|
Originally published In Press as doi:10.1074/jbc.M200050200 on March 8, 2002
J. Biol. Chem., Vol. 277, Issue 20, 18010-18020, May 17, 2002
Heterogeneous Nuclear Ribonucleoprotein A3, a
Novel RNA Trafficking Response Element-binding Protein*
Alice S. W.
Ma ,
Kim
Moran-Jones ,
Jianguo
Shan ,
Trent P.
Munro §,
Mark J.
Snee¶,
Keith S.
Hoek , and
Ross
Smith**
From the Department of Biochemistry and Molecular Biology, The
University of Queensland, Brisbane,
Queensland 4072, Australia
Received for publication, January 3, 2002, and in revised form, February 14, 2002
 |
ABSTRACT |
The cis-acting response element,
A2RE, which is sufficient for cytoplasmic mRNA trafficking in
oligodendrocytes, binds a small group of rat brain proteins.
Predominant among these is heterogeneous nuclear ribonucleoprotein
(hnRNP) A2, a trans-acting factor for cytoplasmic
trafficking of RNAs bearing A2RE-like sequences. We have now identified
the other A2RE-binding proteins as hnRNP A1/A1B, hnRNP B1,
and four isoforms of hnRNP A3. The rat and human hnRNP A3 cDNAs
have been sequenced, revealing the existence of alternatively spliced
mRNAs. In Western blotting, 38-, 39-, 41-, and 41.5-kDa components
were all recognized by antibodies against a peptide in the glycine-rich
region of hnRNP A3, but only the 41- and 41.5-kDa bands bound
antibodies to a 15-residue N-terminal peptide encoded by an
alternatively spliced part of exon 1. The identities of these four
proteins were verified by Edman sequencing and mass spectral analysis
of tryptic fragments generated from electrophoretically separated
bands. Sequence-specific binding of bacterially expressed hnRNP A3 to
A2RE has been demonstrated by biosensor and UV cross-linking electrophoretic mobility shift assays. Mutational analysis and confocal
microscopy data support the hypothesis that the hnRNP A3 isoforms have
a role in cytoplasmic trafficking of RNA.
 |
INTRODUCTION |
Establishment of asymmetry in cells requires selective
localization of proteins. This may be accomplished by directed protein transport, a well established pathway for plasma membrane and secreted
proteins, or by trafficking and subsequent localization of mRNA.
Localization of RNA has been intensively studied in
Drosophila and Xenopus oocytes (for reviews see
Refs. 1-6) and more recently in mammalian somatic cells (7-12).
In 1982, Colman et al. (13) discovered that myelin basic
protein (MBP)1 mRNA is
concentrated in the myelin membrane fraction isolated from brain by
density gradient centrifugation. Subsequent experiments demonstrated
that MBP mRNA is translated close to myelin and the protein rapidly
incorporated into the nascent membrane (14-16) and lead to a model in
which MBP mRNA is recruited into RNA transport granules in the
perikaryon and then transported, by indirect attachment to the
microtubule-bound motor protein kinesin, to the myelin compartment at
the cell periphery (10, 17-21). The granules are localized in the
myelin compartment, and the RNA cargo is translated, with the MBP being
incorporated into the myelin membrane. Deletion studies led to the
conclusion that a small element in the 3'-untranslated region of
the MBP mRNA, the RNA transport sequence (RTS), is sufficient and
necessary for this cytoplasmic RNA transport in oligodendrocytes (17).
Cytoplasmic trafficking of RNA encoding -actin is also dependent on
inclusion in transport granules that are attached to the
cytoskeleton. In fibroblasts -actin mRNA transport is
microfilament-dependent (9, 22), whereas microtubules are
implicated in transport of this mRNA in neurons (23, 24).
trans-Acting factors have been isolated in pull-down
experiments with RTS-labeled magnetic particles. The predominant
RTS-binding protein from a number of rat tissues is heterogeneous
nuclear ribonucleoprotein (hnRNP) A2 (25), a constituent of nuclear "core particles" that bind to nascent hnRNA and participate in various aspects of RNA processing. Recent mutational analyses have
shown a close correlation between oligoribonucleotide binding to hnRNP
A2 and the ability to support cytoplasmic RNA trafficking in
oligodendrocytes (26). Antisense oligonucleotide experiments have added
support to the proposition that hnRNP A2 is involved in this
RTS-dependent trafficking, and the RTS has consequently been renamed the hnRNP A2 response element (A2RE). hnRNP A2 also enhances cap-dependent translation of mRNA containing
the A2RE (27).
Other, less abundant, rat brain proteins that are also reproducibly
isolated on immobilized A2RE have not previously been identified.
Direct Edman sequencing of proteins extracted from SDS/polyacrylamide
gel slices was unsuccessful, suggesting that all are N-terminally
blocked. By using Edman microsequencing and mass spectrometric
fingerprinting of tryptic peptides, Western blotting with antibodies
raised against peptides unique to individual members of the hnRNP A/B
family, and cloning and sequencing of rat and human cDNAs, we have
now identified four of the A2RE-binding proteins as isoforms of hnRNP
A3 and a fifth component as hnRNP A1. hnRNP A3 has been expressed in
Escherichia coli, purified, and shown in biosensor and UV
cross-linking electrophoretic mobility shift experiments to recognize
A2RE directly, suggesting that hnRNPA3 is not bound to RNA through
interaction with hnRNP A2. We have also found that hnRNPs A2 and A3 and
microinjected A2RE-containing RNA are localized in cytoplasmic
transport granules in cultured neurons, suggesting that hnRNP A3, like
hnRNP A2, participates in the trafficking of A2RE-containing RNA. These
are the first reported experiments on hnRNP A3, which has recently been
identified as a component of 40 S hnRNP complexes (28) but has
otherwise been described only at the cDNA level.
 |
EXPERIMENTAL PROCEDURES |
Primers--
Primers designed against the 5' and 3' ends of
frame shift-corrected human fetal brain ribonucleoprotein (FBRNP; NCBI
GI:1710627) DNA coding sequence (nucleotides 31-1140) were purchased
from Invitrogen (Mt. Waverly, Australia). NcoI (forward
primer) and SacI (reverse primer) restriction sites were
added to the 5' ends of the primers to facilitate insertion of the
PCR product into an expression vector. The primers were forward
(hA3F) 5'-GTACCATGGAGGTAAAACCGCCG-3' and reverse (hA3R)
5'-AGAGAGCTCAGAACCTTCTGCTACCATATCCAC-3' (coding sequences are underlined, and restriction sites are in italics).
RNA Extraction and RT-PCR--
21-day-old Wistar rat brain was
snap frozen. Human cerebellar tissue was from a 65-year-old female who
died of heart failure. Total RNA was isolated from 100 mg of tissue
using TRIzol reagent (Invitrogen). The dried RNA-containing pellet was
resuspended in 20 µl of diethyl pyrocarbonate-treated water.
RNA purity and concentration were determined spectrophotometrically and
by electrophoresis on 2% agarose gels. RNA-dependent DNA
synthesis was performed using avian myeloblastosis virus reverse
transcriptase (AMV-RT; Promega, Annandale, Australia, for rat RNA) or
SuperScript II (Invitrogen, for human RNA). 2 µg of RNA was used in
each RT reaction and primed with oligo(dT)15. Subsequent
PCR reactions were performed using the proofreading enzymes platinum
Taq high fidelity DNA polymerase (Invitrogen, for rat) and
ELongase (Invitrogen, for human) with 40 pmol of each primer in each
50-µl reaction.
3'-RACE was performed using an internal gene-specific primer for
reverse transcription. Terminal transferase (Invitrogen) was used for
homopolymeric 3' C-tailing of the first DNA strand. Nested PCR was
performed with RACE anchor and adapter primers (5' AP and AUAP;
Invitrogen). A modified oligo(dT) (3' AP; Invitrogen) and internal
primers were used for the RT step in 3'-RACE.
DNA Sequencing--
Purified RT-PCR products were ligated into
pGemT-Easy (Promega) and electroporated into E. coli DH5
cells. Cells bearing plasmids containing an appropriately sized insert
were grown overnight, the plasmids were isolated, and the inserts were
amplified using M13 universal primers and hA3F and hA3R for sequencing
in both forward and reverse directions with partial overlap. DNA from three individual clones was sequenced. The sequences were analyzed using CLUSTAL W version 1.8 (29) to generate consensus sequence and
protein alignment, and the programs at ExPASy (/au.expasy.org/) were used for conceptual translation of the DNA sequences (30).
Antibodies--
Antibodies were raised against peptides unique
to each of the human hnRNPs A1, A2/B1, B1, and A3:
SKSESPKEPEQLC-NH2 (A1), GGNFGFGDSR GGC-NH2
(A2/B1), VKPPPGRPQPDSGRRC-NH2 (A3(N)),
GYDGYNEGGNFC-NH2 (A3(C)), and
KTLETVPLERKKRC-NH2 (B1). These peptides were synthesized with C-terminal amide groups (Mimetopes, Melbourne, Australia) and
conjugated to diptheria toxoid before injection into rabbits. The
purified antibodies were isolated from antisera by adsorption onto the
corresponding immobilized antigen.
Protein Sequencing and Mass Fingerprinting--
Attempts at
direct Edman sequencing of the A2RE-binding proteins were unsuccessful,
suggesting that they were N-terminally blocked. Peptides were therefore
generated by excision of bands from SDS/polyacrylamide gels and in-gel
digestion with 1.5 times the gel volume of 0.02 mg/ml trypsin (Promega)
in 40 mM ammonium bicarbonate, 10% (v/v) acetonitrile, pH
8.1 (31). The resultant peptides were purified by reverse-phase HPLC on
a microbore C18 column and running a gradient of 10-40%
acetonitrile over 60 min in 1% trifluoroacetic acid at 30 µl/min and
sequenced on a Procise cLC sequencer (Applied Biosystems, Foster
City, CA). Mass spectral analysis was performed on an ABI QSTAR Pulsar
i spectrometer (Applied Biosystems) with an electrospray ion
source interfaced to a microbore HPLC. The peptides were separated on a
C3 reverse-phase column, the output of which was split between the HPLC
detector and the mass spectrometer. The proteins were identified by
comparison of the observed tryptic peptide masses with those predicted
from the gene sequences. For each of the hnRNP A3 isoforms, fragments with masses within ± 0.2 Da of the theoretical value covering at
least 33% of the primary sequence were found.
Cloning, Expression, and Isolation of hnRNP A3--
Full-length
rat hnRNP A3 transcript was amplified and ligated into pGemT. The
sequence was verified by sequencing before ligation in-frame into
pET30a+ (Novagen, Madison, WI), which had been mutated to generate a
second thrombin cleavage site in place of an enterokinase site between
the hexahistidine tag and hnRNP A3. This vector was used to transform
E. coli BL21(DE3) cells that were grown to an A600 of 0.6 before induction with
isopropyl-1-thio- -D-galactopyranoside. The cell lysates
were centrifuged, and the supernatant was passed through a metal ion
affinity column (Talon IMAC resin, CLONTECH, Palo
Alto, CA) equilibrated with 50 mM
NaH2PO4, 700 mM NaCl, 5 mM imidazole, 1 mM phenylmethylsulfonyl
fluoride, pH 7, or 20 mM Tris, 100 mM NaCl, and
6 M guanidinium hydrochloride, pH 7. The hexahistidine
fusion protein was released from the resin by increasing the column
buffer imidazole concentration to 200 mM and purified by
reverse-phase HPLC. Two proteins with the tag removed and an additional
Ser-Gly at the N terminus were generated by cleavage with thrombin;
they were identified by electrospray/time-of-flight mass spectrometry
performed on an Applied Biosystems QSTAR Pulsar i.
Biosensor Measurements--
An IAsys resonant mirror biosensor
(Affinity Sensors, Cambridge, UK) was used to determine the equilibrium
affinities for the interactions of hnRNP A3 with A2RE, with NS1
(CAAGCACCGAACCCGCAACUG) being used as a control to distinguish specific
binding from nonspecific binding. Recombinant hnRNP A3 was covalently
attached to the carboxymethyldextran-coated sensing surface of a
biosensor cuvette using a standard procedure (32). After washing the
biosensor cuvette with phosphate-buffered saline (PBS) containing 0.1%
Tween 20, hnRNP A3 was added to the cuvette, and the equilibrium
response was recorded (~20 min). Unbound protein was removed by
washing with PBS containing 0.05% Tween 20. Binding of
oligonucleotides was monitored at 0.4-s intervals at 25 °C until
equilibrium had been attained (~15 min). The cuvette was washed with
5 mM NaOH to remove the oligonucleotide and with PBS
containing 0.05% Tween 20 to restore the base line between experiments.
UV Cross-linking Electrophoretic Mobility Shift
Assays--
Recombinant proteins were obtained as described above.
Oligoribonucleotide 32P end-labeled with T4 polynucleotide
kinase (New England Biolabs, Beverly, MA) and protein were mixed in
binding buffer (10 mM Tris-HCl, pH 7.5, containing 1 mM EDTA, 4% (w/v) glycerol, 0.1% (w/v) Triton X-100, and
1 mM dithiothreitol) and incubated for 20-30 min on ice.
The reaction mixtures were then irradiated with 250 mJ of 254-nm
light in a Bio-Rad GS Genelinker UV chamber. The samples were run on
15 × 15-cm SDS/12% or 15% polyacrylamide gels.
Affinity Isolation on Magnetic Particles--
A2RE-binding rat
brain proteins were isolated using affinity isolation on
superparamagnetic particles bearing immobilized A2RE or NS1, as
described previously (25). Proteins bound to the particles were eluted
by heating for 10 min at 65 °C in 0.1% SDS, 1 mM
dithiothreitol, or 30% (v/v) acetonitrile in 0.1% trifluoroacetic acid and analyzed on SDS/polyacrylamide gels or used for mass spectrometry.
Cell Culture--
Hippocampus dissected from embryonic day 18 Wistar rats was digested with trypsin in Hanks' balanced salt
solution, washed twice in Hanks' balanced salt solution, placed in
Dulbecco's modified Eagle's medium supplemented with 10% (v/v) fetal
calf serum, and mechanically dissociated by trituration. The cells were
plated at 600 cells/mm2 on
poly(L-lysine)-coated glass-bottomed microwells (MatTek,
Ashland, MA). After 2 h of incubation to allow cell attachment,
medium containing Neurobasal, N2 supplements (1:100 dilution), B27
supplements (1:50 dilution), and 5% (v/v) gentamicin was added, and
the cells were incubated at 37 °C in 95% air, 5% CO2.
The medium was replaced every other day. All reagents were from
Invitrogen except where noted otherwise.
Confocal Laser Scanning Microscopy--
Cultured rat brain
neurons were washed in PBS then fixed for 20 min in 3.7%
paraformaldehyde (Sigma) in PBS. After further washing with PBS, the
cells were permeabilized by incubation for 2 min in 0.1% Nonidet P-40
(Sigma) diluted in the same buffer, washed, and then incubated in 5%
goat serum in PBS for 10 min. For visualization of hnRNPs A2 and A3,
the cells were incubated for 30 min at room temperature in the primary
antibody (rabbit antibody against hnRNP A3 and mouse antibody to hnRNP
A2), washed extensively, blocked with 5% goat serum in PBS for 10 min,
incubated in secondary antibody (fluorescein isothiocyanate-conjugated
goat antimouse IgG and Alexa-598-conjugated goat anti-rabbit; Jackson ImmunoResearch Laboratories, West Grove, PA) for 30 min, and washed with PBS. Finally, 70% glycerol containing an anti-fading agent (Dabco) was added to the cells before they were imaged on either Zeiss
LSM 410 or Bio-Rad MRC 800 laser scanning confocal microscopes equipped
with ×63 (1.4 NA) and ×60 (1.4 NA) lenses.
RNA Microinjection and Visualization--
After 7-14 days in
culture, differentiated hippocampal neurons were microinjected with RNA
labeled with Alexa-488-UTP (Molecular Probes, Eugene, OR) and
containing or lacking the A2RE11 (GCCAAGGAGCC) sequence inserted in the
3'-untranslated region between the green fluorescent protein open
reading frame and the segment encoding the poly(A) (26). The cells were
injected using a Compic Inject (Cellbiology Trading, Hamburg,
Germany) micromanipulator attached to a Zeiss Axiophot inverted
microscope. After injection, the cells were incubated at 37 °C for
30 min to allow transport to occur. To visualize neurites, the cells
were incubated for 30 min in mouse anti-MAP2 (Sigma), washed, and
incubated for 30 min in Texas Red-conjugated goat anti-mouse IgG (Sigma).
 |
RESULTS |
Western Blotting of A2RE-binding Proteins--
Previous
experiments (25, 26) showed that immobilized A2RE binds at least six
polypeptides from rat brain in an RNA sequence-selective manner (Fig.
1A). The most abundant of
these proteins was shown by Edman sequencing of tryptic peptides to be
hnRNP A2, but the other polypeptides were less abundant and appeared to
be N-terminally blocked. Edman protein sequencing of peptides generated
from the 38- and 39-kDa bands had indicated that they were closely
related to hnRNP A2 but were not alternatively spliced forms of this
36-kDa protein. The peptide sequences matched those deduced from the cDNA sequences of human hnRNP A3 (identified as FBRNP, as corrected in the Swiss Protein Database, accession number P51991) but were
insufficient in number and length to unequivocally identify the
protein.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 1.
A2RE-binding proteins. Rat brain
proteins were added, in the presence of heparin, to A2RE immobilized on
magnetic particles. A, the bound proteins were eluted with
1% SDS, separated on an SDS/polyacrylamide gel, and stained with
Coomassie Blue. The 36-kDa hnRNP A2 (arrow) was identified
earlier (25), and hnRNP A1 is barely visible below this band. The other
four bands, which are the focus of this study, are indicated by
arrowheads with their apparent molecular masses.
B, Western blots of the A2RE-binding proteins. The proteins
separated on an SDS/12% polyacrylamide gel were electrophoretically
transferred onto nitrocellulose, and the strips were incubated in
rabbit primary antibodies raised against peptides of hnRNPs A1, A2/B1,
B1, and A3 (N-terminal peptide). The proteins were visualized using an
anti-rabbit IgG alkaline phosphatase-conjugated secondary antibody. The
positions of molecular mass standards are marked on the
left. The two hnRNP A3 bands recognized by the hnRNP A3
antibody, the 41- and 41.5-kDa proteins in A, are not
resolved on this short gel.
|
|
We have now used immunoblotting to identify the other rat brain
A2RE-binding proteins that were eluted from magnetic particles, separated on SDS/polyacrylamide gels, and transferred to nitrocellulose for immunodetection with polyclonal antibodies raised against peptide
antigens. The peptide antigens were selected using published amino acid
sequences for the human hnRNP A1, A2, and B1 proteins, and for A3 a
peptide was deduced from our DNA sequence (see below). The proteins
detected (Fig. 1B) were hnRNPs A1, A1B (above A1
on the A1 track, ~40 kDa), A2, B1 (just above A2 on the A2 track, and
separately on the B1 track; the topmost band in the A2 track is
unidentified), and A3. As shown below, the antibody to hnRNP A3 detects
two proteins, but they are not resolved on the short gel used in this
experiment. The predominant A2RE-binding proteins are thus the
previously identified hnRNP A2 and hnRNP A3. As judged by the staining
on polyacrylamide gels, hnRNPs A1, A1B, and B1 are minor components.
DNA Sequencing--
As a basis for further studies we determined
the cDNA sequences of rat and human brain hnRNP A3, initially using
for both RT-PCR with primers based on the 5' and 3' coding sequences of FBRNP to amplify hnRNP A3-like mRNA. The high degree of amino acid
sequence conservation between humans and rodents observed for other
hnRNPs suggested that these primers would be satisfactory for the
latter, a proposition subsequently verified by direct sequencing of the
rat DNA in these regions (see below).
Two distinct sequences were amplified from multiple clones containing
cDNA reverse-transcribed from human brain RNA. One matched and
extended the partial murine clone (EMBL accession number Y16641), a
truncated expressed sequence tag described as encoding a novel gene
product, mBx-3 (28) (Fig. 2). The second
differed from that deduced for the human FBRNP (33) only by a
substitution of the dipeptide Met93-Arg94 in
our sequence for Ile-Gly at the C-terminal end of the second RNA
recognition motif of FBRNP. These two cDNAs had 96.5% identity at
the nucleotide level and 94.2% (357 of 379 residues) at the amino acid
level, with the nucleotide differences between these human sequences
spread throughout the DNA, suggesting that the two proteins arise from
distinct genes, but subsequent searching of the human genome data bases
suggested that the second of these cDNAs (corresponding to FBRNP)
resulted from transcription of a pseudogene.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 2.
hnRNP A3 amino acid sequences. The human
hnRNP A3 sequence deduced from the cDNA sequence determined in the
present work and those of human hnRNPs A1 and A2. The rat hnRNP A3
differs from the human protein only by insertion in the latter of one
additional Gly residue in the Gly-rich region (arrowhead
above the hnRNP A3 sequence). Residues in hnRNPs A1 and A2 are
identified only where they differ from the hnRNP A3 sequence. The
residues conserved between hnRNPs A1 and A3 but not A2 and A3 are
boxed, and those conserved between hnRNPs A2 and A3 but not
A1 and A3 are shaded. Gaps in the sequences are indicated
with dashes. The minimal M9 nuclear import/export sequence
of A1 (50) and the equivalent segments of hnRNPs A2 and A3 are
underlined in the C-terminal Gly-rich region. Exon 1 residues deleted in the shorter isoform of hnRNP A3 are in
bold, and the sequence within this segment used to generate
the N-terminal hnRNP A3 antibody is underlined. The
arrow marks the point at which recombinant hnRNP A3 is
cleaved by thrombin.
|
|
The first human cDNA sequence differed from the single rat sequence
obtained from multiple clones in 55 nucleotide substitutions spread
throughout the sequence and by the presence of a TGG insert in the
latter, but these differences result only in insertion of a single
additional glycine residue near the C terminus of the rat protein,
suggesting that these proteins are orthologous. No murine cDNA
corresponding to FBRNP was detected by multiple approaches including
3'- and 5'-RACE and direct RT-PCR using total rat brain RNA with an
oligo(dT) primer, again suggesting that it represents a pseudogene.
However, 5'-RACE did result in the identification of a truncated form
of rat DNA, which had a similar but longer 5'-untranslated region and a
66-nucleotide deletion near the 5' end of the coding region (Fig. 2).
This corresponds to a mass change of 2566 Da in the protein. The
3'- and 5'-RACE experiments also confirmed that the human and rat
sequences are identical in the regions corresponding to the primers
used in the initial amplification of the rat DNA. The sequence of the full and truncated cDNAs are closely related to those reported for
A3-like proteins from Xenopus, A3a and A3b (34).
Protein Features Deduced from DNA Sequence--
hnRNP A1 possesses
a transportin-binding nuclear localization signal (M9) that is thought
to be important for shuttling between the nucleus and cytoplasm
(35-37). The minimal 15-residue sequence is underlined in
Fig. 2 (38). A similar sequence is present in hnRNP A3; this suggests
that hnRNP A3, like hnRNPs A1 and A2 (39), may shuttle in and out of
the nucleus.
Comparison of the amino acid sequences of the human hnRNPs A1, A2, and
A3 reveals a close relationship between them. Overall, the hnRNP A3
amino acid sequence matches hnRNP A1 more closely than it matches hnRNP
A2/B1. Within the tandem RNA recognition motif region there are many,
mostly conservative, substitutions in hnRNP A2 where the other two
proteins are identical and relatively few residues where hnRNP A2 but
not hnRNP A1 matches the hnRNP A3 sequence (Fig. 2). In the C-terminal
glycine-rich region, this trend is reversed, suggesting that the hnRNP
A3 gene may have arisen from the recombination of the 5' RNA
recognition motif-encoding segment of a former hnRNP A1 gene with the
3' Gly-rich segment of an earlier hnRNP A2 gene.
Protein Identification--
Antibodies were raised against two
peptide sequences deduced from the FBRNP and hnRNP A3 gene sequences.
The first peptide (VKPPPGRPQPDSGRR), which was used in initial
experiments (Fig. 1B), is in the N-terminal alternatively
spliced region. The second (GYDGYNEGGNF) is in a segment of the
glycine-rich region predicted to be common to all splice variants of A3
but not fully conserved in hnRNPs A1 and A2/B1. In Western blots the
first antibody recognized just the 41- and 41.5-kDa bands, suggesting
that only these proteins contain the 22-residue segment encoded within
exon 1 (Fig. 3). By contrast, the second
antibody associated with all four 38-, 39-, 41-, and 41.5-kDa bands,
identifying them as hnRNP A3-like proteins and not isoforms of hnRNPs
A1 or A2.

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 3.
Antibodies to hnRNP A3 recognize the
A2RE-binding proteins. A2RE-binding rat brain proteins from a
magnetic particle pull-down experiment were separated on an
SDS/polyacrylamide gel and electroblotted onto polyvinylidene
difluoride membrane. Strips of the electroblot were incubated with
antibodies to hnRNP A2 (A2), to the N-terminal alternatively
spliced segment (A3(N)), and to the peptide from the
Gly-rich region (A3(C)). The proteins were visualized using
an anti-rabbit IgG alkaline phosphatase-conjugated secondary antibody
and development with nitroblue tetrazolium
chloride/5-bromo-4-chloro-3'-indolyl phosphate, p-toluidine salt
one-step solution (Pierce). The positions of marker proteins are shown
at left, and the hnRNP A3 bands are indicated by
arrowheads.
|
|
This identification was confirmed by Edman sequencing and electrospray
mass spectrometry. Bands cut from stained SDS/polyacrylamide gels were
pulverized and digested with trypsin, and the reverse-phase HPLC-purified peptides were subjected to Edman degradation. The resultant amino acid sequences, presented in Table
I, confirmed the identification of three
of these proteins as hnRNP A3. Each of the tryptic digests of the
excised bands was also subjected to liquid chromatography-mass
spectrometry (LC-MS), and the resultant peptide masses were compared
with those predicted from the putative protein sequences. For each
band, fragments spanning 33% or more of the translated cDNA
sequence matched the predicted masses of tryptic fragments of hnRNP A3
(Table II). Where the putative protein sequences differed, the observed masses corresponded to the expected sequence and excluded the alternative FBRNP protein, with the exception
of one peptide, which gave a weak signal at a mass corresponding to a
peptide predicted for this protein. The two protein sequences differ
substantially in the predicted tryptic fragments, and the absence of
FBRNP peptides in the mass spectral fingerprinting therefore indicates
that this protein is not expressed at levels comparable with hnRNP A3.
Thus, all four bands appear to be alternatively spliced forms of hnRNP
A3, with two of the forms lacking the majority of exon 1. Alternatively
spliced forms of both hnRNPs A1 and A2 are expressed, with the
inclusion or exclusion of exon 7bis, resulting in hnRNPs A1 and
A1B (40) and the alternative splicing of exons 2 and 9 giving rise to A2, B1, B0a, and B0b (41, 42). By analogy we anticipated that the four forms of A3 would arise from inclusion or exclusion of
two alternatively spliced exons.
View this table:
[in this window]
[in a new window]
|
Table I
Protein sequences from Edman microsequencing
Tryptic peptides from the A2RE-binding proteins were isolated by
microbore reverse-phase HPLC and subjected to Edman degradation.
|
|
View this table:
[in this window]
[in a new window]
|
Table II
The 38-, 39-, 41-, and 41.5-kDa A2RE-binding proteins are all isoforms
of hnRNP A3
Tryptic peptides from each of the SDS/polyacrylamide gel bands were
separated by HPLC, and the masses measured by ion spray mass
spectrometry. The matching peptides from the 38- and 39-kDa bands cover
38% of truncated hnRNP A3 sequence, and those from the 41- and
41.5-kDa bands cover 33% of hnRNP A3. The predicted masses are
monoisotopic and are calculated as [M].
|
|
To test this hypothesis, A2RE-binding proteins were isolated using
magnetic particle pull-down experiments and subjected to LC-MS.
Previous reverse-phase HPLC
experiments2 had shown that
the hnRNP A3 isoforms co-elute ahead of hnRNP A2. The LC-MS
chromatogram gave a similar profile, but only two proteins were
detected in the hnRNP A3 peak, with average masses of 39,863 ± 4 and 37,297 ± 4 Da (Fig. 4); these
values are both 211 Da greater than the masses calculated from the
protein primary structures predicted from the DNA sequences, indicating
that the proteins have undergone post-translational modification. The
difference in mass between these two isoforms, 2566 Da, corresponds to
the mass of the segment encoded by the N-terminal insertion (2567 Da),
reinforcing the evidence for expression of these two forms and
identifying them as the nominally 38- and 41-kDa isoforms (Fig. 1 and
below). The 39- and 41.5-kDa isoforms were not observed in the mass
spectra, and the relationship between them and the other two isoforms
is not known. Although not detected in the mass fingerprinting
experiments, hnRNPs B1 and A1B, which migrate close to the
hnRNP A3 bands on SDS/polyacrylamide gel electrophoresis, did bind the
A2RE (Fig. 1B), as did the faster migrating hnRNP A1.

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 4.
Mass spectrometry identifies two hnRNP A3
isoforms. Rat brain A2RE-binding proteins were isolated using A2RE
immobilized on magnetic particles. The proteins were eluted from the
particles in 30% acetonitrile in 0.1% trifluoroacetic acid,
concentrated by vacuum centrifugation, centrifuged to remove any
particulate material, and analyzed by C18 reverse-phase liquid
chromatography-orthogonal quadrupole/time-of-flight mass spectrometry.
In the total ion current chromatogram the peaks labeled A,
B, and C yielded mass spectra of hnRNP A2
(36,076), the hnRNP A3 isoform missing part of exon 1 (37,297), and the
hnRNP A3 isoform possessing the full exon 1 (39,863), respectively. The
other peaks in the chromatogram are derived from smaller proteins that
are bound nonspecifically to the magnetic particles. Expansion of the
mass spectra for peaks A-C revealed small amounts of sodium
adduct but no other components.
|
|
hnRNP A3 Interacts with the A2RE Independently of hnRNP
A2--
Pull-down experiments with A2RE immobilized on magnetic
particles have consistently yielded hnRNP A2 and the less abundant hnRNP A3s. Given previous demonstrations that purified A2 binds the
A2RE, it was possible that hnRNP A3 was isolated because it interacted
with hnRNP A2 rather than through a direct interaction with the
oligoribonucleotide, as suggested earlier (25). We therefore used the
expressed hnRNP A3 in UV cross-linking electrophoretic mobility shift
assays and biosensor experiments. Full-length rat hnRNP A3 (Fig. 2) was
expressed in E. coli as a hexahistidine-tagged protein and
purified (Fig. 5A). Thrombin
cleavage yielded hnRNP A3 with two additional N-terminal residues,
Gly-Ser, arising from the thrombin cleavage site (calculated mass,
39,796 Da; measured average mass, 39,793 ± 4 Da). Cleavage of the
fusion protein tag was accompanied by cleavage at a second site, marked
with an arrow above the amino acid sequence in Fig. 2, that removed 24 residues from the C-terminal end of the molecule (calculated mass,
37,600 Da; measured average mass, 37,597 ± 4 Da). The full-length
cleaved recombinant hnRNP A3 co-migrated with the 41-kDa band when run alongside the A2RE-binding rat brain proteins on an SDS/polyacrylamide gel (Fig. 5B), suggesting that this rat protein corresponds
in sequence to the expressed protein. This conclusion is consistent with the Western blots (Fig. 3) showing that the 41- and 41.5-kDa proteins contain the N-terminal insertion shown in Fig. 2.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5.
Purification of bacterially expressed hnRNP
A3. A, Coomassie Blue-stained SDS/polyacrylamide gel
showing the purification of the bacterially expressed hnRNP A3
(rA3). The tracks show uninduced bacterial lysate
(Control), the lysate from cells induced with
isopropyl-1-thio- -D-galactopyranoside (rA3),
rA3 purified on a chelated metal column (IMAC), rA3 after
further purification by reverse-phase HPLC (HPLC), and rA3
after complete thrombin cleavage of the hexahistidine tag
(cleaved). Thrombin cleaved at three sites: those
anticipated within the tag and between the hexahistidine tag and the
hnRNP A3 coding region and an unexpected site 24 residues from the
C-terminal end, yielding a product with a molecular mass of 37,597 Da
(shown). The positions of the cleavage sites were deduced from
electrospray/time-of-flight mass measurements. The positions of marker
proteins are shown at left. B, in Western blots
the full-length recombinant protein migrated close to the rat 41-kDa
A2RE-binding protein. The tracks show proteins bound to nonspecific
oligonucleotide (NS) and detected with the Gly-rich region
hnRNP A3 peptide antibody (A3(C)), rat brain A2RE-binding
proteins (A2RE) detected with A3(C) and N-terminal peptide
(A3(N)) antibodies, respectively, and partly digested
recombinant hnRNP A3 detected with A3(N), showing the full-length
protein (arrow) migrating with the rat brain 41-kDa isoform,
behind the C-terminally truncated hnRNP A3
(arrowhead).
|
|
Biosensor measurements in which A2RE or nonspecific oligoribonucleotide
(NS1) was added to purified, expressed His-tagged hnRNP A3 immobilized
on the cuvette showed that the oligonucleotide binding to this protein
closely parallels the binding to hnRNP A2 (43). A saturating
concentration of NS1 (30 µM) or A2RE (4 µM)
was added to the biosensor, resulting in a response with A2RE double
that with NS1. After attainment of equilibrium (Fig.
6A, arrow),
sufficient A2RE was added to each biosensor to double its
concentration. This addition led to little change in the response upon
addition to A2RE but to a doubling of the biosensor response upon
addition of A2RE to the cuvette previously containing only NS1 (Fig.
6A, top panel). By contrast, doubling of the
concentration of NS1 in the cuvette previously equilibrated with this
oligoribonucleotide did not further increase the biosensor response
(Fig. 6A, bottom panel). The parallel between the
oligoribonucleotide binding to hnRNPs A3 and A2 indicated that the
former also possesses one site that binds RNA sequence specifically and
a second site that manifests no strong sequence specificity. Additional
support for this proposition was obtained from studies of the effect of
10 g/liter heparin. This polyanion halved the binding of A2RE to hnRNP
A3 (Fig. 6B, top panel) and eliminated NS1
binding (Fig. 6B, bottom panel). The affinity of
recombinant hnRNP A3 for both NS1 and A2RE, as reflected in the
dissociation constants derived from the binding curves (Fig.
6C), is lower than for human recombinant hnRNP A2. The
Kd for the specific site is 276 ± 35 nM compared with 44 ± 7 nM for hnRNP A2,
and the corresponding values for the nonspecific site are 3.0 ± 0.6 µM (A2RE) and 4.8 ± 0.6 µM (NS1)
for hnRNP A3 compared with 267 ± 41 nM (A2RE) and
246 ± 29 nM (dNS1) for hnRNP A2. UV cross-linking
electrophoretic mobility shift experiments showed binding of
radiolabeled A2RE to hnRNPs A2 and A3 and lower binding of NS1, in
accord with the biosensor experiments (Fig.
7A). Competition assays
confirmed the specificity of the RNA-protein interaction (Fig.
7B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 6.
hnRNP A3 binds A2RE. Biosensor assays
show sequence-specific and nonspecific binding of oligoribonucleotides
to immobilized hnRNP A3. A, saturating concentrations of
A2RE or NS1 were added to the cuvette at time 0. After attainment of
binding equilibrium, A2RE sufficient to increase its concentration by 4 µM was added to each cuvette (arrow). Only the
hnRNP A2 previously equilibrated with NS1 showed increased binding upon
addition of the second aliquot of oligonucleotide (top
panel), suggesting that the protein possesses a site that binds
A2RE but not equivalent oligonucleotides with scrambled sequences. In a
parallel experiment, 30 µM NS1, rather than A2RE, was
added after the attainment of equilibrium (bottom panel).
The addition of further NS1, in contrast to A2RE, results in only a
minor increase in binding. B, comparison of the biosensor
response for the binding of a saturating concentration of A2RE (4 µM) to immobilized hnRNP A3 (top panel) with
that for an oligoribonucleotide with the same composition but scrambled
sequence (NS1; 30 µM; bottom panel). The
response with A2RE is twice that with NS1. Heparin (1.0 g/liter) halves
the A2RE response (top panel) and eliminates the response
for NS1 (bottom panel). C, concentration
dependence of A2RE and NS1 binding to hnRNP A3. The
Kd values were derived from these curves.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7.
Electrophoretic mobility shift assays.
A, UV cross-linking electrophoretic mobility shift
experiments showing binding of recombinant hnRNPs A2 and
histidine-tagged hnRNP A3 to radiolabeled A2RE11 and an oligonucleotide
comprising the 11 5' nucleotides of NS1. The positions of marker
proteins, with molecular masses in kDa, are shown on the
left. B, a 50-fold excess of unlabeled A2RE11 but
not of NS1 11-mer competed for the A2RE binding site on detagged
recombinant hnRNP A3. A 50-fold excess of either A2RE11 or NS1 11-mer
eliminated binding of NS1 to hnRNP A3.
|
|
Earlier experiments had shown a correlation between hnRNP A2 binding to
A2RE and corresponding oligonucleotides with point mutations and the
ability of these sequences to support transport of RNAs (26). Together
with antisense oligonucleotide data, these observations suggested a
role for hnRNP A2 in cytoplasmic mRNA trafficking. Because the
binding to A2RE of hnRNP A3 correlated closely with that of A2 in these
earlier experiments, it appears that the former proteins may also play
some part in RNA trafficking, but confirmation of this proposal
requires a more direct experimental demonstration.
hnRNP A3 Distribution in Rat Tissues Mirrors hnRNP A2--
The
distribution of hnRNP A3 has not previously been investigated. Equal
amounts of protein extracted from rat tissues were separated on
multiple lanes of an SDS/polyacrylamide gel and electroblotted onto
nitrocellulose for detection with anti-peptide antibodies to hnRNPs A2
and the N-terminal peptide of A3. hnRNP A3 was found in several
tissues, most prominently in brain, lung, and testis, and its levels in
these tissues paralleled those of hnRNP A2 (Fig. 8). Little or no hnRNP A2 or A3 was
detected in muscle, kidney, heart, or liver. Lower molecular mass forms
of both proteins were reproducibly observed in extracts of spleen.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 8.
hnRNP A3 expression parallels hnRNP A2
expression in several rat tissues. Proteins were extracted from
21-day-old Wistar rat tissues, separated on SDS/polyacrylamide gels,
and electroblotted onto nitrocellulose. The blots were developed using
antibodies against whole hnRNP A2 (left panel) and the
N-terminal hnRNP A3 peptide (which recognizes the 41- and 41.5-kDa
isoforms) (right panel). The bands were visualized using
rabbit IgG alkaline phosphatase-conjugated secondary antibody. The
distribution of both proteins in these tissues is highly correlated.
The positions of molecular mass markers, with masses in kDa, are
indicated on the left.
|
|
hnRNP A3 Is Co-localized with A2RE-containing RNA in the Cytoplasm
of Neurons--
If hnRNP A3 is involved in cytoplasmic RNA
trafficking, it might be expected to be localized in cytoplasmic
granules and to be co-localized with A2RE-containing RNA.
Immunofluorescence microscopy showed hnRNP A3 to be present in the
nucleus (not shown) and in cytoplasmic granules in the neurites of
cultured hippocampal neurons (Fig.
9A), with hnRNPs A2 and A3
being localized to different populations of granules (Fig. 9).
Microinjected fluorescently labeled A2RE-containing RNA was also
co-localized with hnRNP A3 in a subset of cytoplasmic granules (Fig.
10). These results, together with
earlier data (26) showing that mutations in the A2RE that lower binding
to hnRNP A2 and A3 interfere with RNA
trafficking,3 suggest that
hnRNPs A2 and A3 both play a role in RNA trafficking in neurites.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 9.
hnRNP A3 is present in cytoplasmic
granules. A, confocal laser scanning microscopy image
of the neurites of a cultured hippocampal neuron using a mouse antibody
to hnRNP A2 and a rabbit antibody to an N-terminal peptide unique to
hnRNP A3. Both hnRNP A2 (green, arrows) and hnRNP
A3 (red, arrowheads) were detected in granules,
which had the appearance and distribution of transport granules, in the
neurites. Scale bar, 5 µm. B,
statistical analysis of the fluorescence of individual granules showed
that the majority of granules in the neurites contained either hnRNP A2
or hnRNP A3. A small number of granules were yellow,
indicating the presence of both proteins.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 10.
Microinjected A2RE RNA and hnRNP A3 are
co-localized in neuronal neurites. A, hippocampal
neurons were microinjected with fluorescently labeled A2RE RNA. The
subcellular distributions of the injected RNA (left panels)
and hnRNP A3 (right panels) were visualized and analyzed by
dual channel confocal microscopy, using rabbit primary antibody and
Alexa 598-labeled secondary antibody to locate hnRNP A3 after fixing
the cells. In each image, the arrows indicate granules that
contain both A2RE RNA and hnRNP A3, and the arrowheads
indicate granules with only hnRNP A3 labeling. Granules positive for
hnRNP A3 but negative for injected RNA may transport endogenous
A2RE-containing RNA. Scale bars, 5 µm. B,
analysis of hnRNP A3 and A2RE-containing RNA distributions in
individual granules, showing a linear correlation between the levels of
the two proteins and a population of granules that contain hnRNP A3 but
low levels of exogenous RNA. RNA lacking the A2RE is not transported
into the processes of oligodendrocytes (26) or
neurons.3
|
|
 |
DISCUSSION |
The four most abundant of the A2RE-binding rat brain proteins
migrating behind hnRNP A2 on SDS/polyacrylamide gels have been identified by mass fingerprinting and Edman sequencing of tryptic peptides as hnRNP A3 isoforms (Tables I and II). These peptides had
sequences consistent with our hnRNP A3 cDNA sequences and excluded
the possibility that any of the four proteins were splice variants of
hnRNPs A1 or A2. This conclusion was also consistent with the results
of Western blotting using two antibodies raised against peptides from
hnRNP A3 (Fig. 3).
In the course of identifying these proteins, we completed the sequences
of human and rat hnRNP A3 cDNAs. The hnRNP A3 amino acid sequence
is highly conserved between humans and rats, as are those of hnRNPs A1
and A2. Initially two human cDNAs were amplified; both appeared to
encode full-length hnRNP A/B-like proteins, one corresponding in
protein sequence with the previously described FBRNP expressed sequence
tag, and the other corresponding with the reported hnRNP A3 partial
sequence (28). However, the FBRNP sequence appears to arise from a
processed pseudogene; although it is transcribed and has appropriately
located start and stop codons and polyadenylation signal, it
corresponds to a gene on human chromosome 10 that possesses a single
exon, in contrast to the 10-12 exons of other human and mouse hnRNP
A/B genes (41, 44). Although an intronless paralog has been discovered
for hnRNP E (45), the potential protein product of FBRNP
DNA, which has a predicted mass close to one of the hnRNP A3 isoforms,
was not detected in mass spectrometric fingerprinting of peptides derived from any of the four hnRNP A3 bands, indicating either that it
is not translated in amounts comparable with the other hnRNP A3
isoforms or that the resultant protein does not bind the A2RE. A search
of the DNA data bases revealed several other hnRNP A3 pseudogenes on
different human chromosomes.
Both hnRNPs A2 and A3 are expressed as four isoforms. The hnRNP A2
isoforms arise from exclusion or inclusion of exons 2 (36 nucleotides)
and 9 (120 nucleotides), generating B0a, B0b (+ exon 2), A2 (+ exon 9),
and B1 (+ exons 2 and 9) (44, 46). The two higher molecular mass forms
isoforms (41 and 41.5 kDa) of hnRNP A3, but not the two lower molecular
mass forms (38 and 39 kDa) contain an N-terminal 22-amino acid
insertion (Fig. 2), which was discovered using 5'-RACE; only the two
higher molecular mass proteins bound antibodies raised against a
peptide within this N-terminal insertion. Within these two doublets the
apparent mass difference is 1-1.5 kDa, corresponding to 10-15 amino
acid residues, but RT-PCR did not reveal any mRNAs varying by this
size and in attempts to determine the masses of all four isoforms by
LC-MS only two proteins with masses in the appropriate range were
detected. Their masses and the co-migration on SDS/polyacrylamide gels
of the recombinant hnRNP A3 with the 41-kDa isoform (Fig. 4) suggest that the two observed masses, 37,297 and 39,863 Da, are those of the
nominally 38- and 41-kDa isoforms. Several potential reasons for the
nonappearance of the 39- and 41.5-kDa isoforms in mass spectrometry
experiments have been eliminated; every chromatographic peak from the
LC-MS runs was analyzed, but none contained proteins in the 37-45-kDa
mass range, other than the two mentioned above. All four isoforms were
present in the sample used for mass spectrometry, and all usually elute
with similar retention times on reverse-phase HPLC, as shown by
SDS/polyacrylamide gel electrophoresis.
We had previously discovered, from mutational analysis and antisense
oligonucleotide experiments, that hnRNP A2 is a trans-acting factor for A2RE-mediated, cytoplasmic RNA trafficking in
oligodendrocytes (26) and neurons.3 In these experiments it
was noted that the hnRNP A3 isoforms were also isolated from rat brain
protein extracts in pull-down experiments with immobilized A2RE and
that their binding to mutated forms of the A2RE paralleled that of
hnRNP A2. This left open the possibility that hnRNP A3 bound directly
to A2RE or indirectly through association with hnRNP A2. The biosensor
and gel mobility shift data presented here support the former
interpretation. The biosensor responses with purified recombinant hnRNP
A3 (Fig. 6) closely paralleled those recorded for hnRNP A2 (43),
indicating that hnRNP A3, like hnRNP A2, possesses two RNA-binding
sites; one of them is sequence-specific, binding to A2RE, and the other binds with little discrimination between sequences. Although the RNA
recognition motifs of hnRNP A3 are closer in sequence to hnRNP A1 than
to hnRNP A2, hnRNP A3 mimics hnRNP A2 more closely than hnRNP A1 in its
binding to A2RE, although with dissociation constants for A2RE binding
that are severalfold higher than for hnRNP A2.
Although hnRNP A3 was not described originally as a component of the
core particles identified in HeLa cell nuclei, it is present in
multiple isoforms in these cells (47). We have shown that hnRNP A3 is
abundant in several tissues, paralleling the tissue distribution of
hnRNP A2. hnRNP A3, like hnRNP A2, is mostly localized in the nuclei of
neurons and oligodendrocytes (not shown) and probably has a similar
localization in other cell types.
Association of hnRNP A3 with A2RE in vivo is
suggested by two of our observations. First, in neurons this protein is
localized to granules in neurites that are similar in size and number
to those shown previously to participate in trafficking of
A2RE-containing RNA.3 Interestingly, most granules in the
neurites were positive for either hnRNP A2 or hnRNP A3, but not both.
It has been shown that inclusion in transport granules requires a
cooperative interaction between hnRNP A2 and RNA and that there are
multiple copies of A2RE-containing RNA and probably multiple copies of
hnRNP A2 in each granule.4
Our observation that few cytoplasmic granules contain both hnRNPs A2
and A3 thus indicates that these two proteins do not interact cooperatively with each other in recruiting RNA to the transport granules. The second observation that implicates hnRNP A3 in the cytoplasmic trafficking of RNA is the co-localization of microinjected A2RE RNA with hnRNP A3 in granules that are distributed along the neurites.
The parallels in A2RE binding, tissue, and subcellular
distribution of hnRNPs A2 and A3 beg the question of whether these proteins fulfill the same or similar roles in vivo in
A2RE-dependent RNA trafficking. hnRNP A2 has been shown to
be involved in cytoplasmic trafficking (25, 26) and in the regulation
of translation (27), and hnRNP A3 could also be involved in these
aspects of RNA metabolism or in others such as nuclear export, RNA
tethering at its destination, or mRNA stability. It will be of
particular interest to explore the differences in role between the
isoforms of each protein. The observation that hnRNP B1 expression is
selectively up-regulated in oncogenically transformed cells (48, 49) is an indication that regulation of splicing of RNA encoding hnRNPs and
hence of protein isoform expression may play an important role in cell biology.
In summary, we have shown that the predominant rat brain A2RE-binding
proteins are hnRNP A2 and four isoforms of hnRNP A3. Bacterially
expressed hnRNP A3 has been found in biosensor and gel mobility shift
assays to bind A2RE, showing that this protein can bind A2RE directly
and does not necessarily associate with A2RE indirectly by binding to
an RNA-hnRNP A2 complex. A role for hnRNP A3 in cytoplasmic RNA
trafficking, which may parallel that of hnRNP A2, is suggested by its
co-localization with hnRNP A2 in tissues and its subcellular
co-localization with A2RE RNA in neuronal transport granules. The
sequestration of these hnRNPs into two separate populations of granules
in the neuronal neurites raises interesting questions about the
mechanism by which they are recruited to the transport granules.
 |
ACKNOWLEDGEMENTS |
We thank Dr. W. F. C. Rigby for
kindly supplying the mouse antibody to hnRNP A2, Dr. P. Dodd for human
brain tissue, Dr. G. J. Kidd for discussions, Alun Jones for
performing the mass spectrometry, and Chris Wood for Edman sequencing.
 |
FOOTNOTES |
*
This work was supported by an equipment grant from the
Wellcome Trust and Australian National Health and Medical Research Council grants (to R. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
These authors contributed equally to this work.
§
Present address: Wellcome/CRC Inst., St Johnston Laboratory, Tennis
Court Rd., Cambridge CB2 1QR, UK.
¶
Present address: School of Biological Sciences, College of
Natural Sciences, University of Texas, Austin, TX 78712.
Dept. of Molecular Biophysics and Biochemistry, Yale
University, New Haven, CT 06520.
**
To whom correspondence should be addressed. Tel.:
61-7-3365-4627; Fax: 61-7-3365-4699; E-mail:
ross.s@mailbox.uq.edu.au.
Published, JBC Papers in Press, March 8, 2002, DOI 10.1074/jbc.M200050200
2
T. Munro and R. Smith, unpublished results.
3
J. Shan, T. P. Munro, E. Barbarese, J. H. Carson, and R. Smith, unpublished results.
4
H. Cui and J. H. Carson, private communication.
 |
ABBREVIATIONS |
The abbreviations used are:
MBP, myelin basic
protein;
hnRNP, heterogeneous nuclear ribonucleoprotein;
A2RE, 21-ribonucleotide hnRNP A2 response element;
A2RE11, 5'
11-ribonucleotide segment of A2RE;
FBRNP, fetal bovine
ribonucleoprotein;
HPLC, high pressure liquid chromatography;
LC-MS, liquid chromatography-mass spectrometry;
NS1, oligonucleotide that
binds nonspecifically to hnRNP A2;
PBS, phosphate-buffered saline;
RT, reverse transcription;
RTS, RNA transport sequence;
RACE, rapid
amplification of cDNA ends.
 |
REFERENCES |
| 1.
|
Ding, D.,
and Lipshitz, H. D.
(1993)
BioEssays
15,
651-658[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Pokrywka, N. J.
(1995)
Curr. Topics Dev. Biol.
31,
139-166[Medline]
[Order article via Infotrieve]
|
| 3.
|
Lasko, P.
(1999)
FASEB J.
13,
421-433[Abstract/Free Full Text]
|
| 4.
|
Mowry, K. L.,
and Cote, C. A.
(1999)
FASEB J.
13,
435-445[Abstract/Free Full Text]
|
| 5.
|
Grunert, S.,
and St. Johnston, D.
(1996)
Curr. Opin. Genet. Dev.
6,
395-402[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
St Johnston, D.
(1995)
Cell
81,
161-170[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Mohr, E.
(1999)
Prog. Neurobiol.
57,
507-525[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Kiebler, M. A.,
and DesGroseillers, L.
(2000)
Neuron
25,
19-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Bassell, G. J.,
Oleynikov, Y.,
and Singer, R. H.
(1999)
FASEB J.
13,
447-454[Free Full Text]
|
| 10.
|
Carson, J. H.,
Worboys, K.,
Ainger, K.,
and Barbarese, E.
(1997)
Cell Motil. Cytoskel.
38,
318-328[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Jansen, R.-P.
(1999)
FASEB J.
13,
455-466[Abstract/Free Full Text]
|
| 12.
|
Schnapp, B. J.
(1999)
Curr. Biol.
9,
R725-R727[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Colman, D. R.,
Kreibich, G.,
Frey, A. B.,
and Sabatini, D. D.
(1982)
J. Cell Biol.
95,
598-608[Abstract/Free Full Text]
|
| 14.
|
Campagnoni, A. T., J. M., V.,
Verity, A. N.,
Amur-Umarjee, S.,
and Byravan, S.
(1991)
Ann. N. Y. Acad. Sci.
633,
178-188[Medline]
[Order article via Infotrieve]
|
| 15.
|
Verity, A. N.,
and Campagnoni, A. T.
(1988)
J. Neurosci. Res.
21,
238-248[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Trapp, B. D.,
Moench, T.,
Pulley, M.,
Barbosa, E.,
Tennekoon, G.,
and Griffin, J.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
7773-7777[Abstract/Free Full Text]
|
| 17.
|
Ainger, K.,
Avossa, D.,
Diana, A. S.,
Barry, C.,
Barbarese, E.,
and Carson, J. H.
(1997)
J. Cell Biol.
138,
1077-1087[Abstract/Free Full Text]
|
| 18.
|
Ainger, K.,
Avossa, D.,
Morgan, F.,
Hill, S. J.,
Barry, C.,
Barbarese, E.,
and Carson, J. H.
(1993)
J. Cell Biol.
123,
431-441[Abstract/Free Full Text]
|
| 19.
|
Amur-Umarjee, S.,
Phan, T.,
and Campagnoni, A. T.
(1993)
J. Neurosci. Res.
36,
99-110[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Barbarese, E.,
Koppel, D. E.,
Deutscher, M. P.,
Smith, C. L.,
Ainger, K.,
Morgan, F.,
and Carson, J. H.
(1995)
J. Cell Sci.
108,
2781-2790[Abstract]
|
| 21.
|
Carson, J. H.,
Kwon, S.,
and Barbarese, E.
(1998)
Curr. Opin. Neurobiol.
8,
607-612[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Bassell, G.,
and Singer, R. H.
(1997)
Curr. Opin. Cell Biol.
9,
109-115[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Zhang, H. L.,
Singer, R. H.,
and Bassell, G. J.
(1999)
J. Cell Biol.
147,
59-70[Abstract/Free Full Text]
|
| 24.
|
Bassell, G. J.,
Zhang, H.,
Byrd, A. L.,
Femino, A. M.,
Singer, R. H.,
Taneja, K. L.,
Lifshitz, L. M.,
Herman, I. M.,
and Kosik, K. S.
(1998)
J. Neurosci.
18,
251-265[Abstract/Free Full Text]
|
| 25.
|
Hoek, K. S.,
Kidd, G. J.,
Carson, J. H.,
and Smith, R.
(1998)
Biochemistry
37,
7021-7029[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Munro, T. P.,
Magee, R. J.,
Kidd, G. J.,
Carson, J. H.,
Barbarese, L.,
Smith, L. M.,
and Smith, R.
(1999)
J. Biol. Chem.
274,
34389-34395[Abstract/Free Full Text]
|
| 27.
|
Kwon, S.,
Barbarese, E.,
and Carson, J. H.
(1999)
J. Cell Biol.
147,
247-256[Abstract/Free Full Text]
|
| 28.
|
Plomaritoglou, A.,
Choli-Papadopoulou, T.,
and Guialis, A.
(2000)
Biochim. Biophys. Acta
1490,
54-62[Medline]
[Order article via Infotrieve]
|
| 29.
|
Thompson, J. D.,
Higgins, G. D.,
and Gibson, T. J.
(1994)
Nucleic Acids Res.
22,
4673-4680[Abstract/Free Full Text]
|
| 30.
|
Wilkins, M. R.,
Gasteiger, E.,
Bairoch, A.,
Sanchez, J.-C.,
Williams, K. L.,
Appel, R. D.,
and Hochstrasser, D. F.
(1998)
in
2-D Proteome Analysis Protocols
(Link, A. J., ed)
, pp. 531-552, Humana Press, Totowa, NJ
|
| 31.
|
Speicher, K. D.,
Kolbas, O.,
Harper, S.,
and Speicher, D. W.
(2000)
J. Biomol. Tech.
11,
74-86
|
| 32.
|
Davies, R. J.,
Edwards, P. R.,
Watts, H. J.,
Lowe, C. R.,
Buckle, P. E.,
Yeung, D.,
Kinning, T. M.,
and Pollard-Knight, D. V.
(1994)
in
Techniques in Protein Chemistry V
(Crabb, J. W., ed)
, Academic Press, San Diego, CA
|
| 33.
|
Takiguchi, S.,
Tokino, T.,
Imai, T.,
Tanigami, A.,
Koyama, K.,
and Nakamura, Y.
(1993)
Cytogenet. Cell Genet.
64,
128-130[Medline]
[Order article via Infotrieve]
|
| 34.
|
Good, P. J.,
Rebbert, M. L.,
and Dawid, I. B.
(1993)
Nucleic Acids Res.
21,
999-1006[Abstract/Free Full Text]
|
| 35.
|
Siomi, H.,
and Dreyfuss, G.
(1995)
J. Cell Biol.
129,
551-560[Abstract/Free Full Text]
|
| 36.
|
Michael, M. W.,
Choi, M.,
and Dreyfuss, G.
(1995)
Cell
83,
415-422[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Izaurralde, E.,
Jarmolowski, A.,
Beisel, C.,
Mattaj, I. W.,
Dreyfuss, G.,
and Fischer, U.
(1997)
J. Cell Biol.
137,
27-35[Abstract/Free Full Text]
|
| 38.
|
Truant, R.,
Kang, Y.,
and Cullen, B. R.
(1999)
J. Biol. Chem.
274,
32167-32171[Abstract/Free Full Text]
|
| 39.
|
Carson, J. H.,
Cui, H.,
Kreuger, W.,
Schlepchenko, B.,
Brumwell, C.,
and Barbarese, E.
(2000)
Results Prob. Cell Different.
34,
69-81
|
| 40.
|
Buvoli, M.,
Cobianchi, F.,
Bestagno, M. G.,
Mangiarotti, A.,
Bassi, M. T.,
Biamonti, G.,
and Riva, S.
(1990)
EMBO J.
9,
1229-1235[Medline]
[Order article via Infotrieve]
|
| 41.
|
Kozu, T.,
Henrich, B.,
and Schäfer, K. P.
(1995)
Genomics
25,
365-371[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Matsui, M.,
Horiguchi, H.,
Kamma, H.,
Fujiwara, M.,
Ohtsubo, R.,
and Ogata, T.
(2000)
Biochim. Biophys. Acta
1493,
33-40[Medline]
[Order article via Infotrieve]
|
| 43.
|
Shan, J.,
Moran-Jones, K.,
Munro, T. P.,
Kidd, G. J.,
Winzor, D. J.,
Hoek, K. S.,
and Smith, R.
(2000)
J. Biol. Chem.
275,
38286-38295[Abstract/Free Full Text]
|
| 44.
|
Biamonti, G.,
Ruggiu, M.,
Saccone, S.,
Valle, G. D.,
and Riva, S.
(1994)
Nucleic Acids Res.
22,
1996-2002[Abstract/Free Full Text]
|
| 45.
|
Makeyev, A. V.,
Chkheidze, A. N.,
and Liebhaber, S. A.
(1999)
J. Biol. Chem.
274,
24849-24857[Abstract/Free Full Text]
|
| 46.
|
Kamma, H.,
Horiguchi, H.,
Wan, L.,
Matsui, M.,
Fujiwara, M.,
Fujimoto, M.,
Yazawa, T.,
and Dreyfuss, G.
(1999)
Exp. Cell Res.
246,
399-411[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Dangli, A.,
Plomaritoglou, A.,
Boutou, E.,
Vassiliadou, N.,
Moutsopoulos, H. M.,
and Guialis, A.
(1996)
Biochem. J.
320,
761-767[Medline]
[Order article via Infotrieve]
|
| 48.
|
Hamasaki, M.,
Kamma, H., Wu, W. W.,
Kaneko, S.,
Fujiwara, M.,
Satoh, H.,
Haraoka, S.,
Kikuchi, M.,
and Shirakusa, T.
(2001)
Anticancer Res.
21,
979-984[Medline]
[Order article via Infotrieve]
|
| 49.
|
Sueoka, E.,
Goto, Y.,
Sueoka, N.,
Kai, Y.,
Kozu, T.,
and Fujiki, H.
(1999)
Cancer Res.
59,
1404-1407[Abstract/Free Full Text]
|
| 50.
|
Bogerd, H. P.,
Benson, R. E.,
Truant, R.,
Herold, A.,
Phingbodhipakkiya, M.,
and Cullen, B. R.
(1999)
J. Biol. Chem.
274,
9771-9777[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. Ferron, A. Davies, K. M. Page, D. J. Cox, J. Leroy, D. Waithe, A. J. Butcher, P. Sellaturay, S. Bolsover, W. S. Pratt, et al.
The Stargazin-Related Protein {gamma}7 Interacts with the mRNA-Binding Protein Heterogeneous Nuclear Ribonucleoprotein A2 and Regulates the Stability of Specific mRNAs, Including CaV2.2
J. Neurosci.,
October 15, 2008;
28(42):
10604 - 10617.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Raju, C. Goritz, Y. Nord, O. Hermanson, C. Lopez-Iglesias, N. Visa, G. Castelo-Branco, and P. Percipalle
In Cultured Oligodendrocytes the A/B-type hnRNP CBF-A Accompanies MBP mRNA Bound to mRNA Trafficking Sequences
Mol. Biol. Cell,
July 1, 2008;
19(7):
3008 - 3019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Katahira, T. Miki, K. Takano, M. Maruhashi, M. Uchikawa, T. Tachibana, and Y. Yoneda
Nuclear RNA export factor 7 is localized in processing bodies and neuronal RNA granules through interactions with shuttling hnRNPs
Nucleic Acids Res.,
February 2, 2008;
36(2):
616 - 628.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. A. Muslimov, A. Iacoangeli, J. Brosius, and H. Tiedge
Spatial codes in dendritic BC1 RNA
J. Cell Biol.,
November 6, 2006;
175(3):
427 - 439.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fahling, R. Mrowka, A. Steege, P. Martinka, P. B. Persson, and B. J. Thiele
Heterogeneous Nuclear Ribonucleoprotein-A2/B1 Modulate Collagen Prolyl 4-Hydroxylase, {alpha} (I) mRNA Stability
J. Biol. Chem.,
April 7, 2006;
281(14):
9279 - 9286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Frolova, R. Gorchakov, N. Garmashova, S. Atasheva, L. A. Vergara, and I. Frolov
Formation of nsP3-Specific Protein Complexes during Sindbis Virus Replication.
J. Virol.,
April 1, 2006;
80(8):
4122 - 4134.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zielinski, K. Kilk, T. Peritz, T. Kannanayakal, K. Y. Miyashiro, E. Eiriksdottir, J. Jochems, U. Langel, and J. Eberwine
In vivo identification of ribonucleoprotein-RNA interactions
PNAS,
January 31, 2006;
103(5):
1557 - 1562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Hayer, M. Tohidast-Akrad, S. Haralambous, B. Jahn-Schmid, K. Skriner, S. Trembleau, H. Dumortier, S. Pinol-Roma, K. Redlich, G. Schett, et al.
Aberrant Expression of the Autoantigen Heterogeneous Nuclear Ribonucleoprotein-A2 (RA33) and Spontaneous Formation of Rheumatoid Arthritis-Associated Anti-RA33 Autoantibodies in TNF-{alpha} Transgenic Mice
J. Immunol.,
December 15, 2005;
175(12):
8327 - 8336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Buratti, A. Brindisi, M. Giombi, S. Tisminetzky, Y. M. Ayala, and F. E. Baralle
TDP-43 Binds Heterogeneous Nuclear Ribonucleoprotein A/B through Its C-terminal Tail: AN IMPORTANT REGION FOR THE INHIBITION OF CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR EXON 9 SPLICING
J. Biol. Chem.,
November 11, 2005;
280(45):
37572 - 37584.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. He, M. A. Brown, J. A. Rothnagel, N. A. Saunders, and R. Smith
Roles of heterogeneous nuclear ribonucleoproteins A and B in cell proliferation
J. Cell Sci.,
July 15, 2005;
118(14):
3173 - 3183.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Moran-Jones, L. Wayman, D. D. Kennedy, R. R. Reddel, S. Sara, M. J. Snee, and R. Smith
hnRNP A2, a potential ssDNA/RNA molecular adapter at the telomere
Nucleic Acids Res.,
January 19, 2005;
33(2):
486 - 496.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. V. Laz, C. A. Wiwi, and D. J. Waxman
Sexual Dimorphism of Rat Liver Nuclear Proteins: Regulatory Role Of Growth Hormone
Mol. Cell. Proteomics,
December 1, 2004;
3(12):
1170 - 1180.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Beriault, J.-F. Clement, K. Levesque, C. LeBel, X. Yong, B. Chabot, E. A. Cohen, A. W. Cochrane, W. F. C. Rigby, and A. J. Mouland
A Late Role for the Association of hnRNP A2 with the HIV-1 hnRNP A2 Response Elements in Genomic RNA, Gag, and Vpr Localization
J. Biol. Chem.,
October 15, 2004;
279(42):
44141 - 44153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. A. Jordan, B. D. Fernholz, M. Boussac, C. Xu, G. Grigorean, E. B. Ziff, and T. A. Neubert
Identification and Verification of Novel Rodent Postsynaptic Density Proteins
Mol. Cell. Proteomics,
September 1, 2004;
3(9):
857 - 871.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. J. Cok, S. J. Acton, A. E. Sexton, and A. R. Morrison
Identification of RNA-binding Proteins in RAW 264.7 Cells That Recognize a Lipopolysaccharide-responsive Element in the 3-Untranslated Region of the Murine Cyclooxygenase-2 mRNA
J. Biol. Chem.,
February 27, 2004;
279(9):
8196 - 8205.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. T. Shi, G.-Y. Yu, and M. M. C. Lai
Multiple Type A/B Heterogeneous Nuclear Ribonucleoproteins (hnRNPs) Can Replace hnRNP A1 in Mouse Hepatitis Virus RNA Synthesis
J. Virol.,
October 1, 2003;
77(19):
10584 - 10593.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Snee, G. J. Kidd, T. P. Munro, and R. Smith
RNA trafficking and stabilization elements associate with multiple brain proteins
J. Cell Sci.,
January 12, 2002;
115(23):
4661 - 4669.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|