![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 21, 18281-18290, May 24, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, January 31, 2002, and in revised form, March 10, 2002
Lipid A (endotoxin) is a major structural
component of Gram-negative outer membranes. It also serves as the
hydrophobic anchor of lipopolysaccharide and is a potent activator of
the innate immune response. Lipid A molecules from the genus
Bordetella are reported to exhibit unusual structural
asymmetry with respect to the acyl chains at the 3- and 3'-positions.
These acyl chains are attached by UDP-N-acetylglucosamine
acyltransferase (LpxA). To determine the origin of the acyl
variability, the single lpxA ortholog present in each of
the genomes of Bordetella bronchiseptica (lpxABr), Bordetella parapertussis
(lpxAPa), and Bordetella
pertussis (lpxAPe) was cloned and expressed in Escherichia coli. In contrast to all LpxA proteins
studied to date, LpxABr and LpxAPe display
relaxed acyl chain length specificity in vitro, utilizing
C10OH-ACP, C12OH-ACP, and C14OH-ACP
at similar rates. Furthermore, hybrid lipid A molecules synthesized at
42 °C by an E. coli lpxA mutant complemented with
lpxAPe contain C10OH,
C12OH, and C14OH at both the 3- and
3'-positions, as determined by matrix-assisted laser
desorption/ionization time-of-flight mass spectrometry. In contrast,
LpxA from B. parapertussis did not display relaxed
specificity but was selective for C10OH-ACP. This study
provides an enzymatic explanation for some of the unusual acyl chain
variations found in Bordetella lipid A.
Lipopolysaccharide
(LPS)1 is the major
glycolipid molecule present on the cell surface of Gram-negative
bacteria. Early understanding of LPS has come from studies in the
Enterobacteriaceae (1, 2). In these organisms the molecule consists of
the following three domains: the lipid A, the core oligosaccharide, and
the O-antigen polysaccharide. Lipid A, the hydrophobic anchor of LPS, is generally an acylated and phosphorylated disaccharide of glucosamine (reviewed by Rick and Raetz (3)). The structure, biosynthesis, and
biological properties of LPS have been extensively studied in a wide
variety of systems, although the molecule is best understood in
Escherichia coli (reviewed by Raetz (4)). The minimal LPS structure required for full viability of E. coli under
laboratory conditions is lipid A bearing two
2-keto-3-deoxy-D-manno-octulosonic acid (Kdo)
residues (Fig. 1). In addition,
Kdo2-lipid A, or Re endotoxin, is a fully active agonist of
the TLR-4 receptor-mediated inflammatory response (5-7).
The first step in Kdo2-lipid A biosynthesis in E. coli (Fig. 1) is the transfer of an acyl chain to the glucosamine
3-position of UDP-N-acetylglucosamine (UDP-GlcNAc). This
acylation is performed by UDP-GlcNAc acyltransferase, encoded by the
gene lpxA (8, 9). This acylated UDP-GlcNAc is then
de-acetylated at the 2-position by LpxC (10) before another primary
hydroxyacyl chain is added at this position by LpxD (11). Next UMP is
removed from a portion of the UDP-2,3-diacylglucosamine pool by LpxH
(12), before the tetra-acylated glucosamine disaccharide is formed by
LpxB (9). Kdo2-lipid A biosynthesis is
completed through 4'-phosphorylation by LpxK (13), addition of two Kdo
residues via WaaA (formerly KdtA) (14), and addition of the secondary
acyl chains by the late-acyltransferases LpxL (formerly HtrB) and LpxM
(formerly MsbB) (15, 16).
Much has been learned about LpxA since its discovery in 1986 (9). The
crystal structure of E. coli LpxA (LpxAEc) has
been determined to 2.6 Å resolution (17), and its substrate binding and active sites have been partially characterized (18, 19). LpxA is
functional as a homotrimer and has an unusual parallel The genus Bordetella contains several bacterial species,
some of which are respiratory tract pathogens. Bordetella
pertussis and Bordetella parapertussis cause whooping
cough in humans (23-27), and B. parapertussis is also found
in ovine species (28-30). Bordetella bronchiseptica infects
many mammals and is commonly associated with atrophic rhinitis in pigs,
snuffles in rabbits, and kennel cough in dogs (31-34). B. bronchiseptica has also been occasionally described as a
respiratory tract pathogen in humans (35-37). All three pathogens are
very closely related in terms of multilocus enzyme electrophoresis, DNA
hybridization, and DNA sequence analyses (38, 39). The mechanistic
basis for their different host ranges and pathogenicities are
unknown but are likely to depend on differences in surface structures
between the three pathogens.
Structural studies of the LPS molecules from the bordetellae indicate
that they share many common structural features (40-42); however,
their lipid A moieties have organism-specific acylation patterns (Fig.
2) apart from those from Bordetella
hinzii and Bordetella trematum which are identical
(43). B. bronchiseptica and B. hinzii are the
only bordetellae in which hexa-acylated lipid A is reported (44, 45).
The lipid A structures of other Bordetella species studied
to date contain fewer acyl chains and are thus likely to have reduced
endotoxin activity (46). In addition to interspecies variation,
B. bronchiseptica lipid A structures vary between strains,
with unusual fatty acyl substitutions on the diglucosamine backbone
(45). Interestingly, all reported Bordetella lipid A
structures exhibit unexpected acyl chain asymmetry between the 3- and
3'-positions. The generation of this asymmetry is not currently
understood but might involve either multiple LpxA isoforms or a single
LpxA with relaxed acyl-ACP specificity.
Relaxed Acyl Chain Specificity of Bordetella
UDP-N-acetylglucosamine Acyltransferases*
,
Department of Biochemistry, Duke University
Medical Center, Durham, North Carolina 27710, the
§ Centre for Veterinary Science, Department of Clinical
Veterinary Medicine, University of Cambridge,
Cambridge CB3 0ES, United Kingdom, and the ¶ Middle Atlantic
Mass Spectrometry Facility, Department of Pharmacology and Molecular
Sciences, The Johns Hopkins University, Baltimore, Maryland 21205
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (31K):
[in a new window]
Fig. 1.
The biosynthesis of E. coli lipid A. Nine constitutive enzymes compose
the lipid A biosynthetic pathway in E. coli. The lipid A
shown is the predominant structure. However, about one-third of
E. coli lipid A is modified by the replacement of the
1-phosphate with 1-pyrophosphate (not shown). LpxA, the first enzyme in
the pathway, acylates the glucosamine 3-position of UDP-GlcNAc,
resulting in acyl incorporation at the 3- and 3'-positions of the
mature lipid A structure.
-helical
secondary structure. Based on site-directed mutagenesis, it has been
proposed that the active site lies in a cleft between its subunits;
His-125 is proposed to serve as a general base to facilitate the direct
acyl transfer from the acyl-acyl carrier protein (ACP) to UDP-GlcNAc,
forming an ester linkage to the sugar (19). In most bacteria, LpxA is
highly specific with regard to its acyl-ACP substrate.
LpxAEc is 50-fold more active with its native substrate,
-OH myristoyl-ACP (C14OH-ACP), than with either
-OH
palmitoyl-ACP (C16OH-ACP) (20) or
-OH lauroyl-ACP (C12OH-ACP) (21); it is almost 3 orders of magnitude more
active with C14OH-ACP than with myristoyl-ACP
(C14-ACP) (22) or
-OH decanoyl-ACP
(C10OH-ACP) (21).

View larger version (32K):
[in a new window]
Fig. 2.
Reported structures of Bordetella
lipid A. The proposed structures of the predominant lipid A
molecules isolated from B. bronchiseptica NRCC 4650, 4170, and 4175 (45), B. parapertussis (59), and B. pertussis (58) are shown. These structures are unusual in that
they are reported to contain different acyl chains at the 3- and
3'-positions. The E. coli structure is shown for comparison.
Numbers at the bottom of the structure indicate the length
of the acyl chains.
In this work, we demonstrate that a single lpxA gene is
present in each of the genomes of B. pertussis, B. bronchiseptica, and B. parapertussis. The presence of a
single lpxA gene in each organism despite the asymmetry of
the primary ester-linked acyl residues suggested that these bacteria
have a single UDP-GlcNAc O-acyltransferase of relaxed
substrate specificity. We have overexpressed these genes in E. coli and have assayed extracts of these constructs to examine this
hypothesis. B. pertussis LpxA (LpxAPe) and
B. bronchiseptica LpxA (LpxABr) transfer
C10OH, C12OH, and C14OH acyl
moieties from acyl-ACP to UDP-GlcNAc. However, both enzymes utilize
C10OH-ACP and C14OH-ACP in 2-fold preference to
C12OH-ACP. In contrast, B. parapertussis LpxA
(LpxAPa) displays a strong preference for
C10OH-ACP over all other acyl-ACPs tested.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials--
All growth media were purchased from Difco,
Oxoid, or Mallinckrodt Chemical Works. Bacteria bearing plasmid DNA
were selected using ampicillin at 100 µg/ml. Ampicillin, acyl carrier
protein, fatty acids, and (RS)-
-hydroxylated fatty acids,
glucosamine 1-phosphate, and standard chemicals were purchased from
Sigma. PerkinElmer Life Sciences was the source for radiolabeled
[
-32P]UTP. Silica Gel 60 thin layer plates (0.25 mm)
were purchased from Merck. T4 ligase and preparative grade
phenol/chloroform/isoamyl alcohol (25:24:1, v/v) were from Invitrogen.
DNA restriction endonucleases and other modifying enzymes were bought
from Roche Molecular Biochemicals or New England Biolabs. The LpxC
inhibitor L-573,655 was provided by Dr. A. Patchett (Merck) (47).
Plasmid DNA was purified with Qiagen spin columns and DNA fragments
were gel-purified using the Qiagen Qiaquick Gel Extraction purification kit.
Bacterial Strains and Plasmids-- The strains and plasmids used in this work are shown in Table I. B. pertussis BP536 is a streptomycin-resistant derivative of Tohama I (48). B. bronchiseptica RB50 has been described previously (49). B. parapertussis 12822a is a streptomycin-resistant derivative of 12822. Strain 12822 was isolated from an infant with persistent cough in Germany (a kind gift from U. Heininger). Whole genome sequencing of Tohama I, RB50, and 12822 is currently in progress (www.sanger.ac.uk). E. coli XL1-Blue (Stratagene) was used for cloning and maintenance of pUC plasmids. E. coli BL21(DE3)pLysS (Invitrogen) was used for overexpression of cloned genes. The plasmid pUC18 was used as a general cloning vector. pET21a (Stratagene) was used to overexpress lpxA genes. The E. coli conditional mutant RO138 (lpxA2 recA rpsL Tetr) was provided by Dr. M. Anderson (Merck). RO138 is a recA derivative of SM101 (50, 51), and pBluescript II SK+ (Stratagene) was used to express the genes in R0138. Bordetella strains were grown on BG agar supplemented with 15% defibrillated horse blood and streptomycin (200 µg/ml). E. coli strains were grown on LB agar or in LB broth (pH 7.4).
|
PCR Cloning of LpxA Genes-- To prepare a genomic DNA template, plate-grown bacterial culture was resuspended in 0.5 ml of water, boiled in a water bath for 5 min, and centrifuged at top speed in a bench top microcentrifuge for 2 min. A 0.2-ml sample of supernatant was then recovered. PCR was performed using 1 µl of this supernatant. Each 50-µl PCR was composed of genomic DNA template, buffer as directed by the manufacturer, dNTPs (25 mM each), 20 ng of each primer, 5% (v/v) Me2SO, 5 mM MgCl2, and 2.5 units of polymerase. lpxABr was amplified using Pwo polymerase (Roche Molecular Biochemicals). lpxAPe and lpxAPa were amplified using Vent polymerase (New England Biolabs). The same primers were used for all three species as the sequences are identical in this region. The primers used were 5' TTTTTTCATATGTCAGGAAACATCCAT 3' (N terminus) and 5' TTTTTTAAGCTTTCATGGCCGGATGATG 3'. The N-terminal primer incorporated an NdeI site, and the C-terminal primer incorporated an HindIII site for subsequent cloning into pET21a. PCR was performed on a PerkinElmer Life Sciences 9600 automated cycler. A 5-min denaturing step at 94 °C was followed by 30 cycles of 94 (75 s), 55 (75 s), and 72 °C (120 s) with a final elongation step of 72 °C for 7 min. PCRs were treated with the Klenow fragment of DNA polymerase and T4 polynucleotide kinase with the addition of 1 mM ATP for 30 min at 37 °C to create blunt ends and to 5'-phosphorylate PCR products. These enzymes were then inactivated by heat denaturation at 65 °C for 30 min. PCRs were then analyzed by agarose gel electrophoresis prior to gel purification and cloning.
Purified products were cloned into pUC18 using the Ready-to-GoTM system (Amersham Biosciences) and then subcloned into pET21a (Novagen) for protein expression. lpxAPe was also subcloned from pET21a into pBluescript II SK+ (Stratagene) for constitutive expression in E. coli. This pBluescript construct was transformed into RO138 for complementation and hybrid lipid A isolation. DNA was sequenced using an automated sequencer at the Department of Genetics, University of Cambridge, using universal M13 forward and reverse primers and the lpxA-specific primers: 5' GAGCAAAAGCGGTAGAAG 3'; 5' ACTGGTCATCGGCGACCG 3'; 5' GATCTTGGCGAACTGGTG 3'; and 5'GTCAATGTCGAAGGCTTG 3'. Additional DNA sequencing was performed by Duke University DNA Analysis Facility on an Applied Biosystems 377 instrument using Novagen T7 promoter and terminator primers. DNA sequence was analyzed using the GCG software package (Wisconsin Package version 10.0, Genetics Computer Group, Madison, WI).
Overexpression of Cloned Genes--
To screen for overexpressing
clones, BL21 (DE3) pLysS cultures carrying the relevant pET construct
were grown to A600 = 0.4. Expression was induced
by addition of isopropyl-
-D-thiogalactoside to a
concentration of 1 mM and incubation at 37 °C for 4 h. Overexpression was confirmed by running a portion of the induced
culture on 12% SDS-PAGE gels followed by Coomassie Blue staining (52).
Non-induced cultures and cultures carrying pET vector alone acted as
controls to demonstrate that the overexpressed proteins observed were
dependent on induction and the presence of a cloned lpxA
gene. To prepare cell lysates containing overexpressed
Bordetella LpxA for use in assays, expression cultures were
grown at 37 °C in 50 ml of LB broth containing 100 µg/ml
ampicillin to an A600 = 0.6, induced with
isopropyl-
-D-thiogalactoside, and grown for a further
3 h. At the end of this period, the cultures were chilled on ice for 10 min and then harvested by centrifugation at 4000 × g at 4 °C for 10 min. The cell pellets were resuspended
in 10 ml of ice-cold buffer (sterile 100 mM potassium
phosphate at pH 7.0 with 200 mM NaCl and 20% glycerol) per
50 ml of original culture, and the cells were centrifuged again at
4000 × g at 4 °C for 10 min. Each washed cell
pellet was resuspended in 2 ml of the same buffer and frozen at
20 °C overnight. The cells were then thawed on ice and broken by
one passage through a French pressure cell at 14,000 pounds/square
inch. The cell lysates were centrifuged at 10,000 × g
for 20 min at 4 °C to remove cellular debris, and the supernatants
(extracts) were collected and stored at
80 °C. Before use in the
activity assays, the protein concentrations of these extracts were
quantified using the Pierce bicinchoninic acid assay kit (53). The data
were collected using a Molecular Devices SpectraMax 250 plate reader
and analyzed relative to a bovine serum albumin standard with the
software package Softmax Pro. The extracts were also characterized by
SDS-PAGE (Bio-Rad mini-protean system) to assess the extent of LpxA overproduction.
Substrate Preparation and in Vitro Assay Conditions--
The
[
-32P]UDP-GlcNAc and all acyl-ACP substrates were
prepared as described previously (21), with the addition, as necessary, of an octyl-Sepharose column step to remove residual ACP from the
acyl-ACP preparations. The purity of these acyl donors was verified by
urea gel electrophoresis (data not shown). The LpxA assay follows the
conversion of [
-32P]UDP-GlcNAc to
[
-32P]UDP-(3-O-acyl)-GlcNAc based on a
mobility shift during TLC on a silica plate (21, 54). Each 10-µl
reaction contained 40 mM HEPES, pH 8.0, 1 mg/ml bovine
serum albumin, 0.2 mg/ml L-573,655, 10 µM of one or more
acyl donors (as indicated), 10 µM UDP-GlcNAc, [
-32P]UDP-GlcNAc (2 × 105
dpm/reaction), and an appropriate amount of cell-free lysate extract.
L-573,655 prevents the further metabolism of the LpxA reaction product
by inhibition of LpxC (47). The assays were carried out at 30 °C,
and time points were analyzed by spotting 1-µl portions of each
reaction mixture onto a silica gel TLC plate. The plate was developed
in chloroform/methanol/water/acetic acid (25:15:4:2, v/v) and analyzed
by PhosphorImager (Molecular Dynamics Storm 840 system), using
Molecular Dynamics ImageQuant 1.2 for Macintosh. Data were analyzed
statistically using Microsoft Excel 2001 and plotted by Abelbeck
Kaleidagraph 3.0.5.
Purification and Analysis of Hybrid Lipid A Species-- For structural studies, hybrid lipid A species were isolated and partially purified from an E. coli lpxA2 mutant complemented with LpxAPe. This strain, RO138/pCS561, was grown for 16 h (to stationary phase) at 42 °C in 80 ml of LB with 100 µg/ml ampicillin and 12 µg/ml tetracycline. Extraction, hydrolysis at pH 4.5, and lipid A purification by DE52 chromatography were carried out according to techniques described previously (22).
Mass Spectrometry of Hybrid Lipid A Species--
Spectra were
acquired in the negative ion and positive ion linear modes by using a
Kratos Analytical (Manchester, UK) matrix-assisted laser
desorption/ionization time of flight (MALDI/TOF) mass spectrometer, equipped with a 337 nm nitrogen laser, a 20-kV extraction voltage, and
time-delayed extraction. Each spectrum was the average of 50 shots. The
matrix was a mixture of saturated 5-aza-2-thiothymine in 50% aqueous
acetonitrile and 10% tribasic ammonium citrate (9:1 v/v). The lipid A
samples were prepared by solubilizing the lipid in 4:1 v/v
chloroform/methanol and then depositing 0.3 µl of the sample,
followed by 0.3 µl of matrix, which was allowed to dry at room
temperature prior to mass analysis. E. coli lipid A (Sigma)
was used as an external standard.
| |
RESULTS |
|---|
|
|
|---|
Identification and Cloning of Bordetella LpxA Genes--
To
identify Bordetella lpxA genes, genome sequence data were
searched for similarities to E. coli LpxA, using tBLASTn run on the Sanger Centre blast server. This identified two open reading frames with similarity to E. coli lpxA in each of
B. pertussis, B. bronchiseptica, and B. parapertussis. Further BLAST searches of GenBankTM
databases with these open reading frames revealed one to be the Bordetella lpxA gene (Fig.
3) and the other to be lpxD,
the UDP-3-O-((3R)-hydroxymyristoyl)-glucosamine N-acyltransferase (data not shown). Both open reading frames
were present in the same sequence contig in all three species. As in many other Gram-negative species, these genes are arranged as follows:
lpxD, fabZ (encoding
(R)-3-hydroxymyristoyl-ACP dehydratase), lpxA,
and lpxB (55), within macromolecular biosynthesis operon II
(56) of the bordetellae.
|
The predicted amino acid sequences of the three Bordetella LpxAs are 53% identical and 67% similar to that of E. coli lpxA and are nearly identical to each other. At position 170, LpxAPa contains serine, whereas the other two contain glycine; at position 229, LpxAPe contains glycine, whereas the other two contain alanine. Thus LpxAPe and LpxABr differ from one another at a single residue; LpxABr and LpxAPa differ from each other at a single residue, and LpxAPe and LpxAPa differ from each other at two residues.
The serine in position 170 of LpxAPa is particularly important, as it is analogous to the highly conserved residue Gly-173 in LpxAEc, which is involved in regulation of acyl chain length (18). In Pseudomonas aeruginosa LpxA (LpxAPs), this glycine is replaced by methionine, resulting in a C10OH-ACP-specific enzyme. Furthermore, LpxAEc G173M is specific for C10OH-ACP, and LpxAPs M169G selectively incorporates C14OH-ACP (18). The presence of serine in this position in LpxAPa predicts that this enzyme will utilize short acyl chain substrates in preference to long ones, as there appears to be a reciprocal relationship between the size of the amino acid at this position and the length of the acyl chain substrate that can be accommodated in the active site cleft.
To investigate the substrate specificity of these enzymes, the B. bronchiseptica, B. pertussis, and B. parapertussis lpxA genes were cloned into pUC18. Three sequenced constructs were designated pAP1, pAP5, and pAP6, respectively. The genes were then subcloned from pUC18 into the expression vector pET21a, and verified clones in this vector were labeled pAP10, pAP50, and pAP60, respectively. These constructs were then transformed into E. coli BL21 DE3 (pLysS) to allow expression of the lpxA genes from the T7 promoter of pET21a. A clone that gave high level, inducible expression of a protein matching the predicted molecular weight of Bordetella LpxA was obtained for each of the three LpxA enzymes (data not shown).
To study the ability of Bordetella LpxA to complement an E. coli conditional mutant, lpxAPe was subcloned into pBluescript II SK+. The positive clone used herein was designated pCS561. This plasmid construct was transformed into RO138 for in vivo studies.
In Vitro Acyl Transfer Assays of the Three LpxAs--
Cell-free
extracts of the BL21 cultures were prepared and assayed for the
ability to acylate UDP-GlcNAc, using pools of acyl-ACPs or
-OH
acyl-ACPs. Each pool consisted of 10 µM each of 10-, 12-, 14-, and 16-carbon chain length acyl ACPs. All three LpxA proteins have
high catalytic activity with at least one of the eight acyl donors
tested (Fig. 4). Two of them,
LpxABr and LpxAPe, have significant catalytic
activity with three of the acyl donors. This is the first report of an
LpxA capable of efficiently acylating UDP-GlcNAc with more than one
acyl chain.
|
To determine the acyl specificity of all three Bordetella
LpxAs, a data set was gathered for each enzyme with each acyl donor (Fig. 5). All of the data reported below
were derived from several independent assays over a range of extract
concentrations (5-100 µg/ml). Error is expressed as standard
deviation in these experiments.
|
Acyl Selectivity of Extracts Containing Overexpressed
LpxABr and LpxAPe--
The specific activity
of extracts containing LpxABr is 1100 ± 200 (pmol/min)/mg of total cell-free extract protein with
C10OH-ACP (n = 6), 470 ± 67 (pmol/min)/mg with C12OH-ACP (n = 6),
1000 ± 110 (pmol/min)/mg with C14OH-ACP
(n = 6), and 7.5 ± 0.19 (pmol/min)/mg with
palmitoyl-ACP (n = 2). Likewise, the specific activity
of LpxA from extracts expressing LpxAPe is 870 ± 150 (pmol/min)/mg with C10OH-ACP (n = 6),
350 ± 45 (pmol/min)/mg with C12OH-ACP (n = 6), 790 ± 86 (pmol/min)/mg with
C14OH-ACP (n = 5), and 5.9 ± 0.72 (pmol/min)/mg with C16OH-ACP (n = 2). The
endogenous LpxAEc background activity with
C14OH-ACP (
20 (pmol/min)/mg) is negligible in comparison
to that of extracts bearing LpxABr and
LpxAPe.
Acyl Selectivity of Extracts Containing Overexpressed LpxAPa-- Unlike LpxA from the other two Bordetella species, LpxAPa only shows in vitro activity with two acyl donors. The specific activity of this enzyme extract with C10OH-ACP is 590 ± 100 (pmol/min)/mg (n = 5) and with C12OH-ACP it is 15 ± 3.4 (pmol/min)/mg (n = 2). The minor activity with C12OH-ACP is similar to the activity of LpxABr, LpxAPe, and LpxAEc with C16OH-ACP and is most likely too low to be physiologically relevant. LpxAPa extracts have no activity with C14OH-ACP over endogenous E. coli activity.
None of the Bordetella LpxA proteins display any measurable activity (limit of detection <1 (pmol/min)/mg) with any non-hydroxylated (normal) acyl donor, even at high (0.5 mg/ml) extract concentrations and long (1 h) time points.
Complementation of RO138 with lpxAPe and Isolation of Hybrid Lipid A Species-- To study possible intracellular modulation of Bordetella LpxA activity, LpxAPe was used to complement the E. coli lpxA2 conditional mutant, RO138. This mutant, LpxAEc G189S, is temperature-sensitive for both lipid A biosynthesis and viability. RO138 complemented with pCS561 displayed wild-type colony morphology and growth rate on LB plates and in liquid LB medium at both the permissive temperature (30 °C) and the non-permissive temperature (42 °C) (data not shown).
Based on the in vitro assay results, the hybrid lipid A structures formed by the complemented mutants were expected to contain C10OH, C12OH, and C14OH acyl chains at the 3- and/or 3'-positions. It was possible, however, that the E. coli lipid A biosynthetic apparatus might generate asymmetric structures or exclude one or more of these acyl chains. To identify the acyl chains being incorporated by LpxAPe, the hybrid lipid A pool was isolated from this strain when grown at 42 °C and analyzed by thin layer chromatography. Similar to wild-type lipid A (4), the lipid A profile of this strain shows two fractions that differ in charge. The predominant fraction is hexa-acyl lipid A 1-monophosphate (as shown in Figs. 1 and 2), whereas the less abundant fraction is hexa-acyl lipid A 1-pyrophosphate (not shown).
Negative Ion MALDI/TOF Mass Spectrometry of Lipid A
Species in R0138/pCS561--
The negative mode
spectrum of the purified lipid A 1-monophosphate pool shows five
molecular ions [M
H]
, at m/z 1798.0, 1770.7, 1742.4, 1714.0, and 1686.4 (Fig.
6 and Table
II). These peaks are attributed to
wild-type E. coli lipid A (Mr
1798.4), and a series of variants showing the loss of 2, 4, 6, or 8 methylene units, respectively. These data suggest that the complemented
mutant synthesizes lipid A molecules with
C14OH/C14OH, C12OH/C14OH,
C12OH/C12OH, and/or
C10OH/C14OH,
C10OH/C12OH, and C10OH/C10OH acyl chains, respectively, in the
primary ester-linked (3- and 3')-positions (Fig.
7).
|
|
|
Positive Ion MALDI/TOF Mass Spectrometry of Lipid A Species in
RO138/pCS561--
To characterize these lipid A structures further,
positive mode MALDI/TOF spectrometry was also performed. In this
experiment, the three main peak clusters seen in the spectra are
interpreted as the [M + Na]+ series, the B1+
fragment series, and the B2+ fragment series (Fig.
8 and Table II) (57). The B1+
fragment arises from the distal (non-reducing) sugar moiety after cleavage of the glycosidic linkage between sugars. The B2+
fragment arises from loss of the 1-phosphate moiety from the anomeric
carbon. The [M + Na]+ peaks are seen at
m/z 1822.1, 1792.5, 1764.1, 1736.2, and
1707.6. The corresponding B2+ peaks have values of
m/z 1700.0, 1671.8, 1644.3, 1616.4, and 1588.5 (Fig.
9A and Table II). Like the
negative mode data, both of these sets of peaks strongly support the
existence of a set of at least five molecular species, with
C10OH, C12OH, or C14OH acyl chains
attached at the 3- and 3'-positions in a combinatorial manner (see
above). Furthermore, the positive mode spectrum of this fraction
displays three B1+ ions, with values of
m/z 1087.4, 1060.0, and 1031.5 (Fig.
9B and Table II), corresponding to B1+ ions
bearing C10OH, C12OH, or C14OH acyl
chains. These data confirm that all three expected acyl chain lengths
are incorporated into the distal sugar, which means that these three,
and only these three, acyl chains must also be present at the proximal
sugar, in order to arrive at the five primary ion masses observed
(Figs. 6-9).
|
|
MALDI/TOF analysis of the lipid A 1-pyrophosphate fraction was
complicated by low sample mass and contamination by lipid A 1-monophosphate. However, these spectra (not shown) are consistent with
the proposed acylation pattern (Fig. 7).
| |
DISCUSSION |
|---|
|
|
|---|
An interesting feature of Bordetella lipid A is that the acyl chains present at the 3- and 3'-positions are reported to differ (58) (Fig. 2). This is in contrast to most other lipid A molecules, in which the acyl chains present at these positions are identical, as they are derived from a single enzyme, LpxA. The asymmetric nature of the acyl chains at the 3- and 3'-positions of Bordetella lipid A structures suggested two hypotheses as follows: either these bacteria have two LpxA proteins with different acyl donor specificities, or a single LpxA that has reduced specificity for its acyl-ACP substrates. Either scenario is in contrast to previous studies that demonstrate other bacteria, including E. coli (20) Neisseria meningitidis (21), P. aeruginosa (18), Chlamydia trachomatis (22), and Helicobacter pylori2 have a single lpxA gene, which encodes a protein of high specificity for a single acyl-ACP substrate.
DNA sequencing of the B. pertussis genome is now complete (www.sanger.ac.uk/Projects/B_pertussis/). Those of B. bronchiseptica and B. parapertussis are nearing completion. In all three genome sequences, a single lpxA gene was identified, arguing against the existence of multiple alleles. The data presented here now demonstrate that the second scenario, in which a single LpxA has relaxed substrate specificity, is indeed correct. These results, however, do not entirely support the reported lipid A structures (43).
In both individual and multiple substrate assays, B. bronchiseptica and B. pertussis LpxA have significant activity with three acyl donors, C10OH-ACP, C12OH-ACP, and C14OH-ACP. Both enzymes show 2-fold preferences for C10OH-ACP and C14OH-ACP over C12OH-ACP. In the case of B. pertussis, this activity correlates well with the reported structure, which contains both C10OH and C14OH acyl chains at glucosamine 3-positions (58). However, some additional level of acyl control must act upon LpxA in vivo in B. pertussis, as C12OH is not incorporated at the 3- or 3'-position in B. pertussis lipid A.
Similarly, in B. bronchiseptica, only C12OH and C14OH are reported to be present in the 3- and 3'-positions of the lipid A (58). The ability of the enzyme to incorporate C10OH in vitro suggests that in this organism as well there must be some additional aspect of acyl substrate control, which is not suitably re-created in the assay. For example, it is possible that in B. bronchiseptica, levels of C10OH-ACP are low compared with C12OH-ACP and C14OH-ACP and that this excludes incorporation of C10OH into lipid A. A similar pool-size effect could limit C12OH-ACP usage in B. pertussis. It is unlikely that the unexpected utilization of additional acyl ACPs by these enzymes is purely an artifact of the in vitro assay design or kinetics, as the mass spectrometry data from complemented E. coli lpxA2 show that LpxAPe also incorporates C12OH-ACP efficiently in E. coli. In both the in vitro assay and the complementation however, the Bordetella LpxAs must use E. coli ACP. Although this has not been a problem in previous studies of other LpxAs (18, 21, 22), it is possible that in this case the heterologous nature of these studies causes altered substrate presentation to LpxA, altering the substrate specificity.
There is also a discrepancy between the reported structure of B. parapertussis and the assays results. In vitro, LpxAPa prefers C10OH-ACP 40-fold over C12OH-ACP and does not utilize C14OH-ACP or any non-hydroxylated (normal) acyl donors. This is in agreement with the presence of serine at the putative chain length determining position, which predicts that LpxAPa should only utilize short chain length acyl donors (18). It has been reported, however, that B. parapertussis contains a non-hydroxylated C16 acyl chain at the 3-position (59). Furthermore, one strain of B. bronchiseptica has been reported to bear a non-hydroxylated C12 acyl chain at the 3-position (58), whereas no C12-ACP utilization was observed in the in vitro assay with LpxABr. It is possible that these differences between the structural data (Fig. 2) and enzymatic data (Fig. 5) represent real strain differences in these species; B. pertussis 536, B. bronchiseptica RB50, and B. parapertussis 12822a may have different acylation patterns from those strains for which structural data was determined (B. bronchiseptica NRCC 4170, 4175, and 4650; B. pertussis 1414, A100, and L84; and B. parapertussis ATCC 15989 and 15311). This hypothesis is currently under investigation in collaboration with Dr. M. Caroff of the Université de Paris-Sud, Orsay, France. It may also prove fruitful to examine the structure of these lipids with an independent method, such as NMR, which would provide more information about the nature and location of the acyl substituents.
The fact that at least two Bordetella LpxAs utilize more than one acyl substrate presents another conundrum, namely the asymmetric structural distribution of the varied acyl chains in the bordetellae. In B. pertussis, for example, UDP-GlcNAc is acylated with both C10OH and C14OH, yet all of the C10OH is reported to be present on the proximal sugar of the molecule and all of the C14OH on the distal sugar. This suggests that LpxH and/or LpxB are capable of discriminating between different acyl chains at the 3-position of UDP-2,3-diacylglucosamine (Fig. 1) and that these substrate specificities result in the asymmetric distribution observed in vivo. This effect has been demonstrated previously in E. coli when the lipid A biosynthesis pathway is presented with more than one UDP-2,3-diacylglucosamine (UDP-DAG) species (22). When E. coli lpxA2 was complemented with C. trachomatis lpxA, growth conditions could be manipulated such that the complemented mutant would produce 3-O-C14OH-UDP-DAG and 3-O-C14-UDP-DAG simultaneously. Under these conditions, the E. coli lipid A biosynthetic machinery always placed the fully hydroxylated species (25% of total UDP-DAG pool) at the distal end of the molecule, where it would then be available for the addition of the sixth acyl chain by LpxM (Fig. 1).
Unlike the hypothesized mechanism in the bordetellae, however, E. coli LpxH and/or LpxB are not capable of discriminating chain length; all three acyl chains incorporated into the hybrid lipid A of RO138/pCS561 were found in roughly equal proportions at both the 3- and 3'-positions. There is evidence, however, for asymmetric acyl distribution at the 3- and 3'-positions of the lipid A of Shigella sonnei, Porphorymonas gingivalis, and Rhodobacter capsulatis (60), which lends additional credence to the general hypothesis that downstream enzymes in the pathway are capable of generating asymmetric distribution. At this time, little is known about the substrate specificity of these enzymes in any system, or the mechanism by which they effect this control.
The biological roles and consequences of these unusual asymmetric acylation patterns of Bordetella lipid A are also unclear. The bordetellae are regarded as non-systemic pathogens, which do not usually produce fever following infection. However, Bordetella LPS displays in vitro many of the properties typical of other endotoxins that have identical acyl chains at the 3- and 3'-positions (42, 61, 62), suggesting that identical chains at these positions are not required for typical endotoxic stimulation of the inflammatory response. Studies have also demonstrated B. pertussis LPS to have less potent endotoxin activity than E. coli LPS in some assays, such as induction of interleukin-6 expression from human blood monocytes (63). Thus, it is possible that the short acyl chain present in, and/or asymmetric acylation of, B. pertussis lipid A may modulate certain activities of the LPS. However, it has been widely established that penta-acyl lipid A structures, such as the one found in B. pertussis, have greatly reduced endotoxicity and may be antagonists in some species, including humans. Therefore, it is possible that the asymmetric acyl structure has some other role in Bordetella biology.
Although there are many similarities in the pathogenesis of B. pertussis, B. bronchiseptica, and B. parapertussis, there are differences in host specificity, severity
of disease, and length of carriage of the bacteria (64). It is tempting
to speculate that LPS structure may contribute to these differences,
but this remains to be investigated. Further study of
Bordetella lipid A structure and biosynthesis may facilitate
a greater understanding of the role of lipid A in the pathology of
Bordetella, as well as the biology of Gram-negative bacteria
in general. These studies may also illuminate the biological function
of the curious acyl asymmetry of Bordetella as well as the
mechanism by which it is generated. Furthermore, continued study of the
substrate specificity of these LpxAs may yield better understanding of
its molecular mechanism, which remains poorly characterized.
| |
FOOTNOTES |
|---|
* This work was supported in part by National Institutes of Health Grants GM51310 (to C. R. H. R.) and GM54882 (to R. J. C.), by National Institutes of Health Training Grant GM08558 in Biological Chemistry to Duke University (to C. R. S.), and by Wellcome Trust (UK) Program Grant 054588 (to D. J. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
919-684-5326; Fax: 919-684-8885; E-mail: raetz@biochem.duke.edu.
Published, JBC Papers in Press, March 11, 2002, DOI 10.1074/jbc.M201057200
2 C. R. Sweet, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: LPS, lipopolysaccharide; ACP, acyl carrier protein; MALDI/TOF, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry; Kdo, 2-keto-3-deoxy-D-manno-octulosonic acid; UDP-DAG, UDP-2,3-diacylglucosamine.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Luderitz, O., G, C., Risse, H. J., Ruschmann, E., Schlecht, S., Schmidt, G., Shulte-Holthausen, H., Wheat, R., and Westphal, O. (1966) Ann. N. Y. Acad. Sci. 133, 349-374[Medline] [Order article via Infotrieve] |
| 2. | Westphal, O., Jann, K., and Himmelspach, K. (1983) Prog. Allergy 33, 9-39[Medline] [Order article via Infotrieve] |
| 3. | Rick, P. D., and Raetz, C. R. H. (1999) in Endotoxin in Health and Disease (Brade, H. , Opal, S. M. , Vogel, S. N. , and Morrison, D. C., eds) , pp. 283-304, Marcel Dekker, Inc., New York |
| 4. | Raetz, C. R. H. (1996) in Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C., ed), Vol. 1 , pp. 1035-1063, American Society for Microbiology, Washington, D. C. |
| 5. | Wyckoff, T. J. O., Raetz, C. R. H., and Jackman, J. E. (1998) Trends Microbiol. 6, 154-159[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Rietschel, E. T., Kirikae, T., Schade, F. U., Mamat, U., Schmidt, G., Loppnow, H., Ulmer, A. J., Zähringer, U., Seydel, U., Di, Padova, F., Schreier, M., and Brade, H. (1994) FASEB J. 8, 217-225[Abstract] |
| 7. | Galanos, C., Lüderitz, O., Rietschel, E. T., Westphal, O., Brade, H., Brade, L., Freudenberg, M., Schade, U., Imoto, M., Yoshimura, H., Kusumoto, S., and Shiba, T. (1985) Eur. J. Biochem. 148, 1-5[Medline] [Order article via Infotrieve] |
| 8. |
Coleman, J.,
and Raetz, C. R. H.
(1988)
J. Bacteriol.
170,
1268-1274 |
| 9. |
Crowell, D. N.,
Anderson, M. S.,
and Raetz, C. R. H.
(1986)
J. Bacteriol.
168,
152-159 |
| 10. |
Young, K.,
Silver, L. L.,
Bramhill, D.,
Cameron, P.,
Eveland, S. S.,
Raetz, C. R. H.,
Hyland, S. A.,
and Anderson, M. S.
(1995)
J. Biol. Chem.
270,
30384-30391 |
| 11. |
Kelly, T. M.,
Stachula, S. A.,
Raetz, C. R. H.,
and Anderson, M. S.
(1993)
J. Biol. Chem.
268,
19866-19874 |
| 12. | Babinski, K. J., and Raetz, C. R. H. (1998) FASEB J. 12, A1288 |
| 13. |
Garrett, T. A.,
Kadrmas, J. L.,
and Raetz, C. R. H.
(1997)
J. Biol. Chem.
272,
21855-21864 |
| 14. |
Clementz, T.,
and Raetz, C. R. H.
(1991)
J. Biol. Chem.
266,
9687-9696 |
| 15. |
Clementz, T.,
Bednarski, J. J.,
and Raetz, C. R. H.
(1996)
J. Biol. Chem.
271,
12095-12102 |
| 16. |
Clementz, T.,
Zhou, Z.,
and Raetz, C. R. H.
(1997)
J. Biol. Chem.
272,
10353-10360 |
| 17. |
Raetz, C. R. H.,
and Roderick, S. L.
(1995)
Science
270,
997-1000 |
| 18. |
Wyckoff, T. J. O.,
Lin, S.,
Cotter, R. J.,
Dotson, G. D.,
et al..
(1998)
J. Biol. Chem.
273,
32369-32372 |
| 19. |
Wyckoff, T. J. O.,
and Raetz, C. R. H.
(1999)
J. Biol. Chem.
274,
27047-27055 |
| 20. |
Anderson, M.,
and Raetz, C. R. H.
(1987)
J. Biol. Chem.
262,
5159-5169 |
| 21. |
Odegaard, T. J.,
Kaltashov, I. A.,
Cotter, R. J.,
Steeghs, L.,
van der Lry, P.,
Khan, S.,
Maskell, D. J.,
and Raetz, R. H.
(1997)
J. Biol. Chem.
272,
19688-19696 |
| 22. |
Sweet, C. R.,
Lin, S.,
Cotter, R. J.,
and Raetz, C. R. H.
(2001)
J. Biol. Chem.
276,
19565-19574 |
| 23. | Cherry, J. D. (1992) Vaccine 10, 1033-1038[CrossRef][Medline] [Order article via Infotrieve] |
| 24. | Cherry, J. D. (1996) J. Infect. Dis. 174, S259-S263 |
| 25. | Heininger, U., Stehr, K., Schmittgrohe, S., Lorenz, C., Rost, R., Christenson, P. D., Uberall, M., and Cherry, J. D. (1994) Pediatr. Infect. Dis. J. 13, 306-309[Medline] [Order article via Infotrieve] |
| 26. | Nennig, M. E., Shinefield, H. R., Edwards, K. M., Black, S. B., and Fireman, B. H. (1996) J. Am. Med. Assoc. 275, 1672-1674[Abstract] |
| 27. | Pichichero, M. E., and Treanor, J. (1997) Arch. Pediatr. Adolesc. Med. 151, 35-40[Abstract] |
| 28. | Porter, J. F., Connor, K., and Donachie, W. (1994) Microbiology 140, 255-261[Medline] [Order article via Infotrieve] |
| 29. | Porter, J. F., Connor, K., Vanderzee, A., Reubsaet, F., Ibsen, P., Heron, I., Chaby, R., Leblay, K., and Donachie, W. (1995) FEMS Microbiol. Lett. 132, 195-201[CrossRef][Medline] [Order article via Infotrieve] |
| 30. | Porter, J. F., Connor, K., and Donachie, W. (1996) FEMS Microbiol. Lett. 135, 131-135[CrossRef][Medline] [Order article via Infotrieve] |
| 31. |
Burns, E. H., Jr.,
Norman, J. M.,
Hatcher, M. D.,
and Bemis, D. A.
(1993)
J. Clin. Microbiol.
31,
1838-1844 |
| 32. | Rutter, J. M. (1981) Vet. Rec. 108, 451-454[Abstract] |
| 33. | Thrusfield, M. V., Aitken, C. G. G., and Muirhead, R. H. (1991) J. Small Anim. Pract. 32, 455-459 |
| 34. | Thrusfield, M. V., Aitken, C. G. G., and Muirhead, R. H. (1991) J. Small Anim. Pract. 32, 215-220 |
| 35. | Gueirard, P., Weber, C., Lecoustumier, A., and Guiso, N. (1995) J. Clin. Microbiol. 33, 2002-2006[Abstract] |
| 36. | Reina, J., Bassa, A., Llompart, I., Borrell, N., Gomez, J., and Serra, A. (1991) Infection 19, 46-48[CrossRef][Medline] [Order article via Infotrieve] |
| 37. | Tamion, F., Girault, C., Chevron, V., Pestel, M., and Bonmarchand, G. (1996) Scand. J. Infect. Dis. 28, 197-198[Medline] [Order article via Infotrieve] |
| 38. |
van der Zee, A.,
Mooi, F.,
Van Embden, J.,
and Musser, J.
(1997)
J. Bacteriol.
179,
6609-6617 |
| 39. | Stibitz, S., Aaronson, W., Monack, D., and Falkow, S. (1989) Nature 338, 266-269[CrossRef][Medline] [Order article via Infotrieve] |
| 40. | Lebbar, S., Caroff, M., Szabo, L., Merienne, C., and Szilogyi, L. (1994) Carbohydr. Res. 259, 257-275[CrossRef][Medline] [Order article via Infotrieve] |
| 41. |
Caroff, M.,
Chaby, R.,
Karibian, D.,
Perry, J.,
Deprun, C.,
and Szabo, L.
(1990)
J. Bacteriol.
172,
1121-1128 |
| 42. | Chaby, R., and Caroff, M. (1988) in Pathogenesis and Immunity in Pertussis (Wardlaw, A. C. , and Parton, R., eds) , pp. 247-271, John Wiley & Sons, Inc., New York |
| 43. | Caroff, M., Aussel, L., Zarrouk, H., Martin, A., et al.. (2001) J. Endotoxin Res. 7, 63-68[CrossRef] |
| 44. | Aussel, L., Brisson, J. R., Perry, M. B., and Caroff, M. (2000) Rapid Commun. Mass Spectrom. 14, 595-599[CrossRef][Medline] [Order article via Infotrieve] |
| 45. |
Zarrouk, H.,
Karibian, D.,
Bodie, S.,
Perry, M. B.,
Richards, J. C.,
and Caroff, M.
(1997)
J. Bacteriol.
179,
3756-3760 |
| 46. | Khan, S. A., Everest, P., Servos, S., Foxwell, N., Zahringer, U., Brade, H., Rietschel, E. T., Dougan, G., Charles, I. G., and Maskell, D. J. (1998) Mol. Microbiol. 29, 571-579[CrossRef][Medline] [Order article via Infotrieve] |
| 47. |
Onishi, H. R.,
Pelak, B. A.,
Gerckens, L. S.,
Silver, L. L.,
Kahan, F. M.,
Chen, M. H.,
Patchett, A. A.,
Galloway, S. M.,
Hyland, S. A.,
Anderson, M. S.,
and Raetz, C. R. H.
(1996)
Science
274,
980-982 |
| 48. | Allen, A., and Maskell, D. (1996) Mol. Microbiol. 19, 37-52[CrossRef][Medline] [Order article via Infotrieve] |
| 49. |
Cotter, P. A.,
and Miller, J. F.
(1994)
Infect. Immun.
62,
3381-3390 |
| 50. |
Mohan, S.,
Kelly, T. M.,
Eveland, S. S.,
Raetz, C. R. H.,
and Anderson, M. S.
(1994)
J. Biol. Chem.
269,
32896-32903 |
| 51. |
Galloway, S. M.,
and Raetz, C. R. H.
(1990)
J. Biol. Chem.
265,
6394-6402 |
| 52. | Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1989) Current Protocols in Molecular Biology , John Wiley & Sons, New York |
| 53. | Smith, P. K., Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Anal. Biochem. 150, 76-85[CrossRef][Medline] [Order article via Infotrieve] |
| 54. |
Anderson, M. S.,
Bulawa, C. E.,
and Raetz, C. R. H.
(1985)
J. Biol. Chem.
260,
15536-15541 |
| 55. |
Schnaitman, C. A.,
and Klena, J. D.
(1993)
Microbiol. Rev.
57,
655-682 |
| 56. |
Tomasiewicz, H. G.,
and McHenry, C. S.
(1987)
J. Bacteriol.
169,
5735-5744 |
| 57. | Costello, C. E., and Vath, J. E. (1990) Methods Enzymol. 193, 738-768[Medline] [Order article via Infotrieve] |
| 58. | Caroff, M., Brisson, J., Martin, A., and Karibian, D. (2000) FEBS Lett. 477, 8-14[CrossRef][Medline] [Order article via Infotrieve] |
| 59. | Caroff, M., Karibian, D., Zarrouk, H., Deprun, C., Richards, J. C., and Perry, M. B. (1994) in 17th International Carbohydrate Symposium, Poster A1.56 |
| 60. | Zähringer, U., Lindner, B., and Rietschel, E. T. (1999) in Endotoxin in Health and Disease (Brade, H. , Opal, S. M. , Vogel, S. N. , and Morrison, D. C., eds) , pp. 93-114, Marcel Dekker, Inc., New York |
| 61. | Amano, K., Fukushi, K., and Watanabe, M. (1990) J. Gen. Microbiol. 136, 481-487[Medline] [Order article via Infotrieve] |
| 62. | Watanabe, M., Takimoto, H., Kumazawa, Y., and Amano, K. (1990) J. Gen. Microbiol. 136, 489-493[Medline] [Order article via Infotrieve] |
| 63. | Ray, A., Redhead, K., Selkirk, S., and Poole, S. (1991) FEMS Microbiol. Lett. 63, 211-217[CrossRef][Medline] [Order article via Infotrieve] |
| 64. | Cotter, P. A., and Miller, J. F. (2001) in Principles of Bacterial Pathogenesis (Groisman, E., ed) , pp. 619-674, Academic Press, San Diego, CA |