 |
INTRODUCTION |
Among the signaling pathways known to date, the transcription
factor NF-
B is one of the most intensely studied regulators of gene
expression, playing a crucial role in inflammatory responses, cell
proliferation, and apoptosis (1-4). NF-B transcription factors
activate groups of genes in response to various stimuli, including the
proflammatory cytokine tumor necrosis factor
(TNF),1 interleukin 1
,
bacterial lipopolysaccharide, and viral products. The most common form
of NF-B transcription factor consists of RelA (p65) and p50 subunits
(5, 6). In most non-induced cell types it is sequestered in the
cytoplasm in an inactive state through its association with members of
a family of inhibitory proteins known as IB. After cell stimulation,
IB proteins are rapidly phosphorylated by the IB kinase complex
(IKK) and are then degraded by the 26 S proteasome upon
polyubiquitination (7). This degradation allows NF-B to move to the
nucleus to switch on its target genes.
Three components were identified as constituents of the IKK complex
(
700 kDa): IKK
, IKK, and NF-B
essential modulator (NEMO, also called IKK
).
IKK and IKK sharing 52% identity possess a similar organization
in functional domains including a kinase, a leucine zipper, and a
helix-loop-helix domain (8-11). Although in cells IKK and IKK
are active both as homo- or as heterodimers promoted by their leucine
zipper motifs, the heterodimer is the predominant form (12). The recent
generation of IKK- and IKK-deficient mice showed different
phenotypes assigning different functional roles to each catalytic
subunit. Thus, whereas IKK is required for the activation of
NF-B, IKK but not IKK seems rather involved in keratinocyte
differentiation (13).
NEMO, the third component of the IKK complex, was originally identified
by functional complementation of cells that did not respond to a
variety of stimuli (14). It associates preferentially with IKK, and
its presence is crucial for the stimuli-dependent activation of the IKK complex. NEMO, which has no known catalytic activity, contains at least four structural motifs as deduced from the
primary structure analysis. The N-terminal domain contains a large
coiled-coil domain (CC1, residues 93-231) carrying most of the
essential peptidic determinants required for binding to IKK (15).
The C-terminal domain is composed of three sub-domains including a
coiled-coil (CC2, residues 246-286), leucine zipper (LZ, residues
303-337), and zinc finger motifs (ZF, residues 390-412). Consistent
with an essential role for NEMO in the activation of the NF-B
pathway, two human pathologies, Incontinentia Pigmenti and Anhidrotic
Ectodermal Dysplasia with Immunodeficiency (EDA-ID), were recently
shown to be associated with a partial or total loss-of-function of NEMO
(16, 17). Interestingly, mutations responsible for EDA-ID were mainly
found in the C-terminal part of the molecule. To date the molecular
mechanism by which the IKK complex is activated remains unclear. It has
been proposed that NEMO activates the IKK complex by recruiting the IKK
kinase to a receptor. However, IKK alone is sufficient for the
recruitment of IKK to TNF receptor 1 after TNF stimulation in
NEMO-deficient cells, indicating that NEMO is not essential for
TNF-induced IKK recruitment (18). Co-immunoprecipitation experiments
and in vitro cross-linking (12) showed the ability of NEMO
to self-associate. NEMO oligomerization has also been shown to be
crucial for IKK activation (19, 20) and probably for recruitment by
upstream activators. Mutagenesis experiments mapped the region of NEMO
responsible for its self-association (21), but no correlation with its
oligomeric state could be established.
To understand further the molecular role of NEMO in the activation of
the IKK complex, we have studied the biochemical properties of purified
murine NEMO recombinant protein (rNEMO) as well as of a truncated
C-terminal domain produced in Escherichia coli. The
homologous Hsp70 of E. coli, DnaK, was found tightly
associated to rNEMO, and we characterized this association by gel
filtration and analytical ultracentrifugation methods. As the Hsp70
protein family is relatively well conserved, the in vitro
and in vivo association of NEMO with human Hsp70 was
examined. We also investigated the oligomeric state of NEMO in
vivo by protein cross-linking experiments. Consistent with our
results a model was proposed in which the bipartite function of the
C-terminal of NEMO modulates the activation of the IKK complex.
| |
EXPERIMENTAL PROCEDURES |
Materials--
Octyl glucoside (OG) and dodecyl maltoside (DDM)
were from Roche Molecular Biochemicals. Tetraethylene glycol monooctyl
ether (TGME) and Brij 35 were from Sigma, and the zwitterion detergent, zwittergent 3-16, was from Calbiochem. Bis(maleimido)hexane (BMH) and
bis(maleimido)ethane (BMOE) were from Pierce.
Expression and Purification of rNEMO and of Its C-terminal
Domain--
Murine NEMO was expressed in E. coli with the
pRSETa expression system (Invitrogen). The NEMO cDNA (14) was
cloned in-frame with the vector into BamHI and
PvuII sites to give plasmid pRSETa/NEMO. The encoded
polypeptide (rNEMO) contains an N-terminal extension of 34 residues
(MRGS(H)6GMASMTGGQQMGRDLYDDDDKDRW) inserted at position 2 in NEMO. This sequence contains a His tag and a site of
proteolysis by enterokinase.
A truncated mutant of NEMO corresponding to a part of its
C-terminal domain (amino acids 242-388) was made by PCR
mutagenesis using the plasmid pRSETa/NEMO as template. Briefly, NEMO
cDNA was amplified between the 5' primer oligonucleotide 5'-
GCACGCTAGCTACGACAGCCACATTAAGAGC and the 3' primer
oligonucleotide 5'-
GCACGGATCCCTAGTCAGGAGGTTCTTCAGGAGG. This
introduced NheI and BamHI sites
(underlined) and a stop codon (bold) at position
388 in the polypeptide sequence. After amplification, the fragment was
digested with NheI and BamHI and cloned into a
pET-28b expression vector (Novagen). The nucleotide sequences of NEMO
and of the D242-F388Stop fragment were verified by DNA sequencing.
Purification of rNEMO was performed starting from a 2-liter culture of
BL21(DE3) cells transformed with pRSETa/NEMO grown at 22 °C in 2×
YT/ampicillin (50 µg/ml) medium to A600 = 1, and 1 mM
isopropyl-1-thio--D-galactopyranoside was then added to the medium for 5 h. All subsequent steps were conducted at
4 °C. After harvesting by centrifugation, the cells were washed
twice in a buffer, 100 mM Tris-HCl, pH 8, containing 10 mM MgCl2 and 1 mM
dithioerythritol, resuspended in extraction buffer (50 mM Tris-HCl, pH 7.5, 20 mM KCl, 5% glycerol, 1 mM dithioerythritol) containing a protease inhibitor
mixture (Sigma), and broken in a French press at 1,500 pounds/square
inch. The lysate was then diluted 2.5-fold with the equilibrium buffer
of the Ni-NTA column (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 0.1 mM DDM) and centrifuged at
12,000 × g for 30 min. The supernatant was loaded on a
25-ml Ni-NTA-agarose column (Qiagen, 1.6 × 12.5 cm) charged with
Ni2+. After washing with the equilibrium buffer containing
10 mM imidazole, the bound material was eluted at 110 mM imidazole by a 400-ml linear gradient (10-400
mM imidazole) in 50 mM Tris-HCl, pH 7.5, 500 mM NaCl, 0.1 mM DDM. Fractions containing rNEMO
were pooled (70 ml) according to optical density profile and SDS-PAGE,
and dialyzed twice against 50 mM Tris-HCl, pH 8.0, 30 mM KCl, 1 mM EDTA, 1 mM
dithioerythritol, and 1 mM DDM (buffer A). An rNEMO sample
was then applied to a Resource Q column (6 ml, Amersham Biosciences)
equilibrated in the buffer A and eluted with a 180-ml linear gradient
30-500 mM KCl. Fractions containing rNEMO (according to
the OD profile and to SDS-PAGE) were pooled (15 ml) and dialyzed against 1 liter of 10 mM potassium phosphate, pH 7.0, 1 mM dithioerythritol, and 1 mM DDM. The solution
was then applied onto a ceramic hydroxyapatite column (1.6 cm × 15 cm, Bio-Rad) and eluted with a 600-ml linear gradient (10-400
mM) of potassium phosphate. The peak of rNEMO was pooled
(65 ml), concentrated by ultrafiltration (Millipore), and dialyzed
twice against 50 mM Tris-HCl, pH 7.5, 1 mM
dithioerythritol, 150 mM KCl, 1 mM DDM, and
50% glycerol before freezing at 
80 °C at a concentration of 4.9 mg/ml.
The first purification steps of the C-terminal fragment (D242-F388Stop
fragment) were the same as described above for rNEMO except that the
recombinant protein was produced at 37 °C from 1 liter of culture,
and 0.1 mM DDM was used instead of 1 mM in all
buffers. The elution from the Ni-NTA column was performed using a
higher concentration of imidazole (250 mM) as compared with
rNEMO. Fractions (5 ml) containing the C-terminal domain were pooled
and dialyzed against buffer 50 mM Tris-HCl, pH 7.5, containing 50 mM KCl, 1 mM dithioerythritol,
and 0.1 mM DDM (buffer B). The protein sample (15 mg)
was then loaded on a Resource Q column (6 ml, Amersham Biosciences)
equilibrated in the buffer B. A majority of the protein sample (80%)
passed through the column and corresponded to homogeneous D242-F388Stop
fragment (see Fig. 5). 20% was bound to the matrix and eluted with a
120-ml gradient (50 mM to 1 M) of KCl. This
fraction contained truncated rNEMO associated to DnaK with a
stoichiometry of 1:1 as judged by SDS-PAGE. Both fractions were
dialyzed twice against 50 mM Tris-HCl, pH 7.5, 100 mM KCl, 1 mM dithioerythritol, 50% glycerol,
and 1 mM DDM and stored at 20 °C. Protein
concentrations were determined either by the method of Bradford or by
absorbance at 280 nm using an extinction coefficient of 0.352 unit·mg
1·cm2 for rNEMO and of 0.181 unit·mg1·cm2 for the truncated rNEMO.
Microsequencing of an internal peptide of the DnaK protein was
performed as described previously (22), and the amino acid sequence
comparisons were carried out using the protein data base
Colibri.
In Vitro Binding Assay with Prokaryotic and Eukaryotic Hsp70s and
Co-immunoprecipitation--
Ni-NTA magnetic agarose beads suspensions
(25 µl, Qiagen) equilibrated with the buffer C (20 mM
Tris-HCl, pH 8.0, 20 mM imidazole, 300 mM NaCl,
1 mM DDM, 5% glycerol, and 0.1 mM
dithioerythritol) were incubated for 30 min at 4 °C with the
purified His-tagged NEMO. After separation of beads with a magnet, the
excess protein was removed, and beads captured with His-NEMO were
washed twice with a 100-µl volume of buffer D (20 mM
NaPO4, pH 7.0, 20 mM imidazole, 150 mM NaCl, 1 mM DDM, 5% glycerol, and 0.1 mM dithioerythritol). DnaK (StressGen) or human Hsp70
(Sigma) was then added and incubated for 1 h at 4 °C in buffer
C containing 0.1 mM phenylmethylsulfonyl fluoride. Magnetic
beads were separated and washed 3 times with buffer D (100 µl). Hsp70
proteins trapped by His-tagged NEMO were recovered by elution with
buffer D containing 300 mM imidazole followed by SDS-PAGE
with silver staining. Cell culture, transfection of 293T cells, and
co-immunoprecipitation were carried out as described previously (14).
Western blotting was performed using anti-Hsp70 antibodies provided by Sigma.
Functional Interaction Assay of rNEMO with the IKK
Complex--
Cell culture and preparation of S100 extracts from 70Z/3
murine pre-B cell and the NF-B unresponsive mutant 1.3E2 were
carried out as described previously (14). His-tagged NEMO or His-tagged C-terminal domains (0.15 mg/ml, 200 µl), which were used as bait, were incubated with Ni-NTA magnetic agarose beads (100 µl, Qiagen) equilibrated in buffer C. After separation with a magnet, the supernatant containing His-tagged proteins in excess was removed, and
the beads saturated with His proteins were washed twice with buffer D
(200 µl) and incubated in a 200-µl volume of buffer D at 4 °C
for 1 h with S100 extracts from 70Z/3 and 1.3E2 cells containing
0.8 and 1 mg/ml of proteins, respectively. After extensive washing in
buffer D, His-tagged proteins were recovered by elution with
buffer D containing 300 mM imidazole (100 µl). The IKK
complex trapped (pellet) or not trapped (supernatant) was detected by Western blotting using anti-IKK antibodies (Imgenex). The amount of
His-tagged protein immobilized by Ni-NTA beads was evaluated by
SDS-PAGE analysis with Coomassie staining.
Circular Dichroism and Fluorescence Spectroscopy--
The CD
spectrum of rNEMO (15 µM) or of the truncated C-terminal
domain (36 µM) was recorded from 182 to 260 nm at
20 °C and pH 7.0 in a buffer 20 mM potassium phosphate
containing 1 mM DDM and 1 mM dithioerythritol
(buffer E) using a Jobin-Yvon CD6 spectrodichrograph (Longjumeau,
France). Cells (20 µl) with a path length of 0.1 mm were used, and
the product of the time constant and the rate of scanning were below
0.33 nm (23). Each spectrum was the result of the average of three
scans taken from the same sample minus the average of three scans from
the reference buffer. Deconvolution of CD spectra was performed
according to the method of Chang et al. (24) using the
MDFITT program as described previously (25). The fluorescence spectrum
was recorded in buffer E at 20 °C on a PTI spectrofluorometer
QuantamasterTM. The excitation wavelength was 295 nm to
minimize the contribution of tyrosyl residues to the total
fluorescence. The excitation and emission bandwidths were both set to 2 nm. The fluorescence yield was determined as described previously
(26).
Analytical Gel Filtration--
The apparent Stokes radius of
rNEMO was determined both at 20 and 4 °C by filtration of 400-µl
samples on a Superdex 200 HR 10/30 column (Amersham Biosciences)
equilibrated in 50 mM Tris-HCl, pH 7.5, containing 200 mM KCl, 0.2 mM DDM, and 1 mM
dithioerythritol (buffer F), developed at a constant flow rate of 0.4 ml/min. The respective elution of standard globular protein or rNEMO
was described in terms of Ve V0 (ml) corresponding to the product of
Kav and VT V0, where Ve is the elution volume of the particular protein; V0 and
VT are void and total volumes of the column
determined with blue dextran 2000 and dithioerythritol, respectively.
Thyroglobulin (669 kDa, RS = 82.3 Å), ferritin (440 kDa, RS = 59.1 Å), catalase (232 kDa,
RS = 52.4 Å), aldolase (158 kDa,
RS = 46.4 Å), bovine serum albumin (67 kDa,
RS = 35.2 Å), ovalbumin (43 kDa,
RS = 27.5 Å), chymotrypsinogen A (25 kDa,
RS = 21.1 Å), and ribonuclease A (13.7 kDa,
RS = 16.4 Å) were used for calibration.
Sedimentation Velocity--
Prior to sedimentation, rNEMO was
injected on a Superdex 200 HR 10/30 column equilibrated in buffer F at
4 °C. The fraction (0.8 mg/ml in 500 µl) corresponding to the
median of the elution peak was analyzed by centrifugation, using the
equilibrium buffer of the column as reference. Sedimentation velocity
experiments were performed at 10 °C to minimize protein aggregation
on a Beckman Optima XL-A analytical ultracentrifuge equipped with an
An-Ti60 titanium four-hole rotor with two-channel 12-mm path length
centerpieces. Samples of 400 µl were centrifuged at 50,000 rpm, and
radial scans of absorbance at 280 nm were taken at 1-min intervals.
Data were analyzed using the computer programs Svedberg (27), kindly
provided by John Philo (Amgen, Inc.). The first scans with incomplete
clearing of the meniscus were not taken into account for the fitting
function. The XLA-VELOC program supplied by Beckman was used for the
calculation of the apparent sedimentation coefficient
g(s*)t from the time derivative of the
sedimentation velocity concentration profile as described previously
(28). The sedimentation coefficient of species M1
determined using two species model with Svedberg corresponded to the
peak position in the g(s*) profiles.
Sedimentation and diffusion coefficients were corrected to standard
conditions, s20w and
D20w. A partial specific volume of 0.720 cm3/g at 10 °C for rNEMO was calculated from its amino
acid composition according to Ref. 29. Solvent density and viscosity at
10 °C were 1.008 g/cm3 and 1.3 × 102
cp, respectively, determined from published tables (29).
Hydrodynamic parameters such as frictional ratio
f/f0 and Stokes radius were deduced
from the Teller method (30) using the SEDNTERP program provided by John Philo.
Equilibrium Sedimentation--
Sedimentation equilibrium
experiments with rNEMO were carried out at 10 °C at 8,000 or 12,000 rpm in a Beckman Optima XL-A analytical ultracentrifuge. Initial
loading concentrations (120 µl) were either 0.34 mg/ml in a buffer 20 mM potassium phosphate, pH 7.0, containing 100 mM KCl, 10 mM OG, and 1 mM
dithioerythritol or 0.25 mg/ml in a buffer 20 mM potassium
phosphate, pH 7.0, containing 150 mM KCl, 10 mM
TGME, and 1 mM dithioerythritol. In the study of the
C-terminal fragment, experiments were performed using two loading
concentrations (1 and 1.2 mg/ml in 120 µl) and two rotor speeds
(12,000 and 18,000 rpm) in a single run as described in Table II.
Protein samples were allowed to equilibrate for 30 h, and
duplicate scans (2 h apart) were overlaid to determine that there were
no further changes in the sample cell. After collecting data at
equilibrium, the samples were centrifuged at 50,000 rpm for 12 h
to sediment the protein, and radial scans were again collected to
obtain a base-line correction for each cell. To determine the buoyant
molecular mass, we followed the formalism of Reynolds and Tanford (31)
in which the contribution of the bound detergent 
Det in
g/g can be written by the relation:
![M*(1−&PHgr;′&rgr;)=M<SUB>p</SUB>[(1−<A><AC>&ngr;</AC><AC>&cjs1171;</AC></A><SUB>p</SUB>&rgr;)+&dgr;<SUB><UP>Det</UP></SUB>(1−<A><AC>&ngr;</AC><AC>&cjs1171;</AC></A><SUB><UP>Det</UP></SUB>&rgr;)]](/content/vol277/issue20/fulltext/17464/img001.gif)
|
(Eq. 1)
|
where M* is the molecular mass of the anhydrous
protein-detergent complex, 
' its partial specific volume,
Mp is the molecular mass of the anhydrous protein,
p its partial specific volume, 
is the buffer
density, and Det the partial specific volume of
detergent. Because the density of the detergent TGME
(C8E4) was close to that of buffer, the second term in the second member of Equation 1 was negligible. In contrast, the Det of detergent micelle OG was low (0.92 ± 0.004 ml/g at 20 °C (32)) and a densifier such as the sucrose is
often added to the buffer to match with the detergent density
(Det = 1/Det). However, the
addition of sucrose can change dramatically the oligomer equilibrium or
the protein hetero-association. We rather used an OG concentration of
10 mM below its critical micelle concentration (30 mM) to prevent detergent micelle formation such that the
second term becomes negligible due to a low Det. At
10 °C the densities were 1.009 and 1.007 g/ml in the buffers
containing 10 mM TGME and 10 mM OG,
respectively. The partial specific volumes of DnaK and of DnaK-rNEMO
complex calculated from their amino acid composition were 0.731 and
0.726 ml/g, respectively, at 10 °C. All data were fitted with one,
two, or three species models as described previously (33, 34).
In Vivo Chemical Cross-linking--
HeLa cells were purchased
from American Type Culture Collection and were grown in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum.
Chemical cross-linkings in vivo were performed with a
homobifunctional cross-linker as described previously (35, 36). We used
BMH or BMOE which is very similar to BMH except that the two
carbodiimide groups are linked by a shorter spacer arm (8 Å). BMH and
BMOE were purchased from Pierce and were stored in Me2SO at
20 °C at 20 mM. The in vivo cross-linking with BMH gave the same results as BMOE except that the efficiency of
cross-linking was lower. Briefly, cells (8 × 107)
were concentrated into 1 ml, resuspended twice with fresh medium by
successive centrifugations (100 × g for 10 min), and
incubated on ice for 30 min. 25 µl of stock BMOE (20 mM)
was then added to half of cells (4 × 107 cells in 500 µl) at 37 °C to give a final concentration of BMOE of 1 mM. The other half were mock-treated by 25 µl of
Me2SO added as control. 100 µl of cells were withdrawn
either immediately after adding BMOE or after 10 min or 2 h,
incubated for 10 min at 37 °C, and mixed with 20 µl of 180 mM dithioerythritol (final concentration 30 mM)
to quench the cross-linking reaction. Cells were then pelleted at
4 °C and washed twice with cold phosphate-buffered saline. The
Laemmli loading buffer supplemented with 6 M urea (100 µl) was added to cell pellets (40 µl), and the mixtures were boiled
for 10 min. The precipitates were removed by centrifugation at
20,000 × g at 4 °C for 30 min. Supernatants (40 mg/ml) were diluted 50-fold with Laemmli buffer so that 16 µg of
protein were loaded in each well. Western blots were performed as
described previously (37) using a final antibody concentration of 0.5 µg/ml with polyclonal anti-NEMO (14) or with monoclonal anti-IKK (PharMingen).
| |
RESULTS |
Expression and Purification of Recombinant NEMO--
Recombinant
His-tagged NEMO (rNEMO) was expressed in E. coli at 22 °C
to prevent the formation of inclusion bodies and purified following the
protocol under "Experimental Procedures." The analysis by SDS-PAGE
of each chromatographic step is presented in Fig. 1A. The specific binding on
chromatographic matrix bearing a nitrilotriacetic group charged with
nickel (Ni-NTA) was strictly dependent on the presence of a neutral
detergent such as dodecyl maltoside (DDM), which prevented the
formation of aggregates. Despite the addition of protease inhibitors, a
partial proteolysis of rNEMO protein was detected by Western blot. This
partial degradation occurred even if the bacteria were directly boiled
in SDS/urea lysis buffer (data not shown) and was likely due to
in vivo endogenous proteases, possibly fostered by the lack
of interaction with IKK or - kinases. The proteolyzed fragments
were easily removed using ion exchangers (compare lanes Ni
and HA in Fig. 1A). The analysis of the Ni-NTA pool by SDS-PAGE also revealed the presence of 40- (p40) and 70-kDA (p70) proteins (lanes Ni and Q). These proteins
were not found in the eluate when extracts without tagged NEMO were
loaded onto Ni-NTA columns (data not shown). Their co-elution with
rNEMO at the high imidazole concentration used suggests that both
proteins were bound to the column via their association with rNEMO.
Whereas p40 could be separated by chromatography on ceramic
hydroxyapatite column (lane HA), p70 remained associated
with rNEMO throughout all purification steps (compare lanes
Ni and HA in Fig. 1A) as well as in
additional gel filtration and hydrophobic chromatographies (not shown).
These results support the view that p70 forms a protein complex with
rNEMO. Two additional minor bands with molecular masses of 110 and 160 kDa, respectively, were observed in SDS-PAGE (lane HA,
asterisks) and recognized by anti-NEMO antibodies in Western
blotting (data not shown). Incomplete dissociation of oligomeric
proteins upon SDS-PAGE can be observed when a neutral detergent is
present in the loading buffer, and these two polypeptides could
correspond to dimeric and trimeric forms of rNEMO as judged by their
apparent molecular mass. Because rNEMO with a calculated molecular mass
of 51,796 Da carried an N-terminal extension of 33 residues, it
exhibited a slightly slower electrophoretic mobility as compared with
the native NEMO (compare lanes M and HA in Fig. 1A). The purification procedure yielded 15 mg of purified
rNEMO starting from a 2-liter culture (10 g of cell pellet) with a
global recovery of 28%. As judged by densitometry, rNEMO was at least 95% homogeneous, with p70 representing less than 5% of the
material. The ability of several other detergents like OG, Brij 35 (C12E23), zwittergent 3-16, or tetraethylene
glycol monooctyl ether (C8E4, TGME) to preserve
rNEMO from aggregation was evaluated using each detergent at a
concentration above its critical micelle concentration (cmc). DDM was
found as the most efficient and was used in all further experiments
unless otherwise indicated.
View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
Purification of recombinant NEMO and effect
of DnaK on rNEMO. A, analysis by SDS-PAGE of the
purification steps of NEMO. The crude extracts from transformed
E. coli cells expressing (lane E) or not
expressing NEMO (null plasmid) (lane C) were analyzed by
SDS-PAGE. An arrowhead indicates the polypeptide
corresponding to recombinant NEMO. The analysis of the pooled fractions
from each purification step is shown as follows: lanes Ni,
Q, and HA are the pools of Ni-NTA, POROS HQ,
and ceramic hydroxyapatite columns, respectively (see "Experimental
Procedures"). Lane M corresponds to protein markers.
Arrows indicate rNEMO and co-eluting p40 and p70 proteins.
Asterisks indicate 110- and 160-kDa protein bands that are
specifically recognized by rNEMO antibodies. B,
chaperone role of DnaK on the recombinant NEMO. Purified rNEMO
containing 1 mM DDM was diluted in a buffer containing 0.2 mM DDM. After centrifugation at 13,000 rpm, the supernatant
(lane S) and the pellet (lane P) were analyzed by
SDS-PAGE, and the ratio DnaK/rNEMO was determined by densitometry after
Coomassie staining.
|
|
In order to identify the p70 protein co-purifying with rNEMO, the
N-terminal sequence of an internal peptide was obtained after a trypsin
digestion performed directly on the polyacrylamide matrix. The sequence
KRRINE found identified unambiguously the molecular chaperone Hsp70 of
E. coli, also called DnaK, in the E. coli protein
data bank. Lowering the DDM concentration from 1 to 0.2 mM
induced immediate protein precipitation. Fig. 1B shows a
change in the DnaK/rNEMO ratio at this lower detergent concentration. Very little DnaK was found in the pellet fraction (lane P,
DnaK/rNEMO ratio of 1:20), whereas the two proteins were in a ratio of
1:3 in the supernatant (lane S). Because DnaK co-elutes with
rNEMO in all chromatographic columns used, reflecting the formation of
a protein complex, these data indicate that DnaK can act as a molecular
chaperone protecting rNEMO from aggregation. DnaK-rNEMO complex was
further characterized by developing an in vitro assay using
the purified rNEMO as bait and the commercially available pure DnaK.
His-tagged rNEMO was captured on magnetic beads (Ni-NTA). After
incubation with a variable amount of DnaK, the protein complex was
detected by silver staining of the SDS-PAGE analysis after elution of
His-tagged rNEMO (Fig. 2). Ni-NTA beads
not saturated with His-NEMO were used as control. As shown in Fig.
2a the addition of DnaK induces an increase of a specific
DnaK-rNEMO complex with 1:1 stoichiometry. Note that although the
interaction was weaker in the presence of ATP/Mg2+, it was
not abolished (compare 4th and 5th lanes).
View larger version (51K):
[in this window]
[in a new window]
|
Fig. 2.
Association of NEMO with Hsp70.
a, in vitro association with E. coli DnaK. Ni-NTA beads (25 µl) saturated with (Ni-NTA/His-NEMO)
or without (Ni-NTA) His-tagged rNEMO were incubated with variable
amounts of DnaK in the absence or in the presence of 5 mM
ATP as indicated. After thorough washing, His-tagged rNEMO was eluted,
and the protein complex was analyzed by SDS-PAGE and visualized by
silver staining as described under "Experimental Procedures."
b, in vitro association with human Hsp70.
Similar experiment as a except that Ni-NTA beads with or
without bound His-NEMO were incubated with a saturating concentration
of Hsp70 (10 µg, 0.2 mg/ml). In the right lane (Hsp70) 1 µg was loaded alone to show purity. c, in
vivo association with human Hsp70. Extracts from 293 cells
transiently expressing NEMO were immunoprecipitated with anti-NEMO
antibodies or a preimmune serum (control). Immunoprecipitates
(IP) were then analyzed by Western blot (WB) with
anti-Hsp70 as described under "Experimental Procedures."
|
|
As Hsp70 protein family has been conserved in evolution, we next
examined whether the human counterpart of DnaK could also interact
specifically with rNEMO, using a similar in vitro assay. As
shown in Fig. 2b, the His-tagged NEMO interacts
specifically with Hsp70 forming a protein complex with 1:1
stoichiometry. The in vivo association of Hsp70 was also
investigated using co-immunoprecipitation experiments. In these
experiments NEMO was transiently expressed in human 293 cells, and
crude extracts were used for immunoprecipitation with anti-NEMO
antibodies. The immunoprecipitates were then analyzed by Western
blotting using anti-Hsp70 antibody. The preimmune serum was used as
negative control. As shown in Fig. 2c both constitutive (73 kDa) and inducible (72 kDa) forms of Hsp70 were detected in the
immunoprecipitate, indicating that human Hsp70-like DnaK interacts specifically with NEMO in vivo.
Intrinsic Fluorescence and Secondary Structure of
rNEMO--
Because NEMO has no enzymatic activity, we checked whether
the recombinant protein was correctly folded by recording its CD spectra (Fig. 3A) and by
measuring its fluorescence yield (Fig. 3B). Far-UV CD and
fluorescence spectra of rNEMO were recorded in the presence of 1 mM DDM. Under these conditions, the signal contribution of
DnaK was negligible. The CD profile exhibited two negative dichroic
bands with minima at 208 and 222 nm and a positive dichroic band with a
maximum at 192 nm characteristic of a protein with a high -helix
content. Deconvolution of CD spectra using the method of Chang et
al. (24) estimated the fractions of the -helix, -form, and
unordered form to 44, 0, and 56%, respectively. This result is in
agreement with the secondary structure prediction derived from the
amino acid sequence using the DSC software (38).
View larger version (9K):
[in this window]
[in a new window]
|
Fig. 3.
CD and fluorescence spectra of the
rNEMO. The CD spectrum of rNEMO (15 µM)
(A) or the intrinsic fluorescence emission spectrum of rNEMO
(1.6 µM) (B) were recorded at 20 °C in 20 mM potassium phosphate buffer, pH 7.0, containing 1 mM DDM and 1 mM dithioerythritol. Excitation
wavelength was 295 nm.
|
|
Recombinant NEMO contains two Trp residues (Trp-34 and Trp-39), located
in the N-terminal part of the protein. To minimize the contribution of
the 6 Tyr, the fluorescence spectrum was recorded with an excitation at
295 nm (Fig. 2b). The emission spectrum displayed a maximum
at 345 nm indicating that at least one of the two Trp was accessible to
the solvent. In addition, the fluorescence quantum yield of 0.3 was
high as compared with that of
N-acetyl-L-tryptophanamide (
F = 0.14)
indicating that rNEMO is correctly folded.
rNEMO Binds Specifically to the IKK Complex--
The structural
integrity of rNEMO was also checked by determining whether the pure
His-tagged recombinant protein could bind specifically to the IKK
complex through the interaction with the IKK kinase (Fig.
4). S100 extracts were prepared either
from a parental pre-B cell line (70Z/3) which contains the native
endogenous NEMO associated to IKK complex or from a NEMO-deficient
mutant pre-B cell line (1.3E2) (14). The His-tagged NEMO captured on Ni-NTA beads was then incubated in extracts from both cell types, and
the interaction with IKK complex was detected by Western blotting after
elution of the His-tagged NEMO. The purified His-tagged C terminus
mutant of rNEMO lacking the N-terminal IKK binding domain was used as
control (see below). As shown in Fig. 4a, a specific
interaction of rNEMO with the IKK complex was detected in 1.3E2 cells
(lane 2), whereas no association with IKK complex was
observed with His-tagged rNEMO in 70Z/3 cells nor with His-tagged C
terminus mutant in 1.3E2 cells (1st and 3rd
lanes). To determine the recovery of IKK complex bound, we
analyzed by Western blotting unbound materials in different extracts
(Fig. 4b). About 50% of IKK complex in the 1.3E2 extract
were captured by Ni-NTA beads saturated with His-NEMO, indicating that
the interaction is highly specific. Taken together, CD and fluorescence
spectra as well as the interaction assay showed that rNEMO is a
functional recombinant protein that is correctly folded with a high
-helical content.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
rNEMO binds specifically to IKK complex.
Ni-NTA magnetic beads (100 µl) saturated with pure His-tagged NEMO
(rNEMO) or with pure His-tagged C-terminal fragment (rNEMO-C) were
incubated for 1 h at 4 °C with S100 extracts from
NEMO-deficient cell lines (1.3E2) or parental cell lines (70Z/3). After
thorough washing, bound (a) and unbound (b) IKK
complex was detected by Western blotting using anti-IKK antibodies
as described under "Experimental Procedures." The His-tagged
C-terminal fragment, which does not contain the IKK binding domain, was
used as control.
|
|
Quaternary Structure of rNEMO and of the DnaK-rNEMO
Complex--
The states of association of the recombinant rNEMO and
the DnaK-rNEMO complex were analyzed by a combination of gel filtration and ultracentrifugation experiments. To increase the fraction of
DnaK-rNEMO complex in solution, a part of free rNEMO was removed by precipitation using a lower concentration of DDM (0.2 mM) (see Fig. 1B, lane S). Fig.
5A shows the analysis by gel
filtration of the DnaK/rNEMO mixture at 20 °C on a Superdex 200 HR10/30 column in a buffer containing 0.2 mM DDM. All of
rNEMO eluted in a single symmetrical peak both at 20 and at 4 °C.
SDS-PAGE analysis showed that each fraction contained both rNEMO and
DnaK proteins in a ratio 3:1 (data not shown). The elution volume,
between that of ferritin and thyroglobulin, corresponds to a very high
Stokes radius (RS = 73 Å) (inset of Fig.
5A), corresponding to an apparent mass of 500 kDa for a
globular protein that could indicate the presence of multimeric
species.
View larger version (31K):
[in this window]
[in a new window]
|
Fig. 5.
Analysis of rNEMO by size-exclusion
chromatography and by sedimentation velocity. A,
distribution profile of rNEMO obtained by size-exclusion
chromatography. The gel filtration was performed as described under
"Experimental Procedures" in loading 2.8 mg/ml rNEMO in equilibrium
buffer F (50 mM Tris-HCl, pH 7.5, 200 mM
potassium chloride, 0.2 mM DDM, and 1 mM
dithioerythritol). Inset, calibration curve for
globular proteins measured in the same equilibrium buffer (see
"Experimental Procedures"). Thyr, thyroglobulin;
Fer, ferritin; Cat, catalase;
Ald, aldolase; Ovalb, ovalbumin; Chym,
chymotrypsinogen A; and Ribo, Ribonuclease.
V0 and Vi represent the
void and total volumes of the column, respectively. B,
analysis of rNEMO by sedimentation velocity. Fraction 10 from the
size-exclusion chromatography (0.8 mg/ml) was sedimented at 50,000 rpm.
Sedimentation profiles (symbols) were recorded at 280 nm,
and the sedimentation data were fitted (curves) using a
two-species model as described under "Experimental Procedures."
Residuals calculated for each sedimentation profile are indicated
above. Inset, sedimentation coefficient distribution
analysis. The sedimentation velocity data were analyzed for the
sedimentation distribution, g(s*), as described
under "Experimental Procedures."
|
|
The fraction corresponding to the median peak of the column shown in
Fig. 5A (0.8 mg/ml) was analyzed in sedimentation velocity in the same buffer (Fig. 5B). Using the Svedberg software
(27), the data were poorly fitted with a single species, and the best fit was obtained with a two species model, M1 and
M2, representing 75 and 25% of the material, respectively.
The sedimentation and diffusion coefficients of species
M1 (s20,w = 4.1 S and D20,w = 7.0 × 107cm2/s, Table
I) and the corresponding molecular mass
calculated from the Svedberg relation (mass = 53,000 Da)
indicated that it corresponded to monomeric rNEMO (calculated mass = 51,796 Da). Moreover, its Stokes radius (RS = 29.7 Å) and frictional ratio (f/f0 = 1.20) indicated that it behaved as a globular molecule. These results
contrast strongly with the data from size-exclusion chromatography
experiments where all of rNEMO was eluted as a single peak with a
RS of 73 Å (see "Discussion"). The proportion
of species M2 relative to M1 (25 and 75%,
respectively) strongly suggests that M2 may correspond to
the DnaK-rNEMO complex. Both the values of the average sedimentation
coefficient (s20,w = 5.5 S) and the very
large diffusion coefficient (D20,w = 10.9 × 107 cm2/s) reflect an
equilibrium between rNEMO and DnaK-rNEMO complex. The apparent
sedimentation coefficient distribution function, g(s*) versus s*, supports
this analysis because the distribution profile exhibited a large
asymmetric peak toward the high s* with a maximum at
4.1 S (inset of Fig. 5B).
View this table:
[in this window]
[in a new window]
|
Table I
Structural parameters of recombinant NEMO as deduced from
size-exclusion chromatography and analytical centrifugation
|
|
To obtain additional information on species M2 and to
confirm the monomeric state of rNEMO, we next analyzed the mixture
DnaK/rNEMO by equilibrium sedimentation (Fig.
6 and Table I). For this experiment, the
detergent used could not be DDM because its high density would require
the presence of a densifier such as sucrose to make the detergent
transparent in equilibrium sedimentation (see "Experimental Procedures"). To minimize the possible contribution of the detergent to the calculated mass of the protein, we chose two different approaches. First, we used the detergent TGME (cmc of 7 mM
in 0.1 M NaCl) with a density close to that of the buffer
in order to achieve gravitational transparency (31). Second, we used the detergent OG with a high cmc (cmc of 25 mM in 0.1 mM NaCl) so that its working concentration was below its
cmc to minimize micelle formation. Fig. 6 shows a sedimentation
equilibrium experiment of the mixture DnaK/rNEMO with a ratio 1:2 in a
buffer containing 10 mM OG. Again, the radial distribution
was poorly fitted with a single species model, and the best fitting,
represented by the curved line in Fig. 6, was obtained with
a two species model. As shown in Table I the values found (49,000 ± 3,000 Da for M1 (55%) and 340,000 ± 20,000 Da for
M2 (45%)) corresponded to monomeric rNEMO and to a heavy
protein complex between DnaK and rNEMO. No significant improvement was
obtained when fitting was performed using a three-component model
either in fixing the masses of protein partners or in allowing them to
float. This indicated that no free DnaK was detectable during the
centrifugation, implying again a tight binding between DnaK and rNEMO.
Similar results were obtained when the experiments were performed with
a buffer containing 10 mM TGME. In this case, the molecular
masses of M1 and M2 were 55,000 ± 3,000 Da (66%) and 360,000 ± 10,000 Da (34%), respectively. Given a
complex stoichiometry of 1:1 (see Fig. 2), this mass matches with the
mass of a DnaK-rNEMO complex containing 3 molecules of DnaK bound to 3 rNEMO molecules (theoretical mass of 360,540 Da).
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 6.
Sedimentation equilibrium of rNEMO.
Equilibrium distribution of rNEMO measured by its absorbance at 280 nm
is plotted as a function of radial distance at 12,000 rpm and 10 °C.
Initial protein concentration was 0.35 mg/ml with DnaK/rNEMO ratio of
1:2 in a 50 mM Tris-HCl, pH 7.5, containing 100 mM potassium chloride, 1 mM dithioerythritol,
and 10 mM -OG. Data (symbols) were fitted
(curves) as described under "Experimental Procedures."
The line shows the best-fitting curve for an ideal
two-species model with a molecular mass of 49,000 ± 3,000 Da for
species M1 and 340,000 ± 2,000 Da for species
M2 (see also Table I). The random distribution of residuals
as function of radial distance is shown above.
|
|
Altogether, our ultracentrifugation experiments show that a fraction of
the recombinant rNEMO is present as a monomer while the remainder is
tightly associated to the chaperone DnaK. The DnaK-rNEMO complex forms
a supramolecular structure (3:3) that may correspond to an assembly
intermediate of rNEMO trapped in its trimeric state.
The C-terminal Domain of rNEMO Forms a Trimeric
Coiled-coil--
In order to understand which region of NEMO mediates
its oligomerization, we compared the sequences of NEMO and of the
related proteins NRP/FIP-2 (39, 40). The best conserved C-terminal half
(amino acids 240-412 in NEMO) includes both the coiled-coil CC2 and
the LZ domains, as well as the ZF motif (Fig.
7). The analysis of the 7-residue repeat
composing each coiled-coil domain using the MultiCoil program (41)
predicts that the CC2 shows a propensity to form trimeric coiled-coils,
whereas LZ, similar to the wild-type GCN4 LZ (42), is likely to
self-associate into dimer. To determine which type of oligomer can be
formed with the C-terminal part of NEMO, we tried to express the
C-terminal domain in E. coli. Unfortunately the complete
fragment was poorly produced in E. coli, making its
purification difficult. We next decided to express a fragment
corresponding to the C-terminal part of NEMO devoid of the 24 C-terminal amino acids composing the zinc finger motif (residues
242-388). This fragment was well expressed in E. coli,
and the use of the purification procedure, described under
"Experimental Procedures," resulted in 6 mg of homogeneous protein
from 1 liter of culture. As the mutant protein also showed a propensity
to form aggregates, all buffers were also supplemented with DDM (0.1 mM). The apparent molecular mass observed by SDS-PAGE
(inset of Fig. 8a)
was in agreement with the calculated molecular mass of purified
truncated mutant of 19,625 Da. During the last chromatographic step,
the fraction of the truncated mutant protein which passed through the
Q-column (80%) was homogeneous (inset of Fig.
8a), whereas the part (20%) eluted with a salt linear
gradient was associated to DnaK in a stoichiometry of 1:1 (data not
shown).
View larger version (5K):
[in this window]
[in a new window]
|
Fig. 7.
Schematic structural organization of
NEMO. The boxes indicate the major structural motifs as
follows: coiled-coil (CC1 and CC2), leucine
zipper (LZ), and zinc finger motifs (ZF).
|
|
View larger version (11K):
[in this window]
[in a new window]
|
Fig. 8.
CD spectrum and SDS-PAGE analysis of purified
C-terminal fragment of NEMO. a, CD spectrum of the
C-terminal domain (0.8 mg/ml) was recorded at 20 °C in 20 mM potassium phosphate, pH 7.0, containing 1 mM
dithioerythritol and 0.2 mM DDM. Inset, the
purified truncated C-terminal domain of NEMO (2 µg of protein in
lane) was analyzed on a 15% SDS-PAGE and revealed by Coomassie
staining. The positions of size markers are shown. b,
concentration dependence at 20 °C of the CD signal at 222 nm ( and 208 nm ( ) of the C-terminal fragment of NEMO.
|
|
The CD spectrum of the purified truncated mutant is shown in Fig.
8a. It is similar to that of WT rNEMO with a maximum at 192 nm and two minima at 208 and 222 nm, but the amplitude of each dichroic
band is significantly higher, yielding an -helix content of 52%
instead of 45% in the case of WT rNEMO. In contrast to the WT rNEMO
where the same -helical content was detected over a large protein
concentration range (2-40 µM) (data not shown), molar
dichroic absorption of the C-terminal fragment showed a strong
concentration dependence. As shown in Fig. 8b, the increase of protein concentration induced a significant increase in helicity with a plateau at 10-11 µM, consistent with the
formation of intermolecular coiled-coils induced by the oligomerization
of the C-terminal fragment.
The quaternary structure of the C-terminal fragment was determined by
equilibrium sedimentation. Table II
summarizes the results of two fits using either a monospecies model or
a monomer-dimer-trimer model. All radial distributions obtained at
12,000 or 18,000 rpm with a loading concentration of either 1 or 1.2 mg/ml were poorly fitted with the one-component model (average
molecular mass of about 35,000 Da) well above the 19,625 mass of
monomer indicating oligomerization of the C-terminal fragment. The best
fit at 18,000 rpm was obtained with a monomer-dimer-trimer model which
gave a significant improvement of 
2 and a random
distribution of residuals as compared with monospecies or bispecies
models (monomer-trimer or dimer-trimer). Therefore, in a protein
concentration range of 0.5 to 2.1 mg/ml, the average distribution of
the C-terminal fragment present in solution was monomer (54%), dimer
(16%), and trimer (30%) with dissociation constants
KM
D, KDT, and
KMT equal to 117, 17.6, and 8.8 µM, respectively, indicating that the affinity of the homotrimer is 13-fold higher than that for the homodimer.
View this table:
[in this window]
[in a new window]
|
Table II
Sedimentation equilibrium experiments with recombinant C-terminal
truncated form of NEMO-(241-388)
All experiments were performed in the presence of 10 mM OG
at 10 °C as described under "Experimental Procedures."
|
|
Quaternary Structure of Native NEMO--
Previous experiments (14)
using gel filtration analysis of S100 extracts in different cell lines
showed that native NEMO is always present in association with IKK
kinases and that no free form of the protein could be detected. In
order to determine the oligomeric state of the NEMO in these complexes,
in vivo chemical cross-linking experiments in HeLa cells
were performed using the permeable homobifunctional cross-linker, BMOE,
which reacts specifically with the cysteine residues (see
"Experimental Procedures"). The extent of total protein
cross-linking was probed by the SDS-PAGE analysis of crude extracts,
either treated or mock-treated with 1 mM BMOE. As shown in
Fig. 9A, the pattern of
treated cells only slightly differed from that of the control,
indicating that only a small number of cellular proteins were
cross-linked. When the cross-linked cells were compared with the
mock-treated cells by immunoblotting with either NEMO antibodies or
with anti-IKK antibodies, specific cross-links were detected for
both proteins (Fig. 9B). Note that no band corresponding to
either NEMO (48,200 Da) or IKK (86,564 Da) was observed in cells
treated with BMOE, indicating that the cross-linking reaction was
complete. Three species specifically reacted with anti-NEMO antibodies,
with masses of 110, 160, and about 350 kDa, respectively. The 110- and
160-kDa species matched the masses of the cross-linked dimer and trimer
of NEMO. The slightly slower migration as compared with the theoretical
masses of NEMO dimer (96 kDa) and trimer (144 kDa) was probably due to
the cross-linker molecules that may affect the electrophoretic
migration. The detection of the cross-linked dimer of NEMO could
reflect a partial cross-linking of the NEMO trimer. This was not the
case because extended incubation of the cross-linker with HeLa (2 h)
did not change the relative proportions of cross-linked dimer and
cross-linked trimer (data not shown). When using anti-IKK
antibodies, only one species of about 350 kDa was detected in treated
cells. This 350-kDa species, which co-migrated with the third
cross-linked species generated with anti-NEMO antibodies (Fig.
9B), is likely to correspond to the cross-linked IKK
complex.
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 9.
Chemical cross-linking of NEMO in
vivo. A, HeLa cells were either treated
(lane +) with the BMOE cross-linker or mock-treated
(lane ). The reaction was quenched by adding a molar
excess of dithioerythritol as described under "Experimental
Procedures." The total protein content (5 µg), corresponding to
soluble and insoluble proteins, was prepared by directly boiling the
cells in SDS buffer containing 6 M urea followed by
analysis by 15% PAGE and Coomassie staining. B,
similar experiments were performed as described for A except
that Western blottings were performed with anti-NEMO (left)
or with anti-IKK (right).
|
|
| |
DISCUSSION |
In the present study, the oligomeric state of native and
recombinant NEMO purified from E. coli was investigated
leading to the identification of a domain responsible for its
self-association as a trimer. A variety of biochemical methods showed
that most of rNEMO is in a monomeric state. This demonstration mainly
relies on ultracentrifugation experiments. The data deduced from the sedimentation velocity were best interpreted using a two-species model
which identified unambiguously the presence of monomer (species M1) in the rNEMO protein preparation. The fits of
sedimentation profiles for species M2 yielded an average
sedimentation coefficient of 5.5 S and a diffusion coefficient of 10.9 107 cm2/s. This very large diffusion
coefficient reflected an equilibrium with a heavier species whose
presence was confirmed by the equilibrium sedimentation experiments.
Monomeric rNEMO displays an aberrant retarded elution in gel
permeation. This suggests that the molecular mass of the IKK complex
previously determined by gel filtration (700-900 kDa) was
overestimated (14, 20, 43). This very high aberrant Stokes radius of
the rNEMO monomer (73 Å) along with the poor resolution of the gel
filtration made it impossible to separate the free form of rNEMO from
that bound to DnaK. It should be noted that, in general, the early
elution of a protein from a gel permeation column is either due to a
denatured state, to a very elongated shape, or to a protein/detergent
micellar structure. However, our data from velocity and equilibrium
sedimentation experiments demonstrate that rNEMO monomer behaves as a
globular protein. In addition the far-UV CD spectrum of rNEMO as well
as the interaction assay with IKK show that this monomer is in a native
state. It thus appears that interference with the matrix combined with
the presence of some detergent molecules bound to rNEMO is the cause
for the aberrant elution of the monomer from the gel permeation.
The presence of a DnaK-rNEMO complex was best seen in equilibrium
sedimentation (Fig. 6) showing that rNEMO can form a high molecular
weight complex (360 kDa) with DnaK comprising 3 molecules of each
protein. Neither free DnaK, which exists in a monomer-dimer-trimer equilibrium (44), nor a DnaK-rNEMO complex with a stoichiometry of 1:1
could be detected. This was probably due to the presence of a molar
excess of rNEMO in all experiments and to the high propensity of the
DnaK-rNEMO complex to self-assemble at the concentration used
(0.1-1.25 mg/ml). Because we showed that DnaK binds to NEMO in a
stoichiometric ratio of 1:1 (see Fig. 2a), the DnaK-rNEMO complex is likely formed via the trimerization of rNEMO. Thus, the
fraction of rNEMO bound to DnaK may represent an assembly intermediate
of rNEMO in E. coli. It is usually thought that DnaK recognizes with high affinity proteins exposing locally short hydrophobic segments either in an extended conformation or as elements
with no secondary structure such as loops (45, 46). We showed that the
C-terminal fragment of rNEMO also binds to DnaK, although it was
correctly folded forming a stable trimeric coiled-coil (data not
shown). We hypothesize that the association with DnaK could occur with
the monomer of the C-terminal fragment which contains at least two
coiled-coils motifs with a suitable hydrophobic -helical interface.
Indeed, the motif EEALVAKQE (positions 263-271) composing the CC2
coiled-coil was predicted to be a DnaK-binding site with a very high
score (47). The question then arises why the rNEMO behaves mainly as a
monomer, whereas the endogenous form in association with its IKK
partners is in equilibrium between a dimer and a trimer. Our hypothesis
is that the interactions of IKK partners through the N-terminal domain
of rNEMO have a coupling effect in its self-assembly which is impaired
in the absence of this interaction. Consistent with this hypothesis, the C-terminal fragment of NEMO deleted of the IKK binding domain forms
a stable trimeric coiled-coil structure that was significantly stabilized upon oligomerization as shown by CD (see Fig.
8b).
We demonstrate an association of NEMO with the human protein Hsp70
homologous to DnaK. Previous work (48, 49) showed a role for eukaryotic
Hsp70 and Hsp90 in the conformational maturation of signal transduction
molecules, and recently, the requirements of Hsp70 and Hsp90 proteins
in the NF-B activation of lipopolysaccharide-induced cells were
reported (50, 51). It is likely that Hsp70 alone or in association with
Hsp90 is involved in maintaining the monomeric metastable NEMO in a
state competent to bind to IKK or IKK kinases. This association
may facilitate the correct oligomeric assembly of NEMO through
stabilization of its N-terminal domain. Our data also suggest that NEMO
is more sensitive to proteolytic degradation in the absence of this
interaction. We propose that Hsp70 and Hsp90 proteins may play a key
role in controlling the biological activity of NEMO and thereby in the
activation of NF-B.
Even though there is strong genetic evidence that NEMO is essential for
the activation of the IKK complex, the molecular mechanism by which it
activates IKK kinases is poorly understood. It has been proposed that
NEMO activates the IKK complex by recruiting it to a receptor, but this
mechanism was recently questioned by results showing that the IKK
complex was still recruited to tumor necrosis factor R1 in response to
TNF in NEMO-deficient cells (18). In contrast the results by others
(19-21) indicate that the oligomerization of NEMO plays a key role in
the activation of IKK kinases. The biochemical characterization of the
purified C-terminal fragment of NEMO shown in this paper suggests that it is based on a coiled-coil trimer rather than on coiled-coil dimers.
The C-terminal domain contains both an LZ motif, well known to form
stable homo- or heterodimers, and a CC2 coiled-coil motif, which is
predicted to form a coiled-coil trimer. Thus, the trimeric assembly
of NEMO is likely governed by the CC2 coiled-coil motif and not by the
LZ motif, the latter being probably rather involved in a specific
hetero-association. The expression of NEMO lacking only the CC2 domain
does not restore the NF-B activation in NEMO-deficient 1.3E2 cells
after lipopolysaccharide
stimulation,2 indicating that
the trimerization is crucial for activation of IKK complex.
Furthermore, the CC2 domain is a key element for NEMO biological
function because a point mutation Ala
Gly within this domain
leads to EDA-ID syndrome (17).
Fig. 10 shows a model for the
regulation of NEMO function upon its oligomerization. In this model,
the NEMO LZ forms heterodimers with upstream activators corresponding
either to viral proteins (52) or to signaling proteins belonging to the
interleukin-1/lipopolysaccharide or TNF pathways, for example the
receptor-interacting protein involved in the response to TNF-. We
propose that the association of NEMO with these upstream regulatory
components triggers the activation of the IKK complex by a
conformational change via its trimerization. The formation of a
homodimer through the leucine zipper would then prevent this
association. Thus, different oligomeric states of NEMO
(2 or 3) shown in this study may
correspond to inactive or active states of the IKK complex,
respectively. Experiments attempting to correlate the dimer or trimer
oligomerization of NEMO with the inactive or active state of IKK
complex are in progress.
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 10.
A plausible model for the activation of the
IKK complex upon a change of NEMO oligomerization. The N-terminal
domain of NEMO containing the IKK kinase binding domain and the
C-terminal domain including the CC2 coiled-coil (CC2,
gray areas), the leucine zipper (LZ, light
gray areas), and the zinc finger (ZF) motifs are shown.
In non-stimulated cells NEMO may form a dimer through its CC2
coiled-coil motif leading to a stable inactive IKK complex. Upon
stimulation trimerization of NEMO may occur through its CC2 domain
providing a monomeric LZ suitable for a specific hetero-association
with an upstream inducer containing a specific complementary LZ
(black area). The ZF motif may have a concerted action with
the NEMO LZ to form a specific activator binding domain. This
oligomerization switch of NEMO would induce a conformation change to
IKK kinases triggering the IKK activity by phosphorylation.
|
|
§,
,
TOP
ABSTRACT
INTRODUCTION
