 |
INTRODUCTION |
The basal transcription factor TFIID is a multisubunit complex
consisting of TATA-binding protein
(TBP)1 and associated
factors (TAFIIs). TAFIIs display
multiple functions related to transcription regulation (1, 2). They are
required for recognition and binding to core promoter elements such as the initiator and the downstream promoter element (3-8). In addition, certain TAFIIs interact with activation domains of
transcription factors, interactions that were found to be essential for
transcription activation by activators in vitro (9). The
importance of TAFIIs in the transcription activation
process has also been supported by several studies in cultured cells
(10-16) and by genetic experiments in Drosophila (17,
18).
Despite the significant progress that has been made in the
characterization of TAFIIs at the biochemical level, little
is known about the physiological relevance of these studies or about the specific functions of individual TAF subunits in biological processes involving transcription regulatory programs. An important issue concerning the mechanism of TAF-mediated transcription activation is whether direct contact between activators and TAFIIs is
indeed essential for transcription in vivo and what is the
consequence of activator-TAF interaction in vivo.
Examination of activator-TAF connection is of particular interest
because activators have multiple potential coactivator targets within
the transcription machinery.
Studies in yeast carrying mutations in individual TAFII
subunits indicated that some TAFIIs are required for
transcription of the majority of class II genes and others for
transcription activation of only subsets of genes (19-28).
Interestingly, inactivation of certain individual TAFIIs
dramatically affects the stability and integrity of the entire TFIID
complex in vivo (5, 20, 22, 24, 27-29), complicating the
understanding of the function of the mutant subunit. Furthermore, some
of the TAFIIs are shared between TFIID and other complexes
such as yeast SAGA and human PCAF and TFTC (30, 31);
thus, a phenotypic alteration observed with these mutant
TAFIIs may be linked to any of the complexes containing
TAF.
TAFII105 is a member of the human
TAFII135 and Drosophila
TAFII110 family of TAFIIs, which has several
unique properties. Unlike the core TAFIIs that are
expressed in most cell lines at similar levels, TAFII105
expression is regulated. It is more abundant in the TFIID complex of
human B lymphocytes than in non-B cells (32). Consistent with this
expression pattern, TAFII105 was found to be involved in
transcription activation by p65/RelA, a member of the NF-
B family
(15), and OCA-B (14); both are required for lymphocytic gene
expression. TAFII105 appears to be present only in a small
fraction of TFIID complexes and therefore might be involved in
transcription of a relatively small subset of genes. The C-terminal
domain of human TAFII105 and TAFII130 and
Drosophila TAFII110 is highly conserved and has
interaction surfaces with other TAFIIs, implicating it in
the assembly of the TFIID complex. The N terminus of
TAFII105 is more variable and contains binding sites for
the activation domains of p65/RelA and OCA-B (14, 15). Because
TAFII105 is found only in a small portion of TFIID
complexes and may be required for transcription of a small subset of
genes, but is homologous to one of the core subunits, it has the
potential to be a good candidate for genetic analysis in mammals.
However, recent data obtained from the Human Genome Project revealed
another gene on chromosome 4 encoding a close homolog of
TAFII105 (accession number AC017007). The previously
identified gene is encoded by chromosome 18 (accession number
Y09321). The existence of an expressed sequence tag clone
identical to the chromosome 4 gene and the fact that a sequence of one
of the peptides derived from the TAFII105 protein more closely resembles the chromosome 4 gene (data not shown)
strongly suggest that this gene is also expressed and may display some redundant functions with the gene encoded by chromosome 18. Recently, mice deficient in TAFII105 were generated; the females of
these mice were found to be sterile due to defects in folliculogenesis, but no obvious phenotypic alterations in lymphoid organs were found
(33).
In this study, we addressed the physiological role and the mechanism of
action of TAFII105 in vivo by generating animal
models expressing dominant-negative mutant forms of
TAFII105 that are likely to inhibit the function of
TAFII105 proteins encoded by different genes. The results
revealed that TAFII105 is essential for the survival of B
and T lymphocytes, where the native protein is highly expressed. This
function of TAFII105 is dependent on a domain involved in
the interaction with the NF-B protein p65/RelA in vitro,
suggesting that activator-TAF interaction is important for the function
of TAFIIs in the transcription process in
vivo.
| |
MATERIALS AND METHODS |
Construction of Transgenes--
For the generation of a
lymphoid-specific TAFII105
C expression plasmid, a
TAFII105 fragment encoding amino acids 1-552 fused to a
hemagglutinin tag and a 
-globin intron was ligated into the
HpaI and XhoI sites of the pTDK vector
(kindly provided by Dr. M. van Lohoizen). This vector contains a
duplicated immunoglobulin heavy chain enhancer upstream of the
pim-1 promoter and a murine leukemia virus long terminal
repeat within the 3'-region (36). The fragment containing coding and
regulatory sequences was excised from the vector by SalI
digestion. No expression of the transgene was observed in lymphoid
organs of the transgenic mice (data not shown).
To generate transgenes ubiquitously expressing TAFII105
mutants, the previously described plasmids
pCMV-TAFII105C-(1-552) and
pCMV-TAFII105C-(452-472) were used (35). The
plasmids were linearized by AflIII/XmnI digestion
before microinjection.
Generation of Transgenic Mice--
The DNA fragments were
injected into the male pronucleus of (C57BL/6 × Balb/c)F1 embryos. Transgenic mice among the progeny were
identified by Southern blot analysis. Mice were bred and maintained under standard conditions in the Weizmann Institute of
Science Transgenic Facility.
Immunization of Mice--
Mice were immunized intraperitoneally
at 6-10 weeks of age with 50 µg of keyhole limpet hemocyanin (KLH)
(Calbiochem-Novabiochem) in complete Freund's adjuvant (Difco).
Southern Blot Analysis--
For the detection of the transgene
in the mouse genome, 10 µg of total genomic DNA from each mouse was
digested with EcoRI, separated on 1% agarose gels at 50 V,
and transferred to GeneScreen Plus nylon membrane (PerkinElmer
Life Sciences). Filters were hybridized at 65 °C overnight
with a 32P-labeled fragment of TAFII105C
(C-terminal truncated mutant). The probe was prepared using the
Rediprime random primer labeling system (Amersham Biosciences,
Buckinghamshire, United Kingdom).
For the identification of A20 PCR products, PCR products were run on
1.2% agarose gel and transferred to nylon membranes. The membranes
were hybridized at 37 °C for 2 h with a 32P-labeled
oligonucleotide (TTGACAGAAGTGTCCAGGCT). The oligonucleotide was labeled
with [
-32P]ATP using T4 polynucleotide kinase.
RT-PCR and Real-time Quantitative RT-PCR--
Total RNA was
extracted from spleen and thymus using Trireagent (Molecular
Research Center, Inc., Cincinnati, OH), according to the
manufacturer's instructions. RNA preparations were treated with RQ1
DNase I (Promega) to avoid contamination with genomic DNA. For reverse
transcription, 1 µg of total RNA was incubated at 42 °C in the
presence of avian myeloblastosis virus reverse transcriptase (Promega),
avian myeloblastosis virus reverse transcriptase buffer (Promega), 10 pM reverse-specific primer, 0.1 M
dithiothreitol, 2 µl of 10 mM dNTP, and 40 units of
RNasin (Promega) in a total volume of 30 µl.
RT-PCR analysis for the presence of transgenic mRNA was performed
with total RNA using primers that spanned the intron of the transgene
so that a PCR product obtained from spliced mRNA differed in size
from a product resulting from plasmid or genomic DNA amplification.
Quantitative PCR was performed in 20-µl glass capillary tubes using a
LightCycler system (Roche Molecular Biochemicals) equipped with a
thermal cycler and a real-time detector of fluorescence. 2 µl of
cDNA was amplified specifically using a LightCycler-FastStart DNA
Master SYBR Green I kit (Roche Molecular Biochemicals) according to the
manufacturer's instructions.
The oligonucleotides used for RT-PCR are as follows: for the detection
of transgenic mRNA, transgene forward (CAGCCTTCAGGAGGCAATGA) and
transgene reverse (TAGCCAGAAGTCAGATGCTC); and for the analysis of A20
expression, A20 forward (CGGAAAGCTGTGAAGATACGAGAG), A20 reverse
(TTCCAGTTCCGAGTGTCGTAGC), GAPDH forward (GCCATCAACGACCCCTTCAT), and GAPDH reverse (TTCACACCCATCACAAACAT).
Protein Analysis--
Total cell extracts from mouse tissues
were prepared as described (51). Cell extracts from transfected 293T
cells or from splenocytes were prepared by lysing the cells in buffer
containing 50 mM Tris (pH 7.9), 250 mM NaCl, 5 mM EDTA, 0.5% Nonidet P-40, 1 mM
dithiothreitol, 0.2 mM phenylmethylsulfonyl fluoride, 5 µg/ml aprotinin, and 1 µg/ml leupeptin. Nuclei and cell debris were removed by centrifugation. For immunoprecipitation, 1 µl of either anti-TBP or anti-invertase (control) serum was used. Proteins were
separated by SDS-PAGE, transferred to Protran BA83 nitrocellulose membrane (Schleicher & Schüll), and incubated with the indicated primary antibodies. The blot was then incubated with goat horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA), followed by enhanced chemiluminescent staining using SuperSignal chemiluminescent substrate (Pierce).
Flow Cytometry--
Single cell suspensions from spleen and
thymus were prepared by crushing the organs in RPMI 1640 medium without
serum, followed by hypotonic lysis of erythrocytes. Freshly isolated
cells were incubated on ice for 0.5 h with the following
antibodies: anti-B220 (CyChrome), anti-CD4 (PE), and anti-CD8a
(CyChrome) (all from BD PharMingen). Apoptotic cells were detected
using an ApoScreen fluorescein isothiocyanate-annexin V apoptosis kit
(Southern Biotechnology Associates, Inc., Birmingham, AL). Stained
cells were analyzed on a FACScan using Cell Quest software (both from
BD PharMingen).
Enzyme-linked Immunosorbent Assays--
For enzyme-linked
immunosorbent assays, 96-well plates (Nalge Nunc International,
Naperville, IL) were coated overnight at 4 °C with 5 µg/ml KLH
solution in phosphate-buffered saline. After removing the KLH solution,
the plates were washed three times with phosphate-buffered saline
containing 0.05% Tween 20. Serial dilutions from the sera of immunized
mice were added and incubated for 2 h at room temperature. After
extensive washes, the plates were incubated for 2 h at room
temperature with horseradish peroxidase-conjugated goat antibodies
against different classes of mouse immunoglobulins (Clonotyping System
HRP, Southern Biotechnology Associates, Inc.). The plates were
washed again four times. ABTS solution (Sigma) was added, and the
enzymatic reaction was quantitated in a microplate reader. The levels
of anti-KLH Ig subclasses (at a serum dilution of 1:200) were
determined 1 and 2 weeks after immunization. Results are expressed as
A405 values.
Chromatin Immunoprecipitation Assay--
This assay was
performed on the basis of a previously published protocol with some
modifications (52). Daudi B cells (108) were cross-linked
in vivo with 1% formaldehyde for 10 min at room
temperature. Cells were washed once with cold phosphate-buffered saline, once with 2.5 ml of buffer I (10 mM Hepes (pH 6.5)
10 mM EDTA, 0.5 mM EGTA, and 0.25% Triton
X-100), and once with buffer II (10 mM Hepes (pH 6.5) 1 mM EDTA, 0.5 mM EGTA, and 200 mM
NaCl). Cells were resuspended in 1 ml of lysis buffer (50 mM Tris (pH 8.1) 10 mM EDTA, 1% SDS, 0.8 µg/ml pepstatin A, 0.6 µg/ml leupeptin, and 1 mM
phenylmethylsulfonyl fluoride) and sonicated 10 times for 10 s
each time. The extract was then clarified by centrifugation for 15 min
in a microcentrifuge at 4 °C and diluted 10-fold with dilution buffer (20 mM Tris (pH 8.1), 150 mM
NaCl, 2 mM EDTA, and 1% Triton X-100) to yield the
solubilized chromatin. Next, salmon sperm DNA (50 µg/ml), tRNA
(100 µg/ml), and bovine serum albumin (1 mg/ml) were added; and the
extract was precleared by addition of 50 µl of 50% protein
A-Sepharose suspension beads/ml and incubation for 30 min on a
rotator wheel. After 15 min of centrifugation at 4 °C, the extract
was transferred to a new tube. A sample of 5 µl of the soluble
extract was analyzed on 1% agarose gel to confirm an average size of
1-kb DNA and the relative amount of the input material for each sample.
For immunoprecipitation, 1 µl of anti-TBP, anti-TAFII105,
anti-p65, or control sera was added to 0.5 ml of the
soluble chromatin (corresponding to 5-10 × 106
cells) and incubated from 4 h to overnight at 4 °C. After
centrifugation, the extracts were transferred to a new tube containing
25-30 µl of 50% protein A-Sepharose suspension and incubated at
4 °C for 1-2 on the rotator wheel. The beads were then washed
sequentially with 150 mM NaCl + TSE buffer (TSE buffer: 20 mM Tris (pH 8.1), 0.1% SDS, 2 mM EDTA, 1%
Triton X-100, and 150 or 500 mM NaCl), 500 mM
NaCl + TSE buffer, and buffer III (10 mM Tris (pH 8.1), 0.25 M LiCl, 1% Nonidet P-40, 1% deoxycholate, and 1 mM EDTA) and three times with TE buffer (10 mM
Tris (pH 8) and 1 mM EDTA). The immune complexes were then
eluted from the Sepharose beads by incubating the beads three times
with 100 µl of elution buffer (1% SDS, 0.1 M
NaHCO3, and 20 µg/ml glycogen) for 10 min each time. The
combined eluates were heated at 65 °C for 4 h to reverse the
formaldehyde cross-links. The eluates were extracted once with
phenol/chloroform and once with chloroform, precipitated with ethanol,
and resuspended in 20 µl of TE buffer. 2 µl were used for PCR. The
primers used for the A20 promoter were 5'-CAG CCC GAC CCA GAG AGT
CAC-3' and 5'-CGGGCTCCAAGCTCGCTT-3'.
| |
RESULTS |
Expression of TAFII105 in Mouse Tissues--
As a
first step toward understanding the biological role of
TAFII105, we determined the expression pattern of the
TAFII105 protein in mouse tissues. The TAFII105
protein was found in brain, testis, spleen, and thymus and was
undetectable in lungs, liver, kidney, and heart (Fig.
1A). The presence of
TAFII105 in the lymphoid organs is consistent with previous
results showing high levels of expression of TAFII105 in
mature B cell lines (32). TAFII105 was not expressed at
detectable levels in bone marrow, where B and T cells originate (Fig.
1B). The significant expression of TAFII105 at
the mature stage of lymphocyte development suggests that it may play a
role in immunological functions associated with differentiated B and T
cells.
View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1.
Expression pattern of endogenous
TAFII105 in mouse tissues. A: upper
panel, protein extract was prepared from mouse tissues as
described under "Materials and Methods" and analyzed by Western
blotting using affinity-purified anti-TAFII105 antibody.
Lower panel, the same amounts of protein extracts were
examined by Coomassie Blue staining. B: comparison of
TAFII105 expression in the indicated lymphoid tissues by
Western blotting and Coomassie Blue staining.
|
|
Generation of Mouse Lines Expressing Dominant-negative Mutants of
TAFII105--
To analyze the function of
TAFII105 and the physiological importance of its
interaction with the p65/RelA member of the NF-B family, we set out
to generate transgenic mice expressing dominant-negative mutant forms
of this protein lacking the conserved C-terminal domain involved in
interaction with other TAFIIs (data not shown). When a
C-terminal truncated mutant (TAFII105C) or a full-length TAFII105 protein was expressed in cultured cells,
TAFII105C did not assemble into the TFIID complex,
whereas the full-length protein did (Fig.
2B), indicating that
TAFII105C is either loosely or not associated with
TFIID. Similarly, TAFII130 C-terminal domain was recently
reported to be important for assembly into the TFIID complex (34).
Because TAFII105C binds to the p65/RelA activation domain similarly to the full-length protein (15), expression of this
mutant in cells would compete with endogenous TAFII105 protein for binding with p65/RelA, but not with TFIID, thus exerting a
dominant-negative effect. Previous experiments in cultured cells showed
that TAFII105C acts as a specific inhibitor of
TAFII105 function, as it has an effect similar to depletion
of the endogenous protein by antisense expression (15). Furthermore, a
C-terminal truncation of Drosophila TAFII110, a
homologous subunit of TAFII105, displayed a phenotype that
is identical to deletion of the TAFII110 gene (18). In view
of the high degree of homology between the human and mouse genomes and
the recent finding that two different human chromosomes encode highly
related homologs of TAFII105 (see the Introduction), it is
likely that TAFII105C would inhibit the function of
both.
View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
Characterization of dominant-negative mutant
TAFII105. A, schematic representation of
wild-type and dominant-negative mutant TAFII105.
B, TAFII105, but not TAFII105C,
is associated with the TFIID complex. 293T cells were transfected with
plasmids encoding hemagglutinin (HA)-tagged
TAFII105 and TAFII105C. Total cell extracts
were prepared 48 h after transfection and incubated with anti-TBP
(lanes 7-9) or anti-invertase (lanes 4-6)
polyclonal antibody (Ab) bound to protein A-Sepharose beads.
Bound proteins were eluted and analyzed by Western blotting using
anti-hemagglutinin monoclonal antibody (left panel) and
anti-TBP antibody (right panel). The asterisk
corresponds to a nonspecific band.
|
|
To generate the transgenic mice, we used expression plasmids encoding
TAFII105C and TAFII105C-NFB (Fig.
3A).
TAFII105C-NFB has an additional internal deletion
of 18 amino acids spanning the C-terminal NF-B-binding site within
TAFII105 (35). Consistent with the presence of only one
NF-B-binding site, TAFII105C-NFB bound only
40% of p65/RelA compared with TAFII105C (Fig.
3B).
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
Generation of transgenic mice expressing
dominant-negative mutants of TAFII105. A:
shown is a schematic representation of TAFII105
dominant-negative mutants used for generation of transgenic mice.
B: show is the interaction between TAFII105C
or TAFII105C-NFB and the NF-B protein
p65/RelA. Equal amounts of TAFII105C and
TAFII105C-NFB fused to glutathione
S-transferase (GST) were purified from bacteria
with glutathione-Sepharose beads and used for binding assays with
35S-labeled p65/RelA protein. As a control for binding
specificity, glutathione S-transferase protein was analyzed
in a similar manner. input represents 10% of the labeled
protein used for the binding. C: Southern blot analysis was
carried out with a transgene-specific probe, showing integration of the
transgenes into the mouse genome. Line 7 is transgenic for
TAFII105C-NFB. The other lines are transgenic for
the TAFII105C mutant. D: upper
panel, RNA was extracted from splenocytes and used for RT-PCR
analysis with a transgene (Tg)-specific primer set,
followed by hybridization with a transgene-specific probe, showing
mRNA expression of the transgenes. Lower panel, control
RT-PCR was carried out with GAPDH primers. E: upper
panel, Western blot analysis was carried out with
anti-hemagglutinin antibody, showing expression of the transgene in
mouse tissues from line 48. Lower panel, Western blot
analysis was performed with anti-TAFII105 antibody, showing
expression of the transgene in spleens from different transgenic lines.
Note the low level of expression of the transgene (indicated by
asterisks) compared with endogenous TAFII105.
pc, positive control representing extract from human 293T
cells transiently transfected with the TAFII105C
transgene; Wt/wt, wild-type.
|
|
Considering the possible role of TAFII105 in the immune
system, our initial attempts were to achieve targeted expression of the
dominant-negative mutant in lymphoid tissues using a lymphoid-specific expression vector (36). Although we have obtained 12 TAFII105C transgenic lines, we failed to detect
TAFII105C RNA or protein expression in lymphoid tissues
of these mice (data not shown). Therefore, we used another expression
vector driven by the cytomegalovirus promoter, which is supposed to
direct ubiquitous expression of the transgene. Among 10 transgenic
lines carrying TAFII105C and eight lines carrying
TAFII105C-NFB transgenes in their genome (Fig.
3C and data not shown), only five and three lines,
respectively, expressed transgenic mRNA and protein (Fig. 3,
D and E). It should be noted that the level of
expression of the transgene in lymphoid tissues was low and in all
cases was below the level of expression of endogenous
TAFII105 (Fig. 3E). The expression level of
TAFII105C-NFB (line 7) was higher than that of
TAFII105C (Fig. 3E, lower panel), thus enabling us to compare their phenotypes. Furthermore, the level of
expression of TAFII105C declined with generations, and variable levels of expression between individuals within the same line
were observed. These observations may be explained by a possible toxic
effect of TAFII105C. Transgenic mice, expressing the low level of TAFII105C protein, were viable, but more prone
to microbial infections, occasionally emerging in transgenic facility
(Klebsiella pneumoniae, Micrococcus spp.,
Pseudomonas aeruginosa, etc.). Some of the female mutant
animals were sterile. The results of the subsequent experiments were
reproducible in three independent lines expressing the transgene,
ruling out the possibility of integration position effect.
Increased Levels of Apoptosis in Lymphocytes from
TAFII105C Transgenic Mice--
To determine the effect
of TAFII105C expression on the immune system, we
analyzed B and T lymphocytes in spleen and bone marrow and found no
significant difference in the relative number of these populations
compared with wild-type animals (data not shown). However, the total
number of lymphocytes in spleens from TAFII105C
transgenic mice was significantly lower than in spleens from wild-type
or TAFII105C-NFB animals (Fig.
4A). Taking
into account the results of previous studies that showed an
anti-apoptotic role for TAFII105 in cultured cells (15), we
hypothesized that the reduction in lymphocyte number in transgenic mice
might be caused by increased levels of apoptosis. To test this
possibility, we performed FACS analysis of splenocytes from wild-type
and transgenic mice labeled with anti-B220 (marker of B cells),
anti-CD4 (marker of helper T lymphocytes), or anti-CD8 (marker of
cytotoxic T lymphocytes) antibody together with annexin V, which serves
as a marker of cells in early apoptosis. As shown in Fig.
4B, the percentage of apoptotic B cells (24.8 versus 5.8), helper T cells (12.3 versus 3.5),
and cytotoxic T cells (9.0 versus 2.8) was significantly increased in splenocytes from TAFII105C transgenic mice
compared with wild-type animals. To investigate the possibility that
inhibition of the anti-apoptotic response is associated with
interaction with p65/RelA, a similar experiment was performed with
transgenic animals expressing TAFII105C-NFB.
Remarkably, the number of apoptotic B and T cells in spleens from
TAFII105C-NFB mice was the same as in control mice
(Fig. 4C).
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
Elevated apoptosis in splenocytes from
TAFII105C transgenic mice.
A, reduced number of lymphocytes in spleens from
TAFII105C transgenic mice. Lymphocytes from wild-type
and transgenic mice (lines 134 and 7, respectively) were prepared as
described under "Materials and Methods" and counted. Similar
results were obtained in experiments with four other transgenic lines.
B, elevated apoptosis in B lymphocytes (B220+),
helper T lymphocytes (CD4+), and cytotoxic T lymphocytes
(CD8+) from spleens of TAFII105C transgenic
mice (line 134). Lymphocytes were incubated with one of the antibodies
against the cell markers (B220, CD4, or CD8) together with annexin V,
which serves as a marker for apoptotic cells. The upper right
quadrants represent the apoptotic populations of the cell types
examined. C, an experiment similar to that described for
B was performed with splenocytes from
TAFII105C-NFB transgenic mice (line 7). The
right panels show the averages of results obtained from
experiments with three transgenic lines.
|
|
To test whether TAFII105 is involved in the control of
apoptosis also in thymus, we performed triple staining of
thymocytes with CD4, CD8, and annexin V markers, followed by FACS
analysis. By this analysis, we could monitor the relative number of
apoptotic and non-apoptotic T cell populations: immature
double-negative CD4
/CD8 T cells and
double-positive CD4+/CD8+ T cells and mature
helper T cells (CD4+/CD8) and cytotoxic T
cells (CD4/CD8+). We found a 3-4-fold
increase in the proportion of apoptotic cells in all different
thymocyte populations from TAFII105C transgenic mice
compared with wild-type animals (Fig.
5A). By contrast, the level of
cell death of all T cell populations in
TAFII105C-NFB transgenic mice was similar to that
in wild-type mice (Fig. 5B). Interestingly, the relative
number of single-positive CD4+ or CD8+ T cells
in TAFII105C mice decreased by 2-3-fold, whereas no significant change in the proportion of double-positive and
double-negative cell populations was observed despite the increase in
cell death rates. These results suggest that TAFII105 may
be important in early stages of T cell maturation common to both
CD4+ and CD8+ cells.
View larger version (21K):
[in this window]
[in a new window]
|
Fig. 5.
Elevated apoptosis in thymocytes
from TAFII105C transgenic mice
(line 134). A: upper panels, T cell
suspensions obtained from thymuses of wild-type and
TAFII105C transgenic mice were triple-stained with
anti-CD4 and anti-CD8 antibodies and annexin V, followed by FACS
analysis. The color index is shown on the right. Lower
panel, the results of the same experiment are represented in a bar
graph. The relative percentage of apoptotic cells in each population is
shown above the bars and represents the average of three independent
experiments. Similar results were obtained in experiments with two
other transgenic lines. B: an experiment similar to that
described for A was performed with thymocytes from
TAFII105C-NFB transgenic mice (line 7).
|
|
Expression of the Anti-apoptotic Gene A20 Is Impaired in
TAFII105C Transgenic Mice--
Previously, we reported
that the anti-apoptotic gene A20 is a transcriptional target of the
substoichiometric TAFII105·TFIID complex (35). A20 is
expressed at particularly high levels in lymphoid organs of mice,
especially in spleen and thymus (37). To examine the possible effect of
dominant-negative mutants of TAFII105 on expression of
endogenous A20, we checked the level of A20 mRNA in wild-type and
transgenic mice expressing TAFII105C and
TAFII105C-NFB. RNA was extracted from the thymuses
of wild-type and transgenic mice and used in quantitative RT-PCR
employing a LightCycler with primers specific for either the mouse A20
gene or the housekeeping gene GAPDH, which served as an internal
control. Consistent with the fact that the A20 gene is regulated by
NF-B (38), we found that TAFII105C inhibited A20
expression more efficiently than TAFII105C lacking the
major NF-B-binding site (Fig.
6A). The partial inhibition of
A20 expression observed in the TAFII105C-NFB
mutant may be explained by the presence of another NF-B-binding site
in this mutant (35). We also examined the effect of the transgenes on
other survival genes such bcl-2 and
bcl-XL and found that both transgenes had little inhibitory effect on expression of these genes (data not shown), suggesting that these genes are not involved in the enhanced apoptosis in TAFII105C mice. This finding is consistent with the
notion that TAFII105 is required for transcription of a
subset of NF-B-regulated genes.
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
A, effect of TAFII105
mutants on A20 expression. RNAs from thymuses of wild-type and
transgenic animals (line 134) were extracted (as described under
"Materials and Methods") and used for real-time quantitative RT-PCR
analysis using a LightCycler. The results are expressed as a percentage
of the value of wild-type expression and normalized to the value of
GAPDH. The identity of the PCR products was confirmed by running on
agarose gel and staining with ethidium bromide. B,
TAFII105 binds the A20 promoter in vivo. Daudi B
cells were cross-linked in vivo with 1% formaldehyde.
Soluble chromatin was prepared from these cells and used for
immunoprecipitation with either control antibody (Ab;
anti-hepatitis B virus core) or TAFII105-, TBP-,
and p65/RelA-specific antibodies (chromatin immunoprecipitation
assay). The immunoprecipitated DNAs were analyzed for the A20 promoter
by PCR. To confirm the amplification of the A20 promoter in the
immunoprecipitated samples, the PCR products were analyzed by Southern
blotting.
|
|
To examine the relevance of the inhibition of A20 gene transcription by
TAFII105C to the function of endogenous
TAFII105 protein, we tested whether the A20 promoter is
directly bound by the TAFII105·TFIID complex in living
cells. For this purpose, DNA·protein complexes from the Daudi B cell
line were cross-linked in vivo with formaldehyde, followed
by soluble chromatin preparation and immunoprecipitation with either
control antibodies or TAFII105-, TBP-, and
p65/RelA-specific antibodies. The presence of the A20 promoter on the
bound complexes was determined by PCR, followed by Southern blot
analysis. As shown in Fig. 6B, the promoter of the A20 gene
was specifically enriched by the anti-TAFII105,
anti-TBP, and anti-p65/RelA antibodies, but not by the control
antibodies. The enrichment of the promoter region by the
anti-transcription factor antibodies was specific, as the coding region
of the A20 gene was not immunoprecipitated by these antibodies (data
not shown). These results provide strong evidence that the A20 promoter is directly bound and regulated by the substoichiometric
TAFII105·TFIID complex in vivo as well as by
NF-B.
Dominant-negative TAFII105 Has a Selective Inhibitory
Effect on the Production of Antigen-specific Antibodies--
To
examine the role of TAFII105 in the humoral immune
response, we evaluated the capacity of the dominant-negative mutant to
affect the production of immunoglobulins. To this end, we measured the
levels of antigen-specific antibodies in TAFII105C
transgenic and wild-type mice. The animals were immunized with KLH; and
after 7 and 14 days, sera were checked by enzyme-linked immunosorbent assay using isotype-specific antibodies. The levels of anti-KLH IgM,
IgG2a, and IgG3 in TAFII105C transgenic mice were
significantly lower than in control animals, but no significant
differences were found in the levels of IgG1 and IgG2b (Fig.
7). By contrast, the levels of IgM,
IgG2a, and IgG3 were not changed in TAFII105C-NFB transgenic mice (data not shown). These results demonstrate the importance of TAFII105 in antibody production and isotype
switching.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 7.
Selective inhibitory effect of the
TAFII105C transgenic mutant on the
production of antigen-specific antibodies. Mice were immunized
with 50 µg of KLH in complete Freund's adjuvant. The levels of
anti-KLH Ig subclasses (at a serum dilution of 1:200) were determined
by enzyme-linked immunosorbent assay 7 and 14 days after immunization.
The results are expressed as A405 values.
|
|
| |
DISCUSSION |
In this study, we have examined the function of
TAFII105 in the context of the whole organism and
determined the biological importance of a domain in
TAFII105 involved in interaction with the NF-B protein
p65/RelA in vitro. We generated and analyzed transgenic mice
expressing dominant-negative mutants of TAFII105, which
inhibit the function of TAFII105 and, most likely, also of
TAFII105 homologs. Because we did not interfere with
expression of the native protein, this strategy did not affect the
stability of the endogenous TAFII105·TFIID complex.
Furthermore, expression of different forms of dominant-negative mutants
allowed us to examine the structure-function relationship involved in
the mechanism of action of TAFII105 in vivo. We
provide evidence that one of the domains within TAFII105
required for interaction with p65/RelA in vitro is crucial
for lymphocyte survival and antibody production in the mouse. This
notion is consistent with previous findings indicating that
TAFII105C-NFB is a significantly less potent inhibitor of NF-B transcription activity than
TAFII105C (35) and strongly suggests that the C-terminal
NF-B-binding site within TAFII105 is a functionally more
important site than the N-terminal site. As NF-B has been
established as a survival factor in lymphocytes (39-43), the finding
that TAFII105 is important for activation of anti-apoptotic
genes in B and T lymphocytes implies that it cooperates with p65/RelA
in these cells to activate some of the NF-B target genes. The
observation that the NF-B interaction domain is also required for
IgM, IgG2a, and IgG3 isotype switching is also consistent with a recent
finding showing that B cells lacking p65 exhibit a defect in switching
to IgG3 (44). However, it has yet to be determined whether the effect
of TAFII105C expression on lymphocyte survival is
intrinsic or involves contributions of other cell types.
Programmed cell death is of fundamental importance in the immune system
and plays important roles in the control of the immune response and in
lymphocyte development and cytotoxicity (reviewed in Refs. 45-47). In
developing lymphocytes, cell death is the mechanism by which immune
cells that recognize self-antigens are deleted. This process ensures
the release of cells recognizing non-self-antigens into the periphery
and determines the finite life span of terminally differentiated cells.
Thus, apoptosis provides a flexible mechanism for controlling the
composition and size of the mature cell population. It has been
proposed that positive selection of thymocytes is a rescue from
a default pathway of death in developing thymocytes (48-50). The
TAFII105·NF-B complex may be required for the positive selection process during lymphocyte development and the immune response
by translating upstream positive signals into activation of survival
gene products. This idea is supported by our observation of a
significant reduction in the relative numbers of single-positive mature
T cells in TAFII105C transgenic mice. This effect may be
explained in part by the increased rate of apoptosis in the population
of immature double-positive thymocytes, from which mature T cells
develop by positive selection. However, given that the proportion of
the immature double-positive T cells in the thymuses of
TAFII105C mice is not decreased despite high apoptotic rates, it is possible that TAFII105 is important for T cell
maturation processes that are also apoptosis-independent.
The transgenic animals that we have obtained expressed very low amounts
of the dominant-negative proteins relative to the native endogenous
protein. The accelerated apoptosis of lymphocytes observed despite low
expression levels of the TAFII105C transgene may result
from the fact that the decision of lymphocytes to undergo apoptosis is
dependent on the extent of positive and negative survival signals
encountered by the cell. The amount of TAFII105C protein
in the lymphocytes of the transgenic animals may be sufficient to shift
a delicate balance of pro- and anti-apoptotic signals toward apoptosis.
Alternatively, cells expressing higher levels of the transgene are
those that may have been eliminated by apoptosis. It is therefore
likely that TAFII105 has additional functions that were not
explored in this study, as inhibition of other functions of
TAFII105 may require expression levels that are at least
comparable to those of the native protein. Our inability to obtain
transgenic animals expressing high levels of this protein and the
decline of its expression over generations raise the possibility that the protein may be toxic to the animals.
Early biochemical studies have suggested that activator-TFIID
interaction enhances the formation of a functional preinitiation complex (51-53). A question arising from this study is whether p65/RelA-TAFII105 interaction contributes to the assembly
of the preinitiation complex by enhancing recruitment of the
substoichiometric TAFII105·TFIID complex to the promoters
of anti-apoptotic genes expressed in lymphocytes. Future experiments
should address the molecular mechanism by which NF-B and its
coactivators affect the transcription process in
vivo.
B*
§,
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: Dept. of
Biological Chemistry, Weizmann Institute of Science, 2 Hertzel St.,
Rehovot 76100, Israel. Tel.: 972-8-934-2117; Fax: 972-8-934-4118;
E-mail: rivka.dikstein@weizmann.ac.il.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
