments.

Animal Studies-- Two experimental protocols were performed. In the first, animals were infused with AdCMV-G_L, AdCMV-G_M/R_Gl, AdCMV-G_MC, or AdCMV-GAL viruses. Ninety hours after virus administration, animals were fasted for 20 h with free access to water. An oral glucose tolerance test (OGTT) was performed by anesthetizing animals with Nembutal (50 µg/g of body weight intraperitoneally) and administration of a bolus of 2 g of glucose/kg of body weight by gavage of a 45% solution of glucose in water. Blood samples (~20 µl/sample from the tail vein) were collected immediately before administration of the bolus and at 30, 60, 90, 120, 150, and 180 min after the bolus for measurement of circulating glucose concentrations. Animals were sacrificed immediately after the 180-min time point for collection of blood and liver. The liver samples were rapidly frozen in liquid nitrogen and stored at 70 °C until further analysis. In the second protocol, animals were infused with AdCMV-G_L, AdCMV-G_MC, or AdCMV-GAL viruses. Ninety hours after virus administration, animals were either fasted for 20 h or allowed to continue feeding ad libitum. Thereafter, all animals were anesthetized with Nembutal (50 µg/g of body weight intraperitoneally), blood samples were taken, and liver was excised and rapidly frozen in liquid nitrogen and stored at 70 °C until further analysis.

Measurement of Glycogen-targeting Subunit Expression in Liver or Muscle by Semiquantitative Multiplex RT-PCR-- The procedure used was based on methods described previously (15, 17). Total RNA was extracted from powdered liver or muscle tissue using RNeasy spin columns (Qiagen Inc., Valencia, CA) following the instructions of the manufacturer. First-strand cDNA was prepared using 0.5 µg of total RNA, the Superscript RT kit, and random hexamer primers (Invitrogen) according to the instructions of the manufacturer. The cDNA was diluted 1:6 in distilled water, and PCR was carried out using 5 µl of the diluted cDNA and a PCR mix containing Taq DNA polymerase (2.5 units) and buffer (Promega Corp., Madison, WI), dNTP mix (final concentrations of 40 mM of each dNTP except dCTP, which was present at 20 mM; Invitrogen) and with or without 1.25 µCi of [-³³P]dCTP (2,000 Ci/mmol; PerkinElmer Life Sciences) in a 25-µl reaction volume. Four primer sets (5 pmol of each primer) were used in these studies. The first set specifically amplified a 181-bp fragment from the G_L transgene and did not amplify endogenous rat G_L because the upstream primer hybridizes to 5' untranslated sequence derived from the adenovirus vector (5' primer, CGAGCTCGGTACCAACTTC; 3' primer, GAAGGTGAAGCGCTCTCTG). The second set amplified a 162-bp product from either the full-length endogenous G_M/R_Gl or G_MC transgene as described previously (15). The third oligonucleotide pair specifically amplified a 900-bp fragment of G_MC derived by expression from the AdCMV-G_MC adenovirus because the upstream primer hybridizes to sequence within the G_MC cDNA sequence, while the 3' primer hybridizes to the 3' untranslated region derived from the adenovirus vector (5' primer, CTCAAAGGAAGATCTTATGCAAC; 3' primer, GGTAGTTTGTCCAATTATGTCAC). The last oligonucleotide pair amplified one of the following as internal standards: a 186-bp fragment of the endogenous TATA-binding protein transcript, a 201-bp fragment of the elongation factor-1 (EF-1) mRNA (17), or a 250-bp fragment of the -tubulin gene (5' primer, GCGTGAGTGTATCTCCATCCA; 3' primer, GGTAGGTGCCAGTGCGAACTT). In experiments involving inclusion of [-³³P]dCTP, PCR conditions were an initial incubation at 95 °C for 5 min followed by 22 or 24 cycles (the latter only when studying full-length G_M/R_Gl transgene expression) of 95 °C for 45 s, 55 °C for 30 s, and 72 °C for 30 s. The final PCR products were mixed with 98% formamide denaturing loading buffer and separated on a 6% (w/v) polyacrylamide gel containing 7 M urea. The gel was subsequently dried and exposed to a PhosphorImager screen, and the resulting scan was analyzed using ImageQuant from Molecular Dynamics (Sunnyvale, California). In the experiments designed to assess expression of the G_MC transgene in extrahepatic tissues, PCRs were carried out in the absence of [-³³P]dCTP. For these experiments, PCR conditions were an initial incubation at 95 °C for 1 min followed by 30 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min. 5 µl of the PCR product was resolved on an agarose gel, and products were visualized by incubation of the gel with 0.6 µg/ml ethidium bromide.

Plasma and Tissue Analysis-- Plasma insulin levels were measured by radioimmunoassay (Linco Research, St. Charles, MO). Plasma triglyceride, ketone, and lactate levels were measured using kits from Sigma Chemical Co. Plasma free fatty acids were measured using a kit from Roche Molecular Biochemicals. Plasma glucose was measured using a HemoCue Glucose Analyzer (HemoCue AB, Angelholm, Sweden). Liver glycogen content was measured by an amyloglucosidase-based assay as described elsewhere (24).

Statistical Analysis-- Data are expressed as the mean ± S.E. Statistical significance was determined by unpaired Student's t test using the statistics module of Microsoft Excel (version 5.0; Microsoft Corp., Redmond, WA). Statistical significance was assumed at p < 0.05.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Expression of Glycogen-targeting Subunits in Rat Liver-- Adenovirus-mediated expression of the various glycogen-targeting subunit isoforms in liver was evaluated by semiquantitative multiplex RT-PCR analysis in animals fed on the high fat diet (HF). A representative gel is shown in Fig. 1A. Animals treated with AdCMV-GAL exhibited either no signal or background at the positions expected for the reverse-transcribed and amplified fragments of G_L, G_MC, or G_M/R_Gl. Rats infused with AdCMV-G_L, AdCMV-G_M/R_Gl, or AdCMV-G_MC showed clear expression of the respective transgene mRNAs. When normalized to the internal control, TATA-binding protein, G_L and G_MC mRNA levels were found to be indistinguishable and ~3-fold greater than the levels of G_M/R_Gl transgene RNA (Fig. 1B). The lower apparent efficiency of G_M/R_Gl overexpression relative to the other two targeting subunits is consistent with our previous findings in isolated hepatocytes (15, 16). No attempt could be made to correct for the clearly lower level of G_M/R_Gl expression since infusion of higher viral titers began to have toxic effects as assessed by an increase in the activity of a liver enzyme, aspartyl aminotransferase (PGOT) in the blood of these animals (data not shown). It should also be pointed out that our main goal was to compare the highly glycogenic targeting subunit G_L with our novel construct G_MC.

View larger version (69K): [in this window] [in a new window]   Fig. 1.   Expression of the GL, GM/RGl, and GMC transgenes in liver after OGTT. Male Wistar rats were fed a high fat diet for 7 weeks. At the end of this period, animals were treated with the AdCMV-GAL, AdCMV-GL, AdCMV-GM/RGl, or AdCMV-GMC adenoviruses and allowed to feed ad libitum for 90 h after viral administration. Animals were then fasted for 20 h before receiving an oral glucose bolus of 2 g/kg of body weight. Animals were sacrificed 180 min after the oral glucose challenge for collection of liver samples. A portion of these samples was used to prepare total RNA and to examine transgene expression by multiplex PCR as described under "Materials and Methods." A, representative gel displaying RT-PCR results for two to four animals in each treatment group. TATA-binding protein (TBP) was used as an internal control. Note that endogenous GL was not amplified as primers specific for the GL transgene were used. B, quantitative analysis of the ratio of each transgene:TATA-binding protein (TBP) for all animals included in the OGTT protocol. Data represent mean ± S.E. for a total of six GL-, seven GM/RGl-, and seven GMC-overexpressing animals. Symbols * and *** indicate significant differences between the GMC- and GL-overexpressing groups relative to the GM/RGl-overexpressing group with levels of significance of p < 0.05 and p < 0.0001, respectively. Expression levels in the GL- and GMC-overexpressing groups were not significantly different.

OGTT in Wistar Rats with Adenovirus-mediated G_L, G_MC, or G_M/R_Gl Overexpression in Liver-- To test the capacity of the various glycogen-targeting subunits to improve glucose homeostasis, we performed OGTTs in the HF animals evaluated for targeting subunit expression in Fig. 1 as well as a group of rats that were fed on normal chow and infused with AdCMV-GAL. As shown in Fig. 2, AdCMV-GAL-treated animals fed on normal chow had normal glucose tolerance with a rapid decline of blood glucose from a maximum of 170 mg/dl at 30 min after the glucose load and a return to basal levels by 150 min. In sharp contrast, AdCMV-GAL-treated HF rats were clearly glucose-intolerant with a higher excursion of blood glucose to a peak value of 210 mg/dl at 60 min after the glucose bolus and a slow decline thereafter that failed to approach baseline values by 180 min. Surprisingly, HF rats treated with AdCMV-G_M/R_Gl or AdCMV-G_L exhibited no significant improvement in glucose tolerance during OGTT. In contrast, HF animals treated with AdCMV-G_MC had glucose levels indistinguishable from those of AdCMV-GAL-treated rats fed on normal chow, except at 150 min where glucose was slightly elevated compared with the standard chow controls but still lower than that in the other three treatment groups.

View larger version (27K): [in this window] [in a new window]   Fig. 2.   Oral glucose tolerance test. Animals were treated as described in the legend for Fig. 1. Tail vein blood samples were taken, and glucose levels were measured at the indicated times after the glucose bolus. Data are mean ± S.E. for 12 -galactosidase (GAL)-, six GL-, seven GM/RGl-, and seven GMC-overexpressing animals. The symbol * indicates those time points at which blood glucose levels were significantly lower in HF AdCMV-GMC-treated rats versus HF AdCMV-GAL-treated controls with p < 0.05. A second control group of animals fed a standard chow diet for 7 weeks and infused with AdCMV-GAL (std. chow, n = 8) was also included in this protocol. Note that GMC-overexpressing animals had glucose levels indistinguishable from those of standard chow-fed control animals with the exception of one time point (#, p < 0.01).

Effects of G_L, G_MC, or G_M/R_Gl Overexpression on Liver Glycogen following OGTT-- To determine whether the differential effects of the various glycogen-targeting subunits on glucose levels in the OGTT were related to glycogen deposition, liver glycogen levels were measured in animals at the conclusion of the experiment (180-min time point) summarized in Fig. 2. Fig. 3 shows that high fat feeding per se did not increase liver glycogen stores relative to feeding with normal chow (both of these control groups were treated with AdCMV-GAL). Treatment of HF rats with AdCMV-G_M/R_Gl did not enhance glycogen accumulation compared with either control group. However, treatment of HF animals with AdCMV-G_L or AdCMV-G_MC resulted in 108 and 138% increases in liver glycogen, respectively, relative to the AdCMV-GAL-treated HF controls. Thus, both G_L- and G_MC-overexpressing animals had higher liver glycogen levels following OGTT, but only the AdCMV-G_MC-treated rats had improved glucose tolerance.

View larger version (32K): [in this window] [in a new window]   Fig. 3.   Liver glycogen levels after the OGTT. Animals were sacrificed for collection of liver samples at the 180-min point of the OGTT shown in Fig. 2. Data represent mean ± S.E. for six GL-, seven GM/RGl-, and seven GMC-overexpressing HF rats and 12 -galactosidase-overexpressing HF (GAL) and eight -galactosidase-overexpressing standard chow-fed (GAL/std. chow) rats. The symbols * and ** indicate that GL- and GMC-overexpressing animals stored more glycogen than HF -galactosidase controls with levels of significance of p < 0.001 and p < 0.05, respectively.

Effects of Glycogen-targeting subunit Overexpression on Circulating Metabolites and Hormones after OGTT-- A large aliquot of blood was collected from animals at the conclusion of the OGTT experiment summarized in Fig. 2 (180-min time point), allowing several plasma variables to be measured. As summarized in Table I, in HF animals, overexpression of the various glycogen-targeting subunit isoforms had no effect on circulating free fatty acids, ketones, lactate, or insulin relative to AdCMV-GAL-treated controls. Treatment of animals with AdCMV-G_L or AdCMV-G_M/R_Gl also did not alter circulating triglyceride (TG) levels. However, AdCMV-G_MC treatment did cause an 80% increase in TG levels relative to those of AdCMV-GAL-treated controls that was significant at the level of p = 0.045. 

View this table: [in this window] [in a new window]   Table I Plasma variables in AdCMV-GAL-, AdCMV-GL-, AdCMV-GM/RGl-, and AdCMV-GMC-treated rats after the OGTT protocol Male Wistar rats were fed a high fat diet for 7 weeks. At the end of this period, animals received the AdCMV-GAL, AdCMV-GL, AdCMV-GM/RGl, or AdCMV-GMC adenoviruses and were allowed to feed ad libitum for 90 h after viral administration. Animals were then fasted for 20 h before receiving an oral glucose bolus (2 g/kg). Blood samples were collected after the 180-min time point of the OGTT for analysis of the indicated plasma variables. Data are mean ± S.E. for the number of animals indicated in each group. The symbol * indicates a significant difference compared to the AdCMV-GAL-treated control group with p = 0.045. FFAs, free fatty acids.

Reversal of Glucose Intolerance in AdCMV-G_MC-infused Rats Is Not Due to "Leaky" Expression of the Transgene in Muscle-- In previous studies involving systemic infusion of recombinant adenoviruses to deliver the glucokinase or glucose-6-phosphatase genes in rats, we found no evidence of transgene expression in extrahepatic tissues such as muscle, fat, brain, or kidney and only very low levels of expression in lung (4, 28). However, even modest expression of targeting subunits in a large tissue mass such as muscle could potentially affect the conclusions of the current study. To eliminate this possibility, we used RT-PCR to measure expression of the G_MC transcript in liver and skeletal muscle of AdCMV-GAL- and AdCMV-G_MC-infused animals. This assay used an oligonucleotide pair that specifically amplifies the transcript derived from the adenovirus construct and not endogenous G_M/R_Gl. As a positive control, treatment of 293 cells with AdCMV-G_MC and RT-PCR analysis of RNA derived from such cells resulted in amplification of a band of the predicted size of 900 nucleotides (Fig. 4). RT-PCR analysis was also performed on RNA isolated from liver and muscle samples taken from three AdCMV-GAL- or three AdCMV-G_MC-treated rats subjected to OGTT. As shown in Fig. 4, a band of the same size as that in the AdCMV-G_MC-treated 293 cells was clearly detected in liver samples of AdCMV-G_MC-treated, but not AdCMV-GAL-treated, rats. However, a band of this size was not amplified from muscle RNA regardless of whether the animals were treated with AdCMV-G_MC. These findings clearly demonstrate that the improved glucose tolerance reported in Fig. 2 is due to expression of G_MC in liver and not in muscle.

View larger version (37K): [in this window] [in a new window]   Fig. 4.   RT-PCR analysis of GMC transgene expression in liver and muscle. Oligonucleotides specific to the GMC gene product expressed from the AdCMV-GMC adenovirus or, as an internal control, to -tubulin were used for multiplex RT-PCR analysis of liver and muscle samples from a subset of the animals used for OGTT as described in Figs. 1-3. As an additional control, the same oligonucleotides were used to analyze an RNA sample from cultured 293 cells treated with AdCMV-GMC. Note that a band of 900 bp (labeled GMC Transgene), as predicted only in cells with adenovirus-mediated expression of GMC, is found in liver of AdCMV-GMC-treated rats or in 293 cells treated with this virus but not in liver samples from AdCMV-GAL-treated rats or in any of the muscle samples.

Regulation of Glycogen Metabolism in Response to Fasting and Feeding in HF Rats with Hepatic Overexpression of Glycogen-targeting Subunits-- In an effort to better understand the differential effects of G_MC and G_L overexpression on glucose tolerance (Fig. 2), we next studied liver glycogen levels in fed and fasted HF animals treated with AdCMV-G_MC or AdCMV-G_L. Multiplex RT-PCR analysis of transgene expression levels in these animals is summarized in Fig. 5. In both the AdCMV-G_L- and AdCMV-G_MC-treated groups, transgene expression tended to be lower in fasted animals, but this difference was not significant in either group. Comparison of G_MC to G_L mRNA levels in fed versus fed or fasted versus fasted groups also revealed no significant differences.

View larger version (23K): [in this window] [in a new window]   Fig. 5.   Expression of the GL and GMC transgenes in liver of fasted and ad libitum fed rats. Animals were treated as described in the legend to Fig. 1 with either the AdCMV-GL or AdCMV-GMC adenoviruses. 90 h after virus infusion, animals were either allowed to continue feeding ad libitum on the high fat diet (white bars) or were fasted for 20 h (dark bars). Livers were collected, and transgene expression was measured by multiplex RT-PCR. Band intensities were normalized to EF-1 as the internal control. Results represent mean ± S.E. for the following number of animals: fed GL, n = 8; fasted GL, n = 5; fed GMC, n = 10; fasted GMC, n = 11. No significant differences were found when comparing expression levels in fed and fasted animals within a virus treatment group or when comparing fed to fed or fasted to fasted animals between viral treatment groups.

As shown in Fig. 6, AdCMV-GAL-treated HF rats contained 317 ± 46 µg of glycogen/mg of protein in the fed state and depleted this reserve by 68%, to 103 ± 15 µg of glycogen/mg of protein, in response to a 20-h fast. Interestingly, fed AdCMV-G_L-treated rats accumulated 740 ± 35 µg of glycogen/mg of protein, 2.3 times more than fed AdCMV-GAL-treated controls, and were only able to lower glycogen by 44% in response to fasting to a level of 413 ± 141 µg of glycogen/mg of protein. In sharp contrast, fed AdCMV-G_MC-treated rats contained 402 ± 54 µg of glycogen/mg of protein in liver and reduced their glycogen stores by 57% in response to the 20-h fast to 173 ± 27 µg of glycogen/mg of protein, a value slightly higher than that in fasted AdCMV-GAL-treated controls. Importantly, the liver glycogen level in fasted AdCMV-G_L-treated rats was 80% of that in AdCMV-G_L-treated rats following OGTT. In contrast, liver glycogen content in fasted AdCMV-G_MC-treated rats was only 29% of that in AdCMV-G_MC-treated rats following OGTT. In other words, AdCMV-G_MC-treated rats synthesized 419 µg of glycogen/mg of protein during the OGTT compared with an increment of only 117 µg of glycogen/mg of protein in AdCMV-G_L-treated animals (values obtained by subtracting the glycogen levels in fasted rats shown in Fig. 6 from the glycogen levels after OGTT shown in Fig. 3; note that animals were fasted for 20 h prior to OGTT). This suggests that the differential potency of G_MC and G_L for lowering of blood glucose in glucose-intolerant HF rats may have been due in part to the high basal glycogen levels in G_L-overexpressing rats that impaired further glycogen storage during OGTT.

View larger version (24K): [in this window] [in a new window]   Fig. 6.   Liver glycogen levels in fasted and ad libitum fed rats. Animals were treated as described in the legend to Fig. 1. 90 h after virus administration, animals were either allowed to continue feeding ad libitum (white bars) or were fasted for 20 h (dark bars). Liver samples were taken for measurement of glycogen content. Results are mean ± S.E. for the following number of animals: fed GL, n = 8; fasted GL, n = 5; fed GMC, n = 10; fasted GMC, n = 11. The symbols ** and *** denote differences between the indicated groups at levels of significance of p < 0.01 and p < 0.0001, respectively.

Effects of Glycogen-targeting Subunit Overexpression on Circulating Metabolites and Hormones in Fasted and Fed Rats-- The same group of plasma variables assayed after OGTT (Table I) was measured in fed and 20-h fasted HF rats treated with the various recombinant adenoviruses (Table II). Animals treated with AdCMV-GAL, AdCMV-G_L, or AdCMV-G_MC all showed expected changes in plasma glucose, free fatty acids, lactate, and ketones as a function of fasting and feeding. Insulin levels remained high in the fasted state in all three groups of animals, but this is not unexpected given the known effect of high fat feeding to cause insulin resistance and consequent fasting hyperinsulinemia (23). Circulating TGs were more than twice as high in fed compared with fasted AdCMV-GAL- or AdCMV-G_MC-treated rats. However, in AdCMV-G_L-treated animals, TG remained low in the fed state and was indistinguishable from fasted values. Lactate levels in fasted AdCMV-G_L-infused rats were also lower than in AdCMVG_MC- or AdCMV-GAL-treated animals (p < 0.05).

View this table: [in this window] [in a new window]   Table II Plasma variables in fed and fasted AdCMV-GAL-, AdCMV-GL-, and AdCMV-GMC-treated rats Animals were treated as described in the legend to Table I. 90 h after virus administration, animals were either allowed to continue feeding ad libitum on the high fat diet or were fasted for 20 h. Blood was collected for analysis of the indicated plasma variables. Results represent means ± S.E. for the indicated number of animals in each group. The symbol * indicates variables that are statistically different from the corresponding AdCMV-GAL-treated group with p  0.05. FFAs, free fatty acids.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Regulation of carbohydrate metabolism in liver is perturbed in type 2 diabetes, resulting in increased hepatic glucose production. Factors contributing to this imbalance include increased gluconeogenesis and impairment of hepatic glycogen storage. One approach to improving hepatic glucose balance in diabetes might be to increase the glycolytic rate or, conversely, to decrease the rate of gluconeogenesis. Consistent with this idea, hepatic overexpression of glucokinase (4-6, 25) or 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (26) has been shown to lower blood glucose levels in normal or diabetic animals. Furthermore, overexpression of phosphoenolpyruvate carboxykinase (27), the glucose-6-phosphatase catalytic subunit (28), or the transcriptional co-activator PGC-1, which stimulates expression of the genes encoding several gluconeogenic enzymes (29), all result in hyperglycemia. However, overexpression of glucokinase or 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase results in increases in the levels of circulating lipids (4, 26), raising the concern that therapies that enhance glycolytic rate may also exacerbate the hyperlipidemia associated with type 2 diabetes. It has also been surprising to learn that liver-specific knockout of phosphoenolpyruvate carboxykinase has minimal effects on glucose homeostasis but causes hepatic steatosis (30), suggesting an important role for this enzyme in integration of carbohydrate and lipid metabolism that may preclude its use as a target in diabetes therapy.

In light of the potential complications associated with drugs directed at enzymes of glycolysis or gluconeogenesis, our group has been investigating the utility of glycogen-targeting subunits of protein phosphatase-1 for lowering of blood glucose in diabetes. The advantage of this approach would be to stimulate glucose disposal by diverting it into an inert storage polymer, glycogen, and away from the glycolytic pathway. Some support for the concept was gained in studies involving overexpression of PTG in liver of normal rats fed on standard chow, which resulted in a modest improvement in oral glucose tolerance and no discernable perturbation of lipid homeostasis (17). However, these animals had significant increases in hepatic glycogen stores in the fed state and, of greater concern, failed to lower glycogen levels in response to fasting, thus resembling patients with glycogen storage diseases.

More recently we have learned that the various glycogen-targeting subunit isoforms affect regulation of glycogen and glucose metabolism in different ways when overexpressed in isolated hepatocytes. One set of studies revealed that while overexpression of the muscle-specific isoform G_M/R_Gl had the weakest effect on glycogen synthesis, it also allowed cells to retain appropriate regulation of glycogenolysis by forskolin, a property not equally shared by cells with overexpressed PTG or G_L (15). These findings led us to investigate the possibility that the glycogenic impact of G_M/R_Gl could be improved by deletion of its unique C-terminal tail that includes a putative sarcoplasmic reticulum association domain. To this end, we prepared a truncated form of G_M/R_Gl (G_MC) and demonstrated that its overexpression in hepatocytes had a more potent glycogenic effect than native G_M/R_Gl but with retention of glycogenolytic responsiveness to forskolin, a fall in media glucose, or the combination of both glycogenolytic signals (16).

These in vitro findings led us to compare, in the current study, the metabolic effects of hepatic overexpression of G_MC, native G_M/R_Gl, and the most glycogenic of all the targeting subunits, G_L. These studies were performed in Wistar rats fed on a high fat diet for a period of 7 weeks, a regimen that causes a syndrome resembling early stage type 2 diabetes, including glucose intolerance, mild fasting hyperglycemia, insulin resistance, hyperinsulinemia, increased circulating and tissue lipids, and hyperleptinemia (23). This study reveals that at similar levels of overexpression in liver, G_MC but not G_L lowers blood glucose levels toward normal during OGTT in insulin-resistant, glucose-intolerant, HF rats. Native G_M/R_Gl, which consistent with our previous findings could not be overexpressed as efficiently as the other targeting isoforms (15, 16), also did not improve glucose tolerance.

The explanation for the difference in effect of G_MC and G_L appears to be that animals with overexpressed G_MC experience a larger increment in hepatic glycogen storage during OGTT than animals with overexpressed G_L, probably related to the much higher fasting liver glycogen levels in the latter group. Thus, at the time that the OGTT begins in fasted G_L-overexpressing animals, liver glycogen levels are already higher than in the fed state in AdCMV-GAL controls, probably limiting the further capacity for glycogen storage. In contrast, fasted G_MC-overexpressing animals have levels of liver glycogen that are only slightly higher than fasted AdCMV-GAL controls and are also able to store much more during the subsequent OGTT than the controls due to the glycogenic effect of the overexpressed targeting subunit. Interestingly, liver glycogen content in fed G_MC-overexpressing rats was slightly but not significantly higher than that in AdCMV-GAL-treated controls. This suggests that glycogen metabolism is regulated in a near-normal fashion during typical physiologic cycles (e.g. overnight fasting and feeding) but that G_MC contributes to enhanced efficiency of glucose disposal when the system is challenged, such as during the OGTT experiment. Consistent with this notion, plasma variables such as glucose, insulin, free fatty acids, and TG were normal in ad libitum fed and 20-h fasted G_MC-overexpressing rats. Thus, the new G_MC molecule appears to combine just the right level of glycogenic potency with retention of sensitivity to diverse glycogenolytic signals, allowing it to minimally perturb fuel homeostasis under normal conditions but to assist in disposing of a glucose load in otherwise glucose-intolerant animals.

What then is the real therapeutic potential of the approach outlined here? One important concern is that while hepatic overexpression of G_MC appears to ameliorate glucose intolerance induced by high fat feeding, it does not reduce the high fasting insulin levels in these animals (Table II). We have previously shown that the elevated insulin levels in rats fed on the high fat diet is linked to insulin resistance and that insulin levels can be normalized in these animals by infusion of a recombinant adenovirus containing the leptin cDNA (23). One mechanism by which G_MC might have reversed insulin resistance is via activation of fatty acid oxidation in liver to compensate for the diversion of glucose away from glycolysis and oxidative pathways and into the glycogen storage pathway. If liver becomes more dependent on fat for energy production as a result of G_MC overexpression, this could potentially enhance mobilization of lipids from peripheral tissues such as muscle and fat. Given the correlation between intramyocellular lipid stores and insulin resistance (31, 32), this could ultimately lead to an increase in insulin sensitivity. Perhaps the duration of transgene expression in the current study (5 days) was simply too short to reveal such an effect, or alternatively, an improvement in insulin sensitivity occurred that was not linked to a fall in circulating insulin levels. Further work will be required to test these possibilities. Until such work is carried out, our method should be treated simply as a means of improving glucose tolerance.

The contrasting effects of G_L and G_MC overexpression on circulating TG levels also deserve mention. G_MC-overexpressing animals experienced a mild elevation in TG following OGTT but had normal TG levels in the ad libitum fed or fasted states, while G_L-overexpressing rats had decreased TG levels in the fed state. Interestingly, G_L but not G_MC overexpression caused fat to accumulate in liver.² This may be related to the tendency to saturate hepatic glycogen stores in G_L-overexpressing animals but not G_MC-overexpressing animals, which in turn may have modulated hepatic lipid metabolism and/or mobilization of lipids from peripheral tissues. These issues will require further investigation.

It is also unclear how G_MC or a related activity might be introduced into liver of patients with diabetes. Current viral and nonviral methods for hepatic gene delivery are not sufficiently robust or safe for human therapy. Until gene delivery methods are improved, a better approach may be to develop drugs that interact with endogenous targeting subunit isoforms. This will require a better understanding of the structure/function relationships that govern isoform-specific function (progress in this area has been recently reviewed in Ref. 9). Such insights may ultimately allow the differences in glycogenic potency on the one hand and the differential responses to glycogenolytic signals on the other to be understood in terms of protein domains that can be specifically targeted with small molecules. It is interesting to note that the group of Treadway and associates (33) has reported on the use of a small molecule inhibitor of liver glycogen phosphorylase in lowering of blood glucose levels in diabetic rodents. Surprisingly, this agent did not cause hypoglycemia even in normal fasted animals. With our approach it appears even less likely that hypoglycemia would occur given that we are stimulating hepatic glucose disposal rather than inhibiting glucose production while leaving regulation of glycogen phosphorylase largely intact. Further testing of both approaches under more stressful conditions will be required.

	ACKNOWLEDGEMENTS

We are grateful to Kimberly Jones-Ross and Paul Anderson for expert technical assistance and Dr. Per Bo Jensen for assistance with multiplex RT-PCR.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant P01 DK58398 (to C. B. N.) and DK36569 (to A. A. D.-R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed: Touchstone Center for Diabetes Research, Rm. Y8.212, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd., Dallas, TX 75390. Fax: 214-648-9191; E-mail: newgard@utsw.swmed.edu.

Published, JBC Papers in Press, November 13, 2001, DOI 10.1074/jbc.M107744200

² C. Clark, J. Donkor, and R. Fehn, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: PP-1, protein phosphatase-1; PTG, protein targeting to glycogen; HF, high fat diet; OGTT, oral glucose tolerance test; RT, reverse transcription; TG, triglyceride.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Pautsch, N. Stadler, O. Wissdorf, E. Langkopf, W. Moreth, and R. Streicher Molecular Recognition of the Protein Phosphatase 1 Glycogen Targeting Subunit by Glycogen Phosphorylase J. Biol. Chem., April 4, 2008; 283(14): 8913 - 8918. [Abstract] [Full Text] [PDF]

				Y.-B. Kim, O. D. Peroni, W. G. Aschenbach, Y. Minokoshi, K. Kotani, A. Zisman, C. R. Kahn, L. J. Goodyear, and B. B. Kahn Muscle-Specific Deletion of the Glut4 Glucose Transporter Alters Multiple Regulatory Steps in Glycogen Metabolism Mol. Cell. Biol., November 1, 2005; 25(21): 9713 - 9723. [Abstract] [Full Text] [PDF]

				J. J. Collier and D. K. Scott Sweet Changes: Glucose Homeostasis Can Be Altered by Manipulating Genes Controlling Hepatic Glucose Metabolism Mol. Endocrinol., May 1, 2004; 18(5): 1051 - 1063. [Abstract] [Full Text] [PDF]

				H. CEULEMANS and M. BOLLEN Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button Physiol Rev, January 1, 2004; 84(1): 1 - 39. [Abstract] [Full Text] [PDF]

				C. C. Greenberg, K. N. Meredith, L. Yan, and M. J. Brady Protein Targeting to Glycogen Overexpression Results in the Specific Enhancement of Glycogen Storage in 3T3-L1 Adipocytes J. Biol. Chem., August 15, 2003; 278(33): 30835 - 30842. [Abstract] [Full Text] [PDF]

				R. Yang and C. B. Newgard Hepatic Expression of a Targeting Subunit of Protein Phosphatase-1 in Streptozotocin-diabetic Rats Reverses Hyperglycemia and Hyperphagia Despite Depressed Glucokinase Expression J. Biol. Chem., June 20, 2003; 278(26): 23418 - 23425. [Abstract] [Full Text] [PDF]

This Article