JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M108065200 on March 11, 2002

J. Biol. Chem., Vol. 277, Issue 20, 18229-18237, May 17, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/20/18229    most recent
M108065200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stefanovic, B.
Right arrow Articles by Brenner, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stefanovic, B.
Right arrow Articles by Brenner, D. A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Inhibition of Collagen alpha 1(I) Expression by the 5' Stem-Loop as a Molecular Decoy*

Branko StefanovicDagger, Bernd Schnabl, and David A. Brenner

From the Departments of Medicine and Biochemistry and Biophysics, University of North Carolina, Chapel Hill, North Carolina 27599

Received for publication, August 21, 2001, and in revised form, January 15, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Collagen alpha 1(I) mRNA is posttranscriptionally regulated in hepatic stellate cells (HSCs). Binding of protein factors to the evolutionary conserved stem-loop in the 5'-untranslated region (5' stem-loop) is required for a high level of expression in activated HSCs. The 5' stem-loop is also found in alpha 2(I) and alpha 1(III) mRNAs. Titration of the 5' stem-loop binding factors by a stably expressed RNA containing the 5' stem-loop (molecular decoy) may decrease the expression of these collagen mRNAs. We designed a 108-nt RNA that is transcribed from the optimized mouse U7 small nuclear RNA gene and contains the 5' stem-loop (p74WT decoy). This decoy accumulates in the nucleus and in the cytoplasm. When expressed in NIH 3T3 fibroblasts, the p74WT decoy decreased collagen alpha 1(I) mRNA level by 60% and decreased collagen type I secreted into the cellular medium by 50%. We also expressed this decoy in quiescent rat HSCs by adenoviral gene transfer. Quiescent HSCs undergo activation in culture, resulting in a 60-70-fold increase in collagen alpha 1(I) mRNA. The decoy decreases collagen alpha 1(I) mRNA expression by 50-60% during activation of HSCs. It also decreases collagen alpha 2(I) mRNA expression and collagen alpha 1(III) mRNA expression. The cellular levels of collagen alpha 1(I) propeptide and of disulfide-bonded collagen type I trimer are reduced by 70%. However, the p74WT decoy did not decrease alpha  smooth muscle actin protein or the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase and interleukin-6. The p74WT decoy was also introduced into activated human HSCs. In these cells, the decoy decreased collagen alpha 1(I) propeptide and disulfide-bonded collagen trimer by 50-60%. These results indicate that the 5' stem-loop specifically regulates fibrillar collagen synthesis and represents a novel target for antifibrotic therapy. The molecular decoys provide a generalized method of assessing the functional significance of blocking the interactions of mRNA and proteins.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cirrhosis is characterized by the accumulation of extracellular matrix proteins in the liver, including type I collagen (1, 2). Hepatic stellate cells (HSCs1; also named Ito cells, lipocytes, or fat-storing cells) are the major cell type responsible for collagen synthesis in the cirrhotic liver (3, 4). In normal liver, quiescent HSCs store vitamin A (5) but only express trace amounts of type I collagen. Upon a fibrogenic stimulus, HSCs become activated, a process in which they lose retinoid droplets, proliferate, change morphologically into myofibroblasts, and increase their synthesis of extracellular matrix proteins (6, 7). Culturing quiescent HSCs on plastic causes activation similar to that seen in liver fibrosis in vivo, including the accumulation of collagen alpha 1(I) mRNA (7, 8). This provides a simple model system to study HSC activation and collagen gene regulation.

Expression of the collagen alpha 1(I) gene is regulated at the transcriptional and posttranscriptional level, producing an increase in the mRNA steady-state levels by 60-70-fold in activated HSCs compared with quiescent HSCs (9). This results from a 3-fold increase in the transcription rate and a 16-fold increase in the half-life of the alpha 1(I) mRNA (9), suggesting a predominantly post-transcriptional regulation. Two cis-acting elements in collagen alpha 1(I) mRNA, the 5' stem-loop and the C-rich sequence in the 3'-UTR, regulate the turnover of collagen alpha 1(I) mRNA (9, 10). alpha CP is the protein that binds the C-rich sequence in the 3'-UTR of collagen alpha 1(I) mRNA (11). Since this binding activity is only in activated HSCs, alpha CP is postulated to be involved in stabilization of collagen alpha 1(I) mRNA.

The 5'-UTRs of three fibrillar collagen mRNAs, alpha 1(I), alpha 2(I), and alpha 1(III), have a stem-loop structure encompassing the translation initiation codon (12). These three mRNAs are coordinately induced in fibrotic processes of various organs (2, 13, 14). The 5' stem-loop structure is located about 75 nt from the cap and has a stability of Delta G = 25-30 kcal/mol in different collagen mRNAs. Enzymatic probing of a synthetic 5' stem-loop RNA demonstrated folding into a higher order structure with a bulged A nucleotide (10). The 5' stem-loop is well conserved in evolution (15, 16), but the sequence flanking the stem-loop is not conserved, suggesting an important function. When the 5' stem-loop is placed in the 5'-UTR of reporter genes, the expression is inhibited in quiescent HSCs but high in activated HSCs. Reporter genes with the mutated stem-loop are constitutively expressed to a high level in both cell types. Therefore, expression of the reporter mRNA with the 5' stem-loop resembles expression of endogenous collagen alpha 1(I) mRNA in HSCs; it is low in quiescent HSCs and elevated in activated HSCs and regulated by a posttranscriptional mechanism (10). The 5' stem-loop is also necessary for down-regulating collagen alpha 1(I) expression in a process where cells revert from an activated phenotype to a more quiescent phenotype. This was achieved by culturing mouse fibroblasts within a three-dimensional matrix composed of type I collagen (17). Similarly, activated HSCs reverse to a more quiescent phenotype when cultured in matrigel (18). When the 5' stem-loop was mutated, the full size collagen alpha 1(I) mRNA was more stable in cells grown in the matrix than when this stem-loop was intact (17). Thus, the 5' stem-loop was required for accelerated decay of collagen alpha 1(I) in this experimental system.

The collagen 5' stem-loop binds nuclear and cytoplasmic proteins (10, 17). In quiescent HSCs, no protein binding to the 5' stem-loop was detected. In activated HSCs, a cytosolic protein factor(s) of unknown identity binds to the stem-loop and requires a 7mG cap on the RNA for binding. A protein of 120 kDa was cross-linked to the 5' stem-loop of collagen alpha 1(I) mRNA in extracts of activated HSCs (10). The complex is also found in fibroblasts in the postpolysomal cytoplasmic fraction. Its binding is greatly reduced if the cells are cultured in three-dimensional matrix (17). Protein binding to the 5' stem-loop may increase the steady state level of collagen mRNAs by diverting them from the degradative pathway. Extracts prepared from fibroblasts contain a nuclear protein that binds the collagen 5' stem-loop. This activity is different from the cytoplasmic binding activity, because it is detected only in nuclear extracts, it does not require the presence of 7mG cap for binding, and it has a different electrophoretic mobility in native gels. The nuclear binding inversely correlates with the accumulation of collagen alpha 1(I) mRNA (17). It is possible that after synthesis, the collagen 5' stem-loop binds this nuclear factor, which may be required for nuclear export of collagen alpha 1(I) mRNA and may accumulate in the nucleus if the cytoplasmic levels of collagen alpha 1(I) mRNA are decreased.

Binding of protein factors to the 5' stem-loop is necessary for high level of expression of collagen alpha 1(I) mRNA in activated HSCs and fibroblasts. Therefore, titration of these proteins by a highly expressed short RNA containing the 5' stem-loop (a molecular decoy) may decrease the level of alpha 1(I) mRNA and consequently collagen protein synthesis. Here we describe the design and expression of a short stable RNA containing the collagen alpha 1(I) 5' stem-loop and its effect on collagen type I synthesis in fibroblasts and HSCs.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Plasmid and Adenovirus Constructs-- The mouse U7 small nuclear RNA (U7 snRNA) gene with the optimal Sm binding site (p74) was constructed by Dr. C. Grimm (19) and was a kind gift of Prof. Dr. D. Schumperli (University of Bern, Bern, Switzerland). The EcoRI-BamHI fragment of this gene was recloned into the EcoRI-BamHI sites of the Bluescript SK+ vector. A double-stranded oligonucleotide with the sequence of mouse collagen alpha 1(I) 5' stem-loop was cloned in StuI and BspMI sites of the Bluescript construct, creating the p74WT decoy. The nucleotides flanking the 5' stem-loop were designed to preserve the transcription start site of the gene, the first 5 nt of the RNA, and the optimal Sm binding site. An oligonucleotide with a mutation in the 5' stem-loop was cloned by an identical procedure to create the p74MUT decoy. The sequences of WT and MUT stem-loop are published (10). Recombinant adenoviruses that express p74WT and p74MUT decoys were constructed using the simplified system for generation of adenoviruses (20). The HindIII-NotI fragments of the p74WT decoy and the p74MUT decoy constructs were recloned into the HindIII-NotI sites of the pADTRACK vector. The pADTRACK vector contains green fluorescent protein (GFP) expression cassette under control of cytomegalovirus promoter as a transcription unit that is independent of the cloning of the molecular decoys. The viral genomes were reconstructed by recombination in Escherichia coli between the pADTRACK constructs and pAdEasy-1 plasmid. Viral genomes were packed into infectious particles after transfection into 293 cells. The resulting viruses express both the p74WT or p74MUT decoy and GFP, which serves as a control of infection. Viruses were tested for expression and amplified by the UNC Viral Core facility.

Isolation and Culture of HSCs-- HSCs were isolated by perfusion of the livers of adult Sprague-Dawley male rats with collagenase and pronase. The resultant cell suspension was washed and centrifuged over a Stractan gradient as described (8). HSCs were collected from the 5.5 and 11% stractan interphases and cultured on uncoated plastic tissue culture dishes in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum in a 5% CO2-humidified atmosphere for 2 days. After 2 days, the medium was changed, and the cells were infected with adenoviruses expressing the molecular decoys with a multiplicity of infection of 500. Infection of HSCs with a multiplicity of infection of 500 resulted in GFP expression in 95-100% of the HSCs (not shown). 3-5 days after the infection, the cells were harvested and analyzed for expression of collagen mRNA and protein. Fully activated HSCs were obtained by culturing the cells for 7-14 days. When cellular medium was analyzed, the cells were cultured in 10 mM ascorbic acid 2-phosphate (unhydrolyzable derivative of ascorbic acid; Waco) in 0% serum 24 h before collection of the medium. Human HSCs were isolated by perfusion of surgically removed parts of human liver, as above. These cells were cultured for 7 days before they were infected with adenoviruses.

Transfection of NIH 3T3 Fibroblasts-- NIH 3T3 fibroblasts were transfected by the calcium phosphate technique, using 10 µg of decoy plasmids and 1 µg of luciferase plasmid (pGL3; Promega) per 100-mm dish as a control for transfection efficiency. After 12 h, the medium was changed, and the cells were harvested after an additional 36 h of culturing. To make stable cell lines, 1 µg of pCDNA3 vector was co-transfected with 10 µg of decoy plasmids into NIH 3T3 fibroblasts, and stable transformants were selected with G418 for 3 weeks. Well isolated clones were expanded and analyzed for decoy expression by RNase protection assays (RPA).

RNA Isolation and Analysis-- Total cellular RNA was isolated by the standard procedure (21). Cytoplasmic and nuclear RNAs were isolated as described by Grimm (19). Expression of collagen alpha 1(I) mRNAs was measured by RPA, according to our published procedure (9). Collagen-specific probes were hybridized together with a GAPDH probe, as an internal standard, to account for recovery of the RNA. Riboprobes specific for decoy RNAs were derived by transcribing the antisense strand of the p74WT decoy and p74MUT decoy plasmids with T3 RNA polymerase, after linearizing the plasmids with HgaI. Typically, 5-20 µg of total or cytoplasmic RNA were analyzed, and nuclear RNA was analyzed in one-fourth of the amount of its corresponding cytoplasmic sample. This ratio represents the equivalent amounts of RNA that we consistently extracted from the two compartments from 3T3 fibroblasts and HSCs. RT-PCRs for collagen alpha 1(I) mRNA and GAPDH mRNA were done as described (9). For collagen alpha 2(I) mRNA, the primers were TGAATACAACGCAGAAGGGGT (5' primer) and TTTGAAACAGACAGGGCCAA (3' primer), which amplify RT-PCR product of 385 nt. For alpha 1(III) mRNA, the primers were GATCAGGCCAATGGCAATGT (5' primer) and AAAAGCAAACAGGGCCAATG (3' primer), which amplify RT-PCR product of 259 nt. For interleukin-6 mRNA, the primers were described (22). RT-PCRs were done with 100 ng of total RNA using the rTth reverse transcriptase RNA PCR kit (PerkinElmer Life Sciences) in the presence of 10 µCi of [32P]dCTP, according to the recommended protocol. Gene-specific primers were used together with GAPDH-specific primers, as an internal control, in the same reverse transcription and amplification reaction, which consisted of 20 cycles (1 min at 94 °C, 1 min at 55 °C, and 1 min at 72 °C). The PCR step of 20 cycles is in the linear range of the reaction, and coamplification of GAPDH assures equal loading of RNA. For alpha 1(III) mRNA, 30 cycles were used (1 min at 94 °C, 1 min at 50 °C, and 1 min at 72 °C), and no coamplification with GAPDH primers was done, because 30 cycles is outside the linear range for this mRNA. PCR products were resolved on 6% denaturing acrylamide gels. All gels were quantified by phosphorimaging.

Western Blots-- 20 µg of cellular proteins were resolved on a 7.5% SDS-PAGE gel under reducing or nonreducing conditions, as indicated. After blotting, the membrane was probed with an antibody raised against human collagen type I (600-401-103; Rockland, Inc., Rockland, PA). This antibody recognizes the pro-alpha 1(I) chain, the mature alpha 1(I) chain, and the heterotrimer of type I collagen. It does not recognize alpha 2(I) chain2 and does not cross-react with other collagens. Prior to electrophoresis, some samples were digested at room temperature for 30 min with pepsin (1000 units; Sigma) at pH 2.5 or with 7.5 units of bacterial collagenase (Roche Molecular Biochemicals), as controls for antibody specificity. Treatment with collagenase resulted in complete loss of signal, whereas treatment with pepsin resulted in reduction of the molecular mass from 170 to 120 kDa (not shown). Collagen in cellular medium was analyzed as above, after concentration of the medium by ultrafiltration (Amicon; cut-off limit 100 kDa). To optimize collagen secretion, the cells were grown in the presence of 10 mM ascorbic acid 2-phosphate, in 0% serum for 24 h before medium collection. The amount of medium that was analyzed on the gel was proportional to the number of cells in a given plate. Western blots were quantified by densitometry.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Construction and Expression of Molecular Decoys-- A molecular decoy containing the collagen 5' stem-loop was based on the modified mouse U7 small nuclear RNA (snRNA) gene. The wild type Sm binding site of this gene was replaced by the optimal Sm binding site (construct p74). This modification rendered this U7 snRNA nonfunctional in histone processing (the normal function of U7 snRNA) but produced a higher accumulation, predominantly in the cell nucleus (19). The metabolic pathway of snRNAs is shown at the bottom of Fig. 1A. The 5'-end of U7 RNA is free of proteins (23) and can accommodate various sequences unrelated to U7 function (24). The p74WT decoy was constructed by introducing the 5' stem-loop of the mouse collagen alpha 1(I) mRNA into the 5'-end of the optimal U7 snRNA gene. This insertion increased the total length of the transcript to 108 nt and did not affect the transcription start site or the sequence of the optimal Sm binding site (Fig. 1A). The p74MUT decoy is identical except that 20 nt of the 5' stem-loop were mutated to abolish formation of the 5' stem-loop. This control decoy also has a length of 108 nt (Fig. 1A).


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 1.   Expression of molecular decoys in NIH 3T3 cells. A, top panel, schematic representation of the molecular decoys. The 108-nt RNA is shown as a line, eight core Sm proteins are indicated as circles, and the 5' stem-loop of collagen alpha 1(I) mRNA is indicated. p74MUT decoy has a substitution of 15 nt, which abolishes formation of the 5' stem-loop. 7mG represents the monomethylated cap structure that the decoys initially acquire. Bottom panel, metabolism of snRNAs. Nucleocytoplasmic trafficking and modifications to snRNAs in the cytoplasm are indicated. B, expression of molecular decoys in transiently transfected NIH 3T3 fibroblasts. 48 h after transfection of the p74WT plasmid (lanes 1 and 2) or the p74MUT plasmid (lanes 3 and 4), nuclear (N) and cytoplasmic (C) RNA was extracted and analyzed by RNase protection assays with riboprobes specific for the p74WT decoy (WT) and p74MUT decoy (MUT). Lane 5, total RNA (T) from nontransfected cells (-) probed with the p74WT riboprobes as a control. The arrows indicate migration of the bands corresponding to the longer isoform of decoys (pre-decoy) and the mature size decoy (decoy). C, the same RNA as in B was probed with riboprobe specific for mouse GAPDH mRNA. The expression of this mRNA is indicated by GAPDH.

Expression of the decoys and their subcellular accumulation was analyzed by transient transfections into NIH 3T3 fibroblasts. Luciferase control gene was cotransfected with the decoy genes to assess transfection efficiency. Cytoplasmic and nuclear RNA were extracted and analyzed by RNase protection assay using decoy-specific riboprobes (Fig. 1B) and GAPDH probe (Fig. 1C) as a control for nuclear and cytoplasmic separation. In several experiments, we consistently extracted about 4-fold more RNA from the cytoplasmic fraction than from the nuclear fraction, so in subsequent experiments we used this ratio as a representative abundance of the RNA in these compartments. Total expression (nuclear + cytoplasmic) of p74MUT decoy was comparable with the expression of p74WT decoy (Fig. 1B). Luciferase activity was also similar in these samples, suggesting similar transfection efficiencies (not shown). The p74MUT decoy accumulated mostly as the RNA of expected size of 108 nt (decoy) and to about the same levels in the nucleus and in the cytoplasm (lanes 3 and 4). p74WT decoy RNA accumulated as a longer species of about 115-120 nt (pre-decoy) as well as the mature size species (decoy). In the cytoplasm, both of these isoforms were found (lane 1), whereas the mature size decoy mostly accumulated in the nucleus (lane 2). The longer isoform of the p74WT decoy presumably contains additional nucleotides at its 3' end (see "Discussion"). Similar to the p74MUT decoy, 50% of total p74WT decoy was found in the cytoplasm and 50% in the nucleus. GAPDH mRNA showed predominant cytoplasmic accumulation (Fig. 1C), as expected for this mRNA, which suggests minimal cross-contamination of the nuclear and cytoplasmic fractions. From these experiments, we conclude that the collagen 5' stem-loop can be expressed as a short stable RNA using the optimal U7 snRNA gene. Since it is expressed in both nucleus and cytoplasm, the decoy may encounter nuclear and cytoplasmic collagen 5' stem-loop-binding proteins.

p74WT Decoy Decreases Collagen mRNA in NIH 3T3 Fibroblasts-- To assess how expression of the p74WT decoy affects the expression of endogenous collagen alpha 1(I) mRNA, we developed NIH 3T3 cell lines that stably express the p74WT decoy and p74MUT decoy. Fig. 2A shows an experiment where we characterized one cell line expressing a high level of the p74WT decoy (lane 1, WT#1), a control cell line not expressing a decoy (lane 2, -), and two cell lines expressing the p74MUT decoy (lanes 3 and 4, MUT#1 and MUT#2). Decoy expression was analyzed in total RNA, and a longer isoform of the p74WT decoy was detected (Fig. 2A, pre-DECOY). For analysis of endogenous collagen alpha 1(I) mRNA, nuclear and cytoplasmic RNAs were extracted from the same cell lines and probed with riboprobes specific for mouse collagen alpha 1(I) mRNA and GAPDH mRNA, as a control for loading. Fig. 2B demonstrates that the expression of p74WT decoy decreased the cytoplasmic levels of endogenous collagen alpha 1(I) mRNA (Fig. 2B, lane 1), compared with the level in cells without decoy (lane 3) and in cells expressing the p74MUT decoy (lanes 5 and 7). Collagen alpha 1(I) mRNA in the nucleus is not affected by the decoy (lanes 2, 4, 6, and 8). The band indicated with an asterisk is a nonspecific band present when tRNA is probed with the same riboprobes and compared with total RNA from NIH 3T3 fibroblasts (compare lanes 9 and 10). Additional cell lines of NIH 3T3 fibroblasts expressing the p74WT and p74MUT decoy were developed, and cytoplasmic RNA was analyzed for expression of endogenous collagen alpha 1(I) mRNA (Fig. 2C). All cell lines expressing the p74WT decoy (WT#2 to WT#6) had a decreased level of collagen alpha 1(I) mRNA to about 40% of the level seen in the cell lines expressing the p74MUT decoy (MUT#3 and MUT#4). From these experiments, we conclude that a high level of p74WT decoy down-regulates the cytoplasmic level of collagen alpha 1(I) mRNA.


View larger version (44K):
[in this window]
[in a new window]
  		Fig. 2.   Effect of molecular decoys on endogenous collagen alpha 1(I) mRNA in stably transfected NIH 3T3 cells. A, expression of molecular decoys in clonal cell lines. Total RNA was extracted from a cell line expressing the p74WT decoy (lane 1, WT#1), a control cell line expressing no decoy (lane 2, -), and two cell lines expressing p74MUT decoy (lanes 3 and 4, MUT#1 and MUT#2) and probed with the decoy-specific riboprobes as in Fig. 1. The arrows indicate migration of the two decoy isoforms. B, expression of endogenous collagen alpha 1(I) mRNA in the same cell lines as in A. Nuclear (N) and cytoplasmic (C) RNA was extracted from the cell lines: WT#1 (lanes 1 and 2), control (lanes 3 and 4), MUT#1 (lanes 5 and 6), and MUT#2 (lanes 7 and 8) and analyzed by RNase protection assays with riboprobes specific for mouse collagen alpha 1(I) mRNA (COLL) and mouse GAPDH mRNA (GAPDH). Lane 9, tRNA analyzed with collagen and GAPDH riboprobes; lane 10, total RNA from NIH 3T3 cells analyzed with the same riboprobes. The migrations of the relevant bands are indicated by arrows. The band indicated with an asterisk is nonspecific, since it is seen in the tRNA lane. C, additional NIH 3T3 cell lines expressing the p74WT decoy (lanes 2-6) and p74MUT decoy (lanes 7 and 8) were analyzed for decoy expression as in Fig. 2A (top panel) and for collagen alpha 1(I) mRNA expression as in Fig. 2B (bottom panel; only results with cytoplasmic RNA are shown). Lane 1, top panel, RNA from control cells; lane 9, bottom panel, tRNA control. Lane 9, top panel, and lane 1, bottom panel, size markers. Migration of the relevant bands is indicated by arrows, and migration of nonspecific bands is indicated by asterisks. D, accumulation of collagen protein in cellular medium from the above cell lines. Cells from cell line WT#1 (lane 1) and MUT#1 (lane 2) were seeded at equal density and incubated for 24 h with ascorbic acid 2-phosphate to stimulate collagen production. Cellular medium was collected and concentrated, and equivalent amounts were analyzed by Western blot. The samples were resolved under reducing conditions. The migration of pro-alpha 1(I) chain (pro-alpha1) is indicated. Migration of molecular weight markers is indicated to the right.

Decreased cytoplasmic levels of collagen alpha 1(I) mRNA may result in diminished synthesis of collagen protein. Therefore, we analyzed cellular medium of the cell lines WT#1 and MUT#1 for accumulation of procollagen by Western blot. Prior to harvesting the medium, the cells were grown for 24 h in presence of ascorbic acid 2-phosphate, to maximize the synthesis and secretion of triple-helical collagen (25). Equivalent amounts of cellular medium are resolved under reducing conditions (Fig. 2D). Cells expressing the p74WT decoy secreted 50% less procollagen than cells expressing the p74MUT decoy (compare lane 1 with lane 2). We concluded that p74WT decoy can inhibit collagen alpha 1(I) mRNA and collagen protein secretion by NIH 3T3 fibroblasts.

Expression of Molecular Decoys in Rat HSCs-- Specific inhibition of fibrillar collagen expression in HSCs is one of the goals for therapy of liver fibrosis. To express molecular decoys in HSCs, we constructed adenoviruses expressing the p74WT decoy and the p74MUT mutant decoy. The viruses also express GFP from an independent transcription unit, so that GFP can serve as a marker for efficiency of infection. We infected rat HSCs at day 7 after isolation with viruses expressing the decoys and analyzed decoy RNA expression by RNase protection assays at 4 days postinfection (Fig. 3A). Control decoy (p74MUT, lane 2) was expressed at a 1.25-fold higher level than the decoy with the 5' stem-loop (p74WT, lane 1). The p74WT decoy accumulated partly as a longer precursor RNA (predecoy). Infection efficiency of both decoys was similar as judged by expression of GFP from the same samples (Fig. 3B). Having established that the decoys can be expressed in HSCs, we assessed their effectiveness in inhibiting collagen type I expression during culture activation of rat HSCs.


View larger version (64K):
[in this window]
[in a new window]
  		Fig. 3.   Expression of molecular decoys in HSCs. A, RNase protection assay with total RNA extracted from rat HSCs infected with adenoviruses expressing the p74WT decoy (WT, lane 1) and p74MUT decoy (MUT, lane 2). The expression was analyzed 5 days after infection as in Fig. 1B. Lanes 3 and 4, uninfected HSCs analyzed with riboprobes specific for p74WT and p74MUT decoy, respectively. Migrations of the two isoforms of the decoys are indicated to the left. B, the same cells as in A are analyzed by Western blot for expression of GFP. This protein is expressed from the same adenoviruses that express molecular decoys, but from an independent transcription unit. Uninfected cells show no GFP expression (not shown).

Molecular Decoy Decreases the Steady-state Level of Collagen alpha 1(I) mRNA in HSCs-- Freshly isolated quiescent HSCs change to an activated phenotype when plated on plastic. During this process, collagen type I expression progressively increases from day 3 and reaches the maximum expression at day 7 after plating (8). To assess the inhibitory potential of molecular decoys during this activation, we infected HSCs at day 2 after plating with adenoviruses expressing the p74WT decoy and p74MUT decoy with a multiplicity of infection of 500. This resulted in 95% of cells expressing GFP at the time of analysis. The cells were further cultured until day 7 (5 days after infection with the viruses), when nuclear and cytoplasmic RNA was extracted and analyzed for expression of endogenous collagen alpha 1(I) mRNA and GAPDH mRNA, as a control for loading. The results of one such experiment are shown in Fig. 4A. During culture activation of HSCs, the p74WT decoy significantly reduced the steady state level of collagen alpha 1(I) mRNA in the cytoplasm of HSCs, as compared with the level seen in the presence of the p74MUT decoy (compare lanes 3 and 5). Accumulation of collagen alpha 1(I) mRNA was barely detectable in the nucleus and was unaffected by the p74WT decoy (lanes 2 and 4). Expression of GFP, as a marker for viral delivery, was similar in both infections (Fig. 4B). Fig. 4C shows quantification of the results of three independent experiments. Expression of collagen alpha 1(I) mRNA was reduced by 46 ± 16% by the p74WT decoy. From these results, we concluded that the p74WT decoy is effective in decreasing collagen alpha 1(I) mRNA expression during in vitro activation of quiescent HSCs into myofibroblasts.


View larger version (36K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of molecular decoys on collagen alpha 1(I) mRNA expression in rat HSCs. A, RPA with nuclear (N) and cytoplasmic (C) RNA from rat HSCs infected with adenovirus expressing the p74WT decoy (lanes 2 and 3, WT) and p74MUT decoy (lanes 4 and 5, MUT). The cells were infected at day 2 after isolation, and RNA was analyzed at day 7 (5 days after infection). Migration of the protected band for collagen alpha 1(I) mRNA (COLL) and GAPDH mRNA (GAPDH), as an internal control, is indicated. Lane 1, tRNA control. B, Western blot of cellular proteins from the same cells as in A, probed with the antibody specific for GFP. C, quantification of three independent RPA experiments. Expression of collagen alpha 1(I) mRNA was normalized to expression of GAPDH mRNA and set as 100% for p74MUT decoy (MUT). Expression in the presence of the p74WT decoy (WT) was shown relative to the expression with p74MUT decoy. Error bars, ± S.E.

Molecular Decoy Inhibits Collagen alpha 2(I) mRNA and alpha 1(III) mRNA-- Since the 5' stem-loop is also found in the 5'-UTR of collagen alpha 2(I) mRNA and alpha 1(III) mRNA, we assessed if the p74WT decoy would decrease steady state level of these mRNAs. We analyzed alpha 2(I) mRNA level by semiquantitative RT-PCR. Expression of collagen alpha 1(I) mRNA by RT-PCR was similar to the result obtained by RPA analysis (Fig. 5), suggesting that our RT-PCR analysis is appropriate for assessment of steady-state levels of various collagen mRNAs. Collagen alpha 2(I) mRNA was similarly decreased by the p74WT decoy compared with the p74MUT decoy (Fig. 5). Collagen alpha 1(III) mRNA was decreased by the p74WT decoy as well (Fig. 5). In this reaction, we did not coamplify GAPDH mRNA, because the reaction required 30 cycles, which is out of the linear range for GAPDH. However, since the same RNA was used as for alpha 1(I) and alpha 2(I) analysis, we assumed that its integrity is comparable. Interleukin-6 mRNA was unaffected by the p74WT decoy. Since GAPDH mRNA also did not show a significant difference in multiple experiments, we concluded that inhibition by the p74WT decoy is specific for the three fibrillar collagen mRNAs.


View larger version (49K):
[in this window]
[in a new window]
  		Fig. 5.   RT-PCR analysis of expression of collagen alpha 1(I) mRNA (alpha1(I)), alpha 2(I) mRNA (alpha2(I)), alpha 1(III) mRNA (alpha1(III)), and interleukin-6 mRNA (IL-6) of HSCs infected with p74WT virus (lane 1, WT) or p74MUT virus (lane 2, MUT). Infections were done as in Fig. 4A. The specific mRNAs were coanalyzed with GAPDH mRNA (GAPDH) as internal control, except for alpha 1(III) mRNA, where 30 cycles of PCR amplification were needed, which is out of linear range for GAPDH. Migration of the specific PCR products is indicated.

Molecular Decoy Inhibits Collagen Protein Synthesis in Rat HSCs-- Two independent experiments were performed to assess the effect of the decoys on collagen protein synthesis. First, we transduced quiescent rat HSCs at day 2 after isolation with the viruses expressing the p74WT and p74MUT decoys. Expression of collagen alpha 1(I) protein was analyzed by Western blot at day 5 after isolation (3 days after infection with the viruses). The Western blot was performed with cellular proteins under reducing conditions (Fig. 6A). The decoy with the 5' stem-loop (p74WT) inhibits procollagen synthesis by about 65%, compared with the decoy without the stem-loop (p74MUT) (compare lanes 1 and 2, pro-alpha 1(I)). Expression of GFP serves as a control for decoy delivery into HSCs. Second, rat HSCs were incubated for 5 days after viral infection (a total of 7 days after isolation), and collagen type I was analyzed under nonreducing conditions (Fig. 6B, pro-collagen). In this experiment, we wanted to see if the decoy inhibits synthesis of procollagen assembled into the disulfide-bonded multichain complex, and if this inhibition persisted in activated HSCs. Again, the wild type decoy decreased procollagen synthesis by 70%. Reprobing for alpha SMA reveals a slightly higher expression of this protein in the cells expressing p74WT decoy, further demonstrating that the wild-type decoy is a specific inhibitor of fibrillar collagen.


View larger version (40K):
[in this window]
[in a new window]
  		Fig. 6.   Inhibition of collagen protein synthesis by molecular decoys in rat HSCs. A, Western blot of cellular proteins extracted from rat HSCs infected with adenoviruses expressing the p74WT decoy (lane 1, WT) and p74MUT decoy (lane 2, MUT). The cells were infected at day 2 after isolation and analyzed at day 5 (3 days after infection). 20 µg of cellular proteins were resolved under reducing conditions, and the same blot was probed with antibodies against collagen alpha 1(I) (pro-alpha1(I)) and against GFP, as a control for infection. Migration of molecular weight markers is indicated to the right. B, the same experiment as in A except that the cells were infected at day 2 after isolation and analyzed at day 7 (5 days after infection) under nonreducing conditions. Pro-collagen, the disulfide-bonded high molecular weight procollagen type I. alpha SMA, expression of alpha -smooth muscle actin in the same samples. Migration of molecular weight markers is indicated to the right.

Molecular Decoy Is Effective in Decreasing Collagen Protein Synthesis in Human HSCs-- Finally, we wanted to see if the p74WT decoy is effective in primary human HSCs. Human HSCs are efficiently infected with adenoviruses,2 and the mouse U7 promoter is active in human cells (19, 24). Also, the mouse 5' stem-loop in the p74WT decoy is identical to the 5' stem-loop of human collagen alpha 1(I) mRNA. Therefore, we infected activated primary human HSCs and analyzed collagen alpha 1(I) protein expression 5 days after infection (Fig. 7). Collagen expression was analyzed by Western blot of cellular proteins. Proteins were resolved under reducing conditions (Fig. 7A, pro-alpha 1(I)) or, in an independent experiment, under nonreducing conditions (Fig. 7B, pro-collagen). In both experiments, the p74WT decoy decreased procollagen alpha 1(I) protein expression to 50-60%. Expression of the GFP was equal for both decoys (Fig. 7A, GFP), suggesting similar transduction efficiency. Thus, molecular decoys reduce excessive collagen production in activated primary human HSCs.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 7.   Inhibition of collagen protein synthesis by molecular decoys in human HSCs. A, activated primary human HSCs were infected with adenoviruses expressing the p74WT decoy (lane 1, WT) and p74MUT decoy (lane 2, MUT), and cellular proteins were analyzed by Western blot 5 days after infection under reducing conditions. The blot was probed with antibody against collagen alpha 1(I) (pro-alpha 1(I)) and against GFP, as control for infection. Migration of molecular weight markers is indicated to the right. B, independent experiment, essentially as in A, but proteins are resolved under nonreducing conditions. The amount of disulfide-bonded high molecular weight procollagen type I (pro-collagen) is indicated. Migration of molecular weight markers is indicated to the right.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The 5' stem-loop of fibrillar collagen mRNAs is a critical cis-acting element that regulates expression. In quiescent HSCs, the 5' stem-loop of collagen alpha 1(I) mRNA in the absence of its cognate binding proteins inhibits expression of its mRNA (10). In activated HSCs, where the 5' stem-loop binding proteins are present, there is a high level of expression of collagen alpha 1(I) mRNA as well as reporter mRNAs with the 5' stem-loop (10). Therefore, it should be possible to inhibit collagen alpha 1(I) expression in activated HSCs by titrating out these proteins. This was achieved by expressing a short stable RNA containing the sequence of the 5' stem-loop to act as a molecular decoy (Figs. 1A and 8).


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 8.   Putative mechanism of action of the p74WT decoy. Control, collagen mRNA (shown as a black line with poly(A) tail) associates with the 5' stem-loop-binding proteins (gray circle) and is efficiently exported from the nucleus (N) into the cytoplasm. The mRNA is targeted to the ribosomes (R), associated with the membrane of the endoplasmic reticulum (M). Collagen peptides (CP) are synthesized, assembled into triple helix in the lumen of endoplasmic reticulum (ER), and secreted out of the cell. Decoy, decoy RNA (D) equilibrates between the nucleus and the cytoplasm and sequesters the 5' stem-loop binding factors. Collagen mRNA is left without its binding proteins and is targeted for rapid degradation.

The decoy described here was expressed from a modified mouse U7 snRNA gene (19). snRNA genes are active in all cell types and direct transcription by RNA polymerase II, so that all transcripts initially acquire a 7mG cap (26). The modified U7 gene encodes an snRNA that has an optimized Sm binding site, which increases stability of the RNA and targets it to the nucleus (19), but is nonfunctional in histone pre-mRNA processing (27, 28). The 5'-end of U7 snRNA is free of proteins and can accommodate any short RNA sequence (24). Thus, we placed the 5' stem-loop sequence of the mouse collagen alpha 1(I) mRNA at the 5'-end of the optimized U7 snRNA gene (p74WT decoy). The collagen 5' stem-loop is mutated in the control decoy (p74MUT) (Fig. 1A). Both modifications increased the length of the RNA to 108 nt, without significantly affecting expression (Figs. 1B and 3A). Being synthesized by an snRNA gene, the decoy RNAs are exported from the nucleus into the cytoplasm, where assembly with the Sm proteins into a ribonucleoprotein particle takes place (29). Assembly with Sm proteins leads to hypermethylation of the cap (30) and maturation of the 3' end by removal of several nt (31). These modifications provide stability and redirect the particle back into the nucleus (32) (Fig. 1A, bottom panel). Association with Sm proteins is an absolute requirement for nuclear accumulation of snRNAs (32). Thus, the decoy may encounter both the nuclear and the cytoplasmic 5' stem-loop binding proteins. We believe that sequestration of these binding proteins by the p74WT decoy renders the three fibrillar collagen mRNAs unstable and reduces collagen expression in fibroblasts and HSCs (Fig. 8). Our preliminary results indicate that two proteins can be specifically UV-cross-linked to the p74WT decoy RNA (not shown). Binding of cytoplasmic proteins to the 5' stem-loop in vitro requires the presence of the 7mG cap. In the initial stage after its synthesis, the decoy acquires a 7mG cap, because it is transcribed by RNA polymerase II (26), and this may facilitate binding of the cytoplasmic proteins.

We have repeatedly detected a precursor form of the p74WT decoy (Figs. 1B, 2A, and 3A). This form is longer by 10-15 nt and presumably arises from inefficient 3'-end maturation. Why the 5' stem-loop inhibits the 3'-end formation is not clear. It may interfere with assembly of Sm proteins, which is required for 3'-end trimming (31), or change the RNA structure so that the 3'-end is inaccessible to the processing factors. The p74WT decoy accumulates to a similar level as the p74MUT decoy, which undergoes complete maturation, suggesting that both decoys have a similar stability (Figs. 1B and 3A). However, the precursor form of the p74WT decoy accumulates almost exclusively in the cytoplasm, while the mature form is found in the nucleus (Fig. 1B). Regardless of its length, both forms of the p74WT decoy should be effective in titration of the 5' stem-loop-binding proteins.

The inability to efficiently introduce genes into quiescent HSCs has previously limited studies of gene expression in this cell type. However, delivery of genes using adenoviral vectors is a receptor-mediated process, and infection with equal multiplicity of infection into a given population of cells results in uniform and reproducible gene transfer (10, 33). Using this technology, we successfully introduced molecular decoys in HSCs with a quiescent phenotype, only 2 days after isolation. Our viruses also express GFP from an independent transcription unit, which serves as an indicator of infection efficiency. Equal expression of GFP is associated with comparable expression of the p74WT and p74MUT decoy (Fig. 3). The efficacy of molecular decoys in inhibiting collagen alpha 1(I) gene expression in HSCs was tested during culture activation of these cells. Collagen alpha 1(I) mRNA was decreased by 46% in the presence of p74WT decoy in HSCs (Fig. 4C). Similar results were obtained with NIH 3T3 fibroblasts (Fig. 2). There was no clear correlation between the level of expression of the p74WT decoy and the decrease in steady state level of collagen alpha 1(I) mRNA (Fig. 2C). It is possible that even the modest expression of the p74WT decoy is sufficient to titrate the putative 5' stem-loop binding protein(s). Expression of collagen alpha 2(I) and alpha 1(III) mRNA was also inhibited by the p74WT decoy in HSCs to a similar extent (Fig. 5). The cumulative result was to decrease intracellular pro-collagen by 70% (Fig. 6). Expression of GAPDH mRNA (Fig. 5), interleukin-6 mRNA (Fig. 5), and alpha SMA protein (Fig. 6) were unaffected by the p74WT decoy, suggesting a specific effect of the decoy on the three fibrillar collagen mRNAs. Expression of the disulfide-bonded high molecular weight pro-collagen, a precursor form of fibril formation, was decreased by the p74WT decoy by 70% in rat HSCs (Fig. 6B) and by 50% in human HSCs (Fig. 7B). Collagen secreted into the supernatants of fibroblasts was also inhibited by 50% (Fig. 2D). In addition to inhibiting fibrillar collagen mRNA stability, the p74WT decoy may also inhibit collagen mRNA translation. Such significant effects suggest that decoys based on the p74WT construct may become an effective tool for gene therapy of liver fibrosis.

Although the decoys are based on snRNAs that are nonfunctional in their physiological processes (27, 28), sequestration of Sm proteins by the decoys and competition for transcription factors with other snRNA genes may cause some undesired side effects. As a proof of principle, we have developed fibroblast cell lines that stably express a high level of the 5' stem-loop decoy (Fig. 2). These cells are morphologically indistinguishable from the control cells with similar growth rates but specifically decrease collagen production. Thus, our study demonstrates that molecular decoys may provide a general method of assessing the functional significance of blocking the interactions of endogenous mRNAs and proteins.

Several gene therapies have been proposed for treatment of liver fibrosis. They are based on enhancing the degradation of extracellular matrix by overexpressing urokinase-type plasminogen activator (34) or matrix metalloproteinase 1 (35) or on stimulation of hepatocyte proliferation by expression of hepatocyte growth factor (36). The molecular decoys described here act by a novel mechanism of preventing excessive production of fibrillar collagens. This effect is significant in HSCs in culture and suggests that molecular decoys may be effective in reducing excessive collagen production in liver fibrosis.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Division of Digestive Diseases and Nutrition, University of North Carolina, CB 7038, 154 Glaxo Bldg., Chapel Hill, NC 27599. Tel.: 919-966-7885; Fax: 919-966-7468; E-mail: stefbra@med.unc.edu.

Published, JBC Papers in Press, March 11, 2002, DOI 10.1074/jbc.M108065200

2 B. Stefanovic, B. Schnabl, and D. A. Brenner, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: HSC, hepatic stellate cells; UTR, untranslated region; snRNA, small nuclear RNA; GFP, green fluorescent protein; RPA, RNase protection assay(s); RT, reverse transcription; nt, nucleotide(s); GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WT wild type, MUT, mutant.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Aycock, R. S., and Seyer, J. M. (1989) Connect. Tissue Res. 23, 19-31[Medline] [Order article via Infotrieve]
2. Schuppan, D. (1990) Semin. Liver Dis. 10, 1-10[Medline] [Order article via Infotrieve]
3. de Leeuw, A. M., McCarthy, S. P., Geerts, A., and Knook, D. L. (1984) Hepatology 4, 392-403[Medline] [Order article via Infotrieve]
4. Maher, J. J., and McGuire, R. F. (1990) J. Clin. Invest. 86, 1641-1648[Medline] [Order article via Infotrieve]
5. Hendriks, H. F., Verhoofstad, W. A., Brouwer, A., de Leeuw, A. M., and Knook, D. L. (1985) Exp. Cell Res. 160, 138-149[CrossRef][Medline] [Order article via Infotrieve]
6. Friedman, S. L. (1999) Alcohol Clin. Exp. Res. 23, 904-910[CrossRef][Medline] [Order article via Infotrieve]
7. Knittel, T., Kobold, D., Saile, B., Grundmann, A., Neubauer, K., Piscaglia, F., and Ramadori, G. (1999) Gastroenterology 117, 1205-1221[CrossRef][Medline] [Order article via Infotrieve]
8. Friedman, S. L., Rockey, D. C., McGuire, R. F., Maher, J. J., Boyles, J. K., and Yamasaki, G. (1992) Hepatology 15, 234-243[Medline] [Order article via Infotrieve]
9. Stefanovic, B., Hellerbrand, C., Holcik, M., Briendl, M., Aliebhaber, S., and Brenner, D. A. (1997) Mol. Cell. Biol. 17, 5201-5209[Abstract]
10. Stefanovic, B., Hellerbrand, C., and Brenner, D. A. (1999) Mol. Cell. Biol. 19, 4334-4342[Abstract/Free Full Text]
11. Lindquist, J. N., Kauschke, S. G., Stefanovic, B., Burchardt, E. R., and Brenner, D. A. (2000) Nucleic Acids Res. 28, 4306-4316[Abstract/Free Full Text]
12. Yamada, Y., Mudryj, M., and de Crombrugghe, B. (1983) J. Biol. Chem. 258, 14914-14919[Abstract/Free Full Text]
13. Niederreither, K., D'Souza, R., Metsaranta, M., Eberspaecher, H., Toman, P. D., Vuorio, E., and De Crombrugghe, B. (1995) Matrix Biol. 14, 705-713[CrossRef][Medline] [Order article via Infotrieve]
14. Milani, S., Herbst, H., Schuppan, D., Surrenti, C., Riecken, E. O., and Stein, H. (1990) Am. J. Pathol. 137, 59-70[Abstract]
15. Su, M. W., Suzuki, H. R., Bieker, J. J., Solursh, M., and Ramirez, F. (1991) J. Cell Biol. 115, 565-575[Abstract/Free Full Text]
16. D'Alessio, M., Ramirez, F., Suzuki, H. R., Solursh, M., and Gambino, R. (1990) J. Biol. Chem. 265, 7050-7054[Abstract/Free Full Text]
17. Stefanovic, B., Lindquist, J., and Brenner, D. A. (2000) Nucleic Acids Res. 28, 641-647[Abstract/Free Full Text]
18. Friedman, S. L., Roll, F. J., Boyles, J., Arenson, D. M., and Bissell, D. M. (1989) J. Biol. Chem. 264, 10756-10762[Abstract/Free Full Text]
19. Grimm, C., Stefanovic, B., and Schumperli, D. (1993) EMBO J. 12, 1229-1238[Medline] [Order article via Infotrieve]
20. He, T. C., Zhou, S., da Costa, L. T., Yu, J., Kinzler, K. W., and Vogelstein, B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2509-2514[Abstract/Free Full Text]
21. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162, 156-159[Medline] [Order article via Infotrieve]
22. Herfarth, H. H., Mohanty, S. P., Rath, H. C., Tonkonogy, S., and Sartor, R. B. (1996) Gut 39, 836-845[Abstract/Free Full Text]
23. Smith, H. O., Tabiti, K., Schaffner, G., Soldati, D., Albrecht, U., and Birnstiel, M. L. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 9784-9788[Abstract/Free Full Text]
24. Gorman, L., Suter, D., Emerick, V., Schumperli, D., and Kole, R. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 4929-4934[Abstract/Free Full Text]
25. Blanck, T. J., and Peterkofsky, B. (1975) Arch Biochem. Biophys. 171, 259-267[CrossRef][Medline] [Order article via Infotrieve]
26. Hamm, J., and Mattaj, I. W. (1990) Cell 63, 109-118[CrossRef][Medline] [Order article via Infotrieve]
27. Stefanovic, B., Wittop Koning, T. H., and Schumperli, D. (1995) Nucleic Acids Res. 23, 3152-3160[Abstract/Free Full Text]
28. Stefanovic, B., Hackl, W., Luhrmann, R., and Schumperli, D. (1995) Nucleic Acids Res. 23, 3141-3151[Abstract/Free Full Text]
29. Raker, V. A., Hartmuth, K., Kastner, B., and Luhrmann, R. (1999) Mol. Cell. Biol. 19, 6554-6565[Abstract/Free Full Text]
30. Mattaj, I. W. (1986) Cell 46, 905-911[CrossRef][Medline] [Order article via Infotrieve]
31. Jacobson, M. R., Rhoadhouse, M., and Pederson, T. (1993) Mol. Cell. Biol. 13, 1119-1129[Abstract/Free Full Text]
32. Hamm, J., Darzynkiewicz, E., Tahara, S. M., and Mattaj, I. W. (1990) Cell 62, 569-577[CrossRef][Medline] [Order article via Infotrieve]
33. Hellerbrand, C., Stefanovic, B., Giordano, F., Burchardt, E. R., and Brenner, D. A. (1999) J. Hepatol. 30, 77-87[CrossRef][Medline] [Order article via Infotrieve]
34. Salgado, S., Garcia, J., Vera, J., Siller, F., Bueno, M., Miranda, A., Segura, A., Grijalva, G., Segura, J., Orozco, H., Hernandez-Pando, R., Fafutis, M., Aguilar, L. K., Aguilar-Cordova, E., and Armendariz-Borunda, J. (2000) Mol. Ther. 2, 545-551[CrossRef][Medline] [Order article via Infotrieve]
35. Imuro, Y., Nishio, T., Nitta, T., Harada, N., Yoshida, M., and Yamamoto, N. (2000) Hepatology 23, 321A[CrossRef]
36. Ueki, T., Kaneda, Y., Tsutsui, H., Nakanishi, K., Sawa, Y., Morishita, R., Matsumoto, K., Nakamura, T., Takahashi, H., Okamoto, E., and Fujimoto, J. (1999) Nat. Med. 5, 226-230[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Circ. Res.Home page
G. Buttice, J. Miller, L. Wang, and B. D. Smith
Interferon-{gamma} Induces Major Histocompatibility Class II Transactivator (CIITA), Which Mediates Collagen Repression and Major Histocompatibility Class II Activation by Human Aortic Smooth Muscle Cells
Circ. Res., March 3, 2006; 98(4): 472 - 479.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. N. Lindquist, C. J. Parsons, B. Stefanovic, and D. A. Brenner
Regulation of {alpha}1(I) Collagen Messenger RNA Decay by Interactions with {alpha}CP at the 3'-Untranslated Region
J. Biol. Chem., May 28, 2004; 279(22): 23822 - 23829.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
B. Stefanovic, L. Stefanovic, B. Schnabl, R. Bataller, and D. A. Brenner
TRAM2 Protein Interacts with Endoplasmic Reticulum Ca2+ Pump Serca2b and Is Necessary for Collagen Type I Synthesis
Mol. Cell. Biol., February 15, 2004; 24(4): 1758 - 1768.
[Abstract] [Full Text] [PDF]