HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 21, 18390-18396, May 24, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/21/18390    most recent M201047200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Weber, J. Articles by Senior, A. E. Search for Related Content PubMed PubMed Citation Articles by Weber, J. Articles by Senior, A. E. Social Bookmarking                      What's this?

Quantitative Determination of Binding Affinity of -Subunit in Escherichia coli F₁-ATPase

EFFECTS OF MUTATION, Mg²⁺, AND pH ON K_d^*

Joachim Weber, Susan Wilke-Mounts, and Alan E. Senior

From the Department of Biochemistry and Biophysics, University of Rochester Medical Center, Rochester, New York 14642

Received for publication, January 31, 2002, and in revised form, February 21, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

To study the stator function in ATP synthase, a fluorimetric assay has been devised for quantitative determination of binding affinity of -subunit to Escherichia coli F₁-ATPase. The signal used is that of the natural tryptophan at residue 28, which is enhanced by 50% upon binding of -subunit to ₃₃ complex. K_d for  binding is 1.4 nM, which is energetically equivalent (50.2 kJ/mol) to that required to resist the rotor strain. Only one site for  binding was detected. The W28L mutation increased K_d to 4.6 nM, equivalent to a loss of 2.9 kJ/mol binding energy. While this was insufficient to cause detectable functional impairment, it did facilitate preparation of -depleted F₁. The G29D mutation reduced K_d to 26 nM, equivalent to a loss of 7.2 kJ/mol binding energy. This mutation did cause serious functional impairment, referable to interruption of binding of  to F₁. Results with the two mutants illuminate how finely balanced is the stator resistance function. ' fragment, consisting of residues 1-134, bound with the same K_d as intact , showing that, at least in absence of F_o subunits, the C-terminal domain of  contributes zero binding energy. Mg²⁺ ions had a strong effect on increasing  binding affinity, supporting the possibility of bridging metal ion involvement in stator function. High pH environment greatly reduced  binding affinity, suggesting the involvement of protonatable side-chains in the binding site.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

ATP synthesis by oxidative or photophosphorylation is catalyzed by the enzyme ATP synthase. In Escherichia coli the subunit composition is ₃₃ab₂c_n. F₁ or F₁-ATPase is the name given to the ₃₃ subcomplex, which may be released from the membrane and purified in soluble form showing ATP hydrolysis activity. F_o is the subcomplex that remains behind in the membrane after F₁ release. Consisting of ab₂c_n, it is responsible both for anchoring F₁ and for providing the pathway for protons to move through the membrane (1-3). ATP synthase is extraordinary because it acts as a rotary motor (4) with ATP hydrolysis on the three catalytic sites of F₁ located at / interfaces, providing the energy to drive rotation of the -, -, and c-subunits (5-8). These three subunits are firmly linked together and comprise the "rotor" of the motor (9-11). ATP-driven rotation of the rotor, specifically of the c-subunit oligomeric ring, brings about proton efflux, and mechanisms for this proton transport have been suggested (11-13). It is widely assumed, although not yet demonstrated, that influx of protons through F_o down the transmembrane proton gradient reverses the rotor, and that the rotational movement of  within F₁ brings about ATP synthesis in the three catalytic sites. The mechanism by which ATP-driven rotation of subunits occurs, and the mechanism of rotation-driven ATP synthesis, are not yet understood and have most recently been discussed in Refs. 14-16.

It was apparent that a stator was required to counteract the rotor, and the stator is believed to be formed from the a-, b₂-, and -subunits (9, 10, 17, 18). The stator is the least well understood part of ATP synthase in terms of structure. For a-subunit, no high resolution structure analysis is yet available, although topological models have been derived (11, 19, 20). It appears to be largely or entirely membrane-buried. The b-subunit dimer has been characterized biochemically and divided into functional domains (17, 18, 21), but no high resolution structure is yet available. Via its N-terminal region, b-subunit interacts with a-subunit within the membrane (22-24), whereas the C-terminal region of b is shown to interact with  (21, 25, 26). Thus the b-subunit is pictured as being an elongated, helical molecule, positioned at one side of F₁. NMR analysis has provided a high resolution structure for residues 1-105 of the -subunit (27), but the structure of the remaining residues to the C terminus (residue 177)¹ is not yet known. Electron microscopic analysis has shown that  is located at the top of F₁ (31), sitting presumably upon the "crown" formed by the N-terminal -barrel domains of the ₃₃ hexagon (32).

Our understanding of the nature of the interaction between  and F₁ remains rudimentary, however. Cross-linking studies showed proximity of the - and/or -subunits to , both in E. coli (33, 34) and chloroplast enzyme (35). Other studies in E. coli enzyme implicated the -subunit N-terminal region as being involved. Removal of the N-terminal 15 or 19 residues from  by proteolytic digestion prevented binding of  to ₃₃ complex (36). Cross-linking of an inserted Cys at residue 2 to a natural Cys in  was obtained in high yield (37). The mutation G29D rendered F₁ deficient of -subunit and resulted in functional disruption, including partial loss of oxidative phosphorylation in cells, loss of F₁ binding to F_o in vitro, and loss ATP-driven proton pumping in vitro (38). However, while the designation of the N-terminal region of  as a "membrane-binding region" turned out to be well founded (38) (even though this region is actually the part of the enzyme most distant from the membrane) unfortunately none of the available x-ray structures show the extreme N-terminal residues of  or any of . Therefore no detailed model of the / interface can be assigned as yet. Questions that have not yet been answered are: 1) does -subunit interact functionally with parts of  as well as , 2) are all three -subunits (or / pairs) involved in binding one  or is just one  (or /) sufficient, 3) what are the region(s) and residues of  that bind to  and/or , and 4) what are the residues of the N-terminal of  that are functionally directly involved in -binding?

Understanding the manner in which the stator functions in ATP synthase is clearly important to understanding the overall process of ATP synthesis, and elucidating the nature of the -F₁ interface in functional and structural terms is one facet of this problem. Our goal in this paper was to develop a quantitative binding assay to determine the binding affinity of  under true equilibrium conditions and then to quantify the binding affinity accurately in wild-type and in the G29D mutant. During the project we found that the mutation W28L also impairs binding, suggesting that this region of  is likely at or close to the -F₁ interface. The C-terminal region of  was found not to contribute any binding energy at the -F₁ interface. An important role for Mg²⁺ (or other divalent) ions is shown, and pH was found to profoundly influence  binding.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Purification of F₁, Purification of -Subunit, and Preparation of -depleted F₁-- E. coli F₁ was purified as in Ref. 39. -subunit was purified as in Ref. 40 with minor modifications as follows. Plasmid pJC1 was transformed into strain AH3 (30) for expression, the gel filtration was on Sephacryl S100HR, and the peak from ion exchange or gel filtration was concentrated by ultrafiltration using Amicon YM10 membranes. ' fragment was purified using the same procedure, except pJC1 was transformed into strain DK8 (41). For purification of W28L subunit, the mutation was constructed by directed mutagenesis using the oligonucleotide described previously (42) in an M13mp19 template containing an EcoRI-SmaI fragment from pJC1(40). After mutagenesis the EcoRI-SmaI fragment was moved back to pJC1 creating the new plasmid pSWM101, which was transformed into strain AH3 and used for expression of W28L subunit. -depleted F₁ was prepared as in Ref. 43, except that the gel filtration column consisted of Sephacryl S300HR (1.5 cm × 100 cm). The column buffer was 50 mM glycine/NaOH, pH 9.4, 2 mM EDTA, 1 mM ATP, and 10% glycerol at 20 °C, and immediately after recovery the fractions were adjusted to pH 8.0 with 50 mM HEPES, pH 7.0.

E. coli Strains-- Wild-type F₁ was purified from strain SWM1 (44). Trp-free F₁ was purified from strain pB0W1/DK8, created by transferring a Pme1-EagI fragment from plasmid p0W1(42) into plasmid pRLL2 (45) and transforming the resultant pB0W1 into strain DK8. W28L F₁ was purified from strain pSWM92/DK8. pSWM92 was constructed by moving a PpuM1-SphI fragment from p0W1 into pBWU13.4 (46). W107 F₁ was purified from strain pSWM86/DK8. pSWM86 was constructed by moving a Pme1-EagI fragment from pDP34N (47) into pRLL2. The following mutations were constructed by oligonucleotide-directed mutagenesis as in Ref. 45 using the respective oligonucleotides. 1) L55W, GAAATGATCTCGTGGCCGGGTAACC, inserts a Trp (TGG) codon and also a new BssS1 site. The template was M13mp18 with an SphI-SalI fragment from p0W1, and after mutagenesis the mutation was moved into pB0W1 on an SphI-Csp45-1 fragment creating new plasmid pSWM89. 2) F17W, GTTGACGTCGAATGGCCACAGGATGCCG, inserts a Trp codon and an Msc1/BalI site. The template was M13mp18 containing the W107F mutation in a HindII-KpnI fragment from p0W1, and the mutations were moved back into pRLL2 on a Pme1-EagI fragment to create new plasmid pSWM87. 3) Y26W, GGATGCCGTACCACGCGTGTGGGATGCTCTTGAG, inserts a Trp codon and both BstXI and Mlu1 sites. The template and procedure were as for F17W, and the final plasmid was pSWM88. 4) G29D, CTCACAACGAAGACACTATTGTTTCTG, adds a Bbs1 site. The template was the same as for L55W mutagenesis above, and the G29D mutation was moved into plasmid pSWM86 (above) on a SphI-Csp45-1 fragment to create new plasmid pSWM93. Each of the plasmids pSWM87,88,89, and 93 were transformed into strain DK8 for purification of F₁.

Fluorescence Binding Assays-- Tryptophan fluorescence was measured in a spectrofluorometer type SPEX Fluorolog 2 at 23 °C. _exc was 295 nm. The buffer was 50 mM HEPES/NaOH, 5 mM MgSO₄, pH 7.0, unless noted otherwise. Binding of  to -depleted F₁ was measured by adding increasing concentrations of isolated -subunit to 10 or 50 nM enzyme and monitoring the fluorescence at 325 nm. Background signals, including enzyme fluorescence and fluorescence of free , determined in parallel control experiments, were subtracted. The binding-induced increase in  fluorescence was plotted versus the total  concentration, and from the resulting curves K_d values were determined by nonlinear regression. K_d for binding of W28L mutant subunit was estimated from competition experiments in which -depleted F₁ was preincubated with a given concentration of W28L subunit, and then wild-type  was added. From the change in K_d^app for wild-type  due to the presence of W28L mutant, K_d for the mutant was calculated.

Assay of ATP-driven Proton Pumping in Reconstituted Membrane Vesicles and Routine Procedures-- Acridine orange fluorescence quenching was followed as an indicator of ATP-driven proton pumping (48). Membrane vesicles were stripped of F₁ by KSCN-extraction (48). For reconstitution of F₁F_o, stripped membranes (500 µg of protein) were preincubated for 15 min at 30 °C in a total volume of 500 µl with F₁ (100 µg) or -depleted F₁ (100 µg) plus appropriate amounts of -subunit or ' fragment (10 µg, unless otherwise indicated). 400 µl of this mixture were added to 1.6 ml of assay buffer (100 mM HEPES/NaOH, 5 mM MgCl₂, 300 mM KCl, pH 7.5). Acridine orange (4 µM) fluorescence was continuously recorded in a spectrofluorometer type SLM AMINCO AB2 (_exc 430 nm, _em 565 nm). Proton gradient formation was initiated by addition of 1 mM ATP and terminated by addition of 10 µM CCCP. Assays of ATPase activity, protein concentration by Bradford assay, and SDS-gel electrophoresis on 10-20% gradient gels were as described (49).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Strategy for Design of Assay to Determine K_d of Binding of -Subunit to -depleted E. coli F₁

As discussed in the Introduction, current evidence favors the view that -subunit binds to F₁ at the "top" of the molecule, distant from the membrane. Our initial approach was to insert single Trp residues into the N-terminal -barrel domains of - or -subunits, with the hope that upon binding of , one or more of these would show perturbation of the Trp fluorescence signal. Conserved aromatic or leucine residues were targeted. The following mutations were made: L55W, F17W, and Y26W. Each was expressed in the Trp-free background (42) previously used in this laboratory to characterize nucleotide-binding properties of the enzyme (e.g. Ref. 49). The Trp-free background contains the mutations W28L/W513F/W108Y/W206Y/W107F and it was previously shown that Trp-free F₁ is functionally similar to wild-type (42). In addition the naturally occurring Trp at 107 was expressed alone in otherwise Trp-free background (we refer to this as the "W107" enzyme). After purification, all mutant enzymes showed normal subunit composition on SDS-gels. Properties of the mutant enzymes used in this work are shown in Table I. It may be seen that none of the enzymes containing single Trp residues or the Trp-free enzyme caused any major functional perturbation of ATP synthesis in cells as the growth yields were close to normal. Also, the specific activities of the purified F₁ were close to normal (the increased activity for Trp-free F₁ confirmed previous data (42)). Yields of the L55W, F17W, Y26W, and Trp-free enzyme were 0.04, 0.085, 0.19, and 0.11 mg/g cells, respectively, which was significantly lower than wild-type (0.8 mg/g cells). However, the W107 enzyme could be purified in good yield (0.41 mg/g cells).

Preparation of -depleted F₁

To prepare -depleted F₁ we used essentially the procedure of Smith et al. (43), in which F₁ is passed through a gel filtration column at pH 9.4, which causes the -subunit to dissociate from the ₃₃ complex. We found that complete -depletion was not achieved with wild-type F₁. However, complete depletion (as judged by Coomassie Blue-stained SDS gels) was achieved with the Trp-free enzyme, the mutants L55W, F17W, Y26W, and the W107 enzyme. The result of a -depletion experiment using W107 enzyme is shown in Fig. 1 lanes 1 and 2, and was typical for this group. Confirming the earlier report (43) we found that -depletion by this procedure did not change the ATPase activity of F₁. A common property of all the enzymes that could be efficiently depleted of  by this procedure was that they contain the mutation W28L in the -subunit. We therefore constructed an enzyme that was wild-type except for the W28L mutation and found that it too could be readily depleted of -subunit. Thus residue Trp-28 appeared to contribute to enhanced affinity of binding of -subunit to F₁, and use of the mutant W28L was valuable for -depletion.

View larger version (37K): [in this window] [in a new window]   Fig. 1.   SDS-gel electrophoresis of -depleted F1, purified -subunit and ' fragment. Coomassie Blue-stained 10-20% gradient SDS gels are shown. Lane 1, W107 F1 (10 µg); lane 2, -depleted W107 F1 (10 µg); lane 3, purified ' fragment (2 µg); lane 4, purified W28L mutant -subunit (2 µg); lane 5, purified wild-type  (2 µg).

Expression and Purification of -Subunit

We used essentially the method reported by Dunn and Chandler (40) in which -subunit expression from plasmid pJC1 is induced by isopropyl thiogalactoside. Plasmid JC1 was transformed into strains DK8 (uncB-uncC) or AH3(uncFH). Growth conditions and purification of  were essentially as described (40). In the original procedure a proteolytic fragment named ', consisting of residues 1-134 of -subunit (27) was formed and had to be separated from intact . Here we found that using the DK8 background, only ' was present, and it could be purified to homogeneity readily (Fig. 1, lane 3). In contrast, in the AH3 background, mostly intact  and little ' was present, and the intact  could be readily purified (Fig. 1, lane 5) in high yield (5.0 mg/liter cells). We also introduced the W28L mutation, allowing purification of this mutant -subunit (Fig. 1, lane 4).

Confirmation of Functional Integrity of -depleted F₁ and Purified

The in vitro ATP-driven proton-pumping assay described by Perlin et al. (48) was used to demonstrate functional integrity of -depleted F₁ and purified . The assay uses acridine orange fluorescence quenching as a measure of proton accumulation in membrane vesicles. Fig. 2A shows typical experimental results. F₁ containing the W28L mutation was depleted of , thus yielding wild-type -depleted F₁. Addition of this preparation to KSCN-stripped membranes gave no ATP-driven proton pumping (Fig. 2A, trace 1). When wild-type F₁ that was -replete (containing either Trp or Leu at 28) was added the results were as in Fig. 2A, trace 2, i.e. there was excellent reconstitution of ATP-driven proton pumping. When -depleted F₁ was preincubated with excess purified  (containing either Trp or Leu at 28) the results were as in trace 3, i.e. there was again excellent reconstitution of function. When purified ' was substituted for , however, no reconstitution of function occurred. Using this method we found that all of the mutant F₁ preparations containing single Trp and Trp-free F₁ gave 50-85% quenching of acridine fluorescence quenching upon rebinding to stripped membranes either before -depletion or after -depletion followed by incubation with wild-type or W28L -subunit. Therefore all of these mutant enzymes were functionally competent. The experiment also showed that the procedure used for -depletion did not cause functional impairment and that our purified  preparations were fully active.

View larger version (12K): [in this window] [in a new window]   Fig. 2.   ATP-driven proton-pumping in reconstituted F1Fo. A, membrane vesicles were stripped of F1 by KSCN treatment, then reconstituted with wild-type -depleted F1 (trace 1), intact wild-type F1 (trace 2), or wild-type -depleted F1 incubated with wild-type -subunit (trace 3). The traces show acridine orange fluorescence upon addition of ATP. A quench of fluorescence indicates proton uptake into the reconstituted vesicles. For details, see "Experimental Procedures." B, wild-type -depleted F1 was incubated with increasing concentration of purified wild-type -subunit and reconstituted with stripped membranes. The percent quench of acridine orange fluorescence after addition of ATP is plotted against the molar ratio of /F1.

We investigated whether this procedure could be used to determine stoichiometry and/or affinity of binding of  to -depleted F₁. Fig. 2B shows a typical titration experiment in which increasing amounts of wild-type -subunit were mixed with wild-type -depleted F₁ and stripped membranes. The curve shows that saturation was reached at a stoichiometry of less than 1 mol of  per mol of added -depleted F₁. This result ensues because the F_o binds F₁- complex preferentially, and the assay requires that F₁ is present in excess over F_o. Thus this assay cannot be used to determine accurately the affinity of binding of  to F₁.

Flurorescence Properties of F₁ and -Subunit

The environment of the introduced Trp in the mutant enzymes varied from unpolar (F17W) to moderately polar (Y26W; max values given in Table I). Each of the enzymes, L55W, F17W, Y26W, and W107, was -depleted and then mixed with purified W28L -subunit (which lacks Trp and therefore has no intrinsic Trp fluorescence of its own as seen in Fig. 3, trace 1). In no case was any change in fluorescence spectrum seen (data not shown). Therefore none of these single Trp residues was responsive to addition of -subunit, and it appeared binding of  caused no changes of the environment of these residues within the N-terminal -barrel domains of the - and -subunits, indicating conformational rigidity of the F₁ crown.

View larger version (17K): [in this window] [in a new window]   Fig. 3.   Fluorescence spectra of purified -subunit and of -subunit bound to -depleted F1. Corrected spectra are shown. Trace 1, purified W28L subunit; trace 2, purified wild-type -subunit; trace 3, purified wild-type -subunit mixed with -depleted W107 F1 (ratio 1 mol/mol). Note that the contribution of the W107 F1 fluorescence alone (in absence of ) has been subtracted from trace 3.

However, when the same experiment was repeated using wild-type  instead of W28L, in every case an enhancement of the total fluorescence was seen. Fig. 3 shows typical spectra obtained using the W107 enzyme, and the same results were seen with L55W, F17W, and Y26W enzymes. Fig. 3, trace 2 shows the intrinsic fluorescence of purified wild-type , which has a maximum at 326 nm, showing that the single Trp in wild-type  resides in a relatively unpolar environment. Trace 3 is the spectrum obtained upon mixing -depleted W107 F₁ with wild-type  after subtraction of the contribution of -depleted W107 F₁ alone. The experiment shows that upon binding of  to -depleted F₁, a strong enhancement (+50%) of the fluorescence of residue Trp-28 occurs accompanied by a blue-shift of 4 nm. The same enhancement of residue Trp-28 fluorescence was seen using -depleted Trp-free and wild-type F₁ (data not shown). The results show that the environment of residue Trp-28 becomes more unpolar upon binding to F₁ and, importantly, show that the fluorescence change of this residue provides a sensitive equilibrium binding assay for  binding to F₁.

Determination of Affinity of Binding of Purified -Subunit or ' to -depleted F₁ by Fluorescence Assay

We chose to use the W107 enzyme for most assays for the following reasons. As noted above, the W107 enzyme was obtained in good yield. Also, because its intrinsic fluorescence was 60% lower than that of wild-type enzyme, this meant that the correction factor upon subtraction of the intrinsic F₁ fluorescence (see above) was lower. It might seem that Trp-free F₁ would provide even greater advantage; however, this was counterbalanced by the low yield of this enzyme. However, we wish to emphasize here that binding measurements were made with the W107, Y26W, Trp-free, and wild-type enzymes, and all showed essentially identical affinity (K_d) for binding of wild-type -subunit as determined in titration experiments.

Fig. 4A shows typical titration curves obtained when W107 (trace 1) or wild-type (trace 2) -depleted F₁ was titrated with wild-type . In these experiments the concentration of -depleted F₁ was 50 nM at pH 7.0 with 5 mM Mg²⁺ present. The titration curves were fitted by a model assuming n binding sites. The curves appear "stoichiometric," i.e. there is a close-to-linear approach to saturation plateau, which is reached at a ratio of 1  per F₁ (mol/mol), and in all cases the calculated value of n was 1.0 or very close to 1.0. Fig. 4B shows titration curves using 10 nM -depleted W107 F₁ (trace 1) or Trp-free -depleted F₁ (trace 2) with wild-type . These more rounded curves yielded K_d values similar to those calculated from Fig. 4A data. Lower protein concentrations could not be used due to loss of sensitivity. Fig. 4B, trace 3 shows a control experiment in which -depleted W107 F₁ was titrated with purified W28L subunit, yielding no enhancement of fluorescence.

View larger version (17K): [in this window] [in a new window]   Fig. 4.   Titration of -depleted F1 with purified -subunit. -subunit was mixed with -depleted F1, and the resultant fluorescence enhancement at 325 nm (after subtraction of the contribution of  alone and of -depleted F1 alone) was plotted against the concentration of -subunit. Concentration of -depleted F1 was 50 nM (A) or 10 nM (B). A, trace 1, -depleted W107 F1 titrated with wild-type ; trace 2, wild-type -depleted F1 titrated with wild-type ; trace 3, -depleted W107 F1 titrated with ' fragment. B, trace 1, -depleted W107 F1 titrated with wild-type ; trace 2, Trp-free -depleted F1 titrated with wild-type ; trace 3, -depleted W107 F1 titrated with W28L subunit.

Calculated K_d values for binding of wild-type  to wild-type, W107, Trp-free, and Y26W -depleted F₁ are shown in Table II, lines 1-4. We note that in no case was there any indication of additional binding sites, and from the results we can state that if such binding sites occur their K_d values are >1 µM.

View this table: [in this window] [in a new window]   Table II Kd values for binding of wild-type -subunit, ' fragment, or W28L mutant to -depleted F1.

The affinity for binding of ' fragment was measured by the same technique (see Fig. 4A, trace 3), and K_d was found to be 1.4 nM for binding to W107 F₁ (Table II, line 5). This experiment showed that under the assay conditions in Fig. 4, none of the binding energy between  and F₁ is contributed by the C-terminal part of .

Conditions That Affect the Strength of  Binding to F₁

The purification procedure for E. coli F₁ involves preparation of membrane vesicles enriched in F₁F_o followed by release of the F₁ in presence of EDTA to chelate Mg²⁺ ions. Additionally, F₁ may be depleted of -subunit by gel filtration at high pH values (see "Experimental Procedures"). Thus it was anticipated that both pH and Mg²⁺ concentration would affect the strength of -binding. Table III shows values of K_d for binding of wild-type  to -depleted F₁ under a range of pH values in presence or absence of 5 mM Mg²⁺ ions. It may be noted that Mg²⁺ ions had a large effect at all pH values. In the presence of Mg²⁺, binding affinity (K_d) was found to lie in a narrow range between pH 6.0 and 9.0 but increased at pH 9.4 to 16.6 nM. pH 9.4 is the condition for preparation of -depleted F₁. In the absence of Mg²⁺, all K_d values were increased, and the influence of higher pH on K_d values became very marked indeed. Addition of ADP (1 mM) in presence of 5 mM Mg²⁺ ions at pH 7.0 had no effect on the binding curve or calculated K_d values.

View this table: [in this window] [in a new window]   Table III Influence of Mg2+ concentration and pH on Kd of -binding Values shown are Kd in nM, for binding of purified wild-type -subunit to -depleted W107 F1. All values shown are means of duplicate assays. It was confirmed from measurements of ATPase activity that varied pH caused no instability of W107 -depleted F1. Buffers were 50 mM MES/NaOH, pH 6.0, 50 mM HEPES/NaOH, pH 7.0, 50 mM Tris/H2SO4, pH 8.0, 50 mM glycine/NaOH, pH 9.0 and 9.4.

Mutations That Impair -Binding

The G29D Mutation-- Originally identified by random mutagenesis (38), the G29D mutation is the only mutation yet known to cause functional defects specifically derived from disruption of -binding to F₁. These defects include impairment of binding of F₁ to F_o, ATP-driven proton pumping, and oxidative phosphorylation (38). In contrast, for example, the Q2C mutation did not cause functional defects, although cross-linking of the introduced Cys-2 to natural Cys in  could be readily achieved (37), showing proximity of the introduced Cys to . Thus the region around Gly-29, and perhaps residue Gly-29 itself, is likely involved in -binding. We therefore wished to define the effects of the mutation in quantitative terms. For this purpose the G29D mutation was combined with the W107 mutation in an otherwise Trp-free background. As expected the growth yield of strain G29D/W107 was significantly lower than wild-type or of W107 alone (Table I). Purified G29D/W107 F₁ retained ATPase activity (Table I); however, in the ATP-driven proton-pumping assay conducted as in Fig. 2, G29D/W107 F₁ gave only 12% quench of acridine orange fluorescence in presence or absence of excess added wild-type . -depleted G29D/W107 F₁ was prepared and titrated with wild-type  (Fig. 5), yielding a K_d value of 25.5 nM as compared with a value of 1.4 nM for wild-type or W107 alone (see above). Thus a diminution of strength of binding of  to F₁ of around 20-fold is caused by G29D, and this is sufficient to cause defects in F₁F_o function easily detectable in vitro and in vivo. It may also be noted that titrations of the G29D/W107 mutant enzyme with wild-type -subunit consistently gave greater fluorescence enhancement than that seen with wild-type, Trp-free, or W107 enzymes, by 1.4-fold, as if the G29D mutation itself were directly affecting the environment of the Trp-28 residue.

View larger version (13K): [in this window] [in a new window]   Fig. 5.   Effect of the G29D mutation on -binding to F1. Titrations were carried out as in Fig. 4, using -depleted G29D/W107 F1 and wild-type -subunit. A, 50 nM F1. B, 10 nM F1.

W28L Mutation-- We had a strong indication that the W28L mutation weakened binding of  to F₁ from the fact that it facilitated preparation of -depleted F₁. To assay the K_d of binding of the mutant  we used a competition assay in which titrations of wild-type  to -depleted W107 F₁ were carried out in the presence of different fixed concentrations of added W28L. The results of three experiments (not shown) gave a K_d of 4.6 nM (Table II). Thus the W28L mutation weakens binding by 3- to 4-fold. This apparently is sufficient to allow more efficient -depletion of F₁ but not sufficient to cause significant functional impairment in the cell or in ATP-driven proton pumping assays in vitro.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We report here a novel assay for quantitative determination of binding affinity (K_d) for binding of -subunit to the ₃₃ complex of E. coli F₁-ATPase. The assay is a true equilibrium method that depends on enhancement of the fluorescence of the natural Trp at residue 28 in the -subunit upon binding to F₁. No chemical modification was required, although removal of some of the intrinsic Trp residues in F₁ helped to reduce the signal/noise ratio. Because purified E. coli -subunit occurs as a monomer (40) the assay was not complicated by formation of dimers or aggregates of  (cf. Ref. 50). Using the assay we determined the K_d for binding of wild-type  and of a fragment of ', which lacks the C-terminal 43 residues, and also the affinity of binding of two mutants that impair binding, namely G29D and W28L. Further we demonstrate large effects of Mg²⁺ ions and pH on the binding affinity.

We found that the K_d of binding of -subunit to F₁ was around 1.4 nM (Table II). A similar value was found for the chloroplast -subunit binding to chloroplast F₁ (50) using an assay involving fluorescence correlation spectroscopy of chemically modified . A K_d value of 1.4 nM suggests a standard free energy of binding of 50.2 kJ/mol, which, as pointed out in Ref. 50 is consistent with the strain demands placed upon the stator by the torque energy generated by the rotor during ATP hydrolysis under conditions of ATP, ADP, and P_i concentrations within the cell, equivalent to ~50 kJ/mol (50, 51). We found that the ' fragment, lacking the C terminus of , bound with the same affinity as intact , suggesting that the C-terminal residues contribute little binding energy. Previous proteolytic cleavage of  had suggested that the C-terminal region was not responsible for F₁-binding (29). It is thought that the C-terminal region of  binds to the C-terminal region of the b-subunit (21, 24-26). A fragment of the b-subunit containing the C-terminal region, named "b_sol," was found to form a b₂ complex with purified -subunit, but the binding affinity between b₂ and  was surprisingly weak with K_d = 5-10 µM (40). This would also imply that the C-terminal region of  through its association with b-subunit confers little binding energy to stator resistance. However, mutations and truncations at the C-terminal region of  bring about large functional deficiencies (30, 52). One explanation could be that there is a cooperative effect between binding of  to F₁ and to b-subunit, which tightens the overall binding of . The availability of the assay described here should allow this to be examined in future work. Additional effects on stator resistance could also derive from interactions between b-subunit and / pairs as seen in Refs. 24 and 53.

In this context, experiments on OSCP,² the mitochondrial homolog of E. coli -subunit, are relevant. Cross-linking and proteolysis studies indicate that, like E. coli , OSCP binds to the N-terminal region of  and also to  at the top of F₁ (54, 55). Numerous functional studies indicate a similar role for the two proteins in binding F₁ to F_o. However, reported K_d values for binding of OSCP to mitochondrial F₁ are in the 50-80-nM range (56, 57), which is much higher than we saw here for -binding in E. coli enzyme and explains why OSCP does not co-purify with F₁ in contrast to . When OSCP binding to mitochondrial F₁F_o was measured, the apparent K_d value was 1.7-5 nM, showing that there was an extra effect (58, 59). In mitochondrial F₁F_o there are several supernumerary subunits, not seen in the E. coli enzyme, which could contribute to the higher binding affinity, but the alternative explanation, of cooperativity of binding of OSCP in F₁F_o, is also possible.

Reduction of the binding affinity in the W28L mutant to K_d = 4.6 nM (Table II) reduces the standard free energy of binding by 2.9 kJ/mol. This was not enough to have a detectable effect on function as measured by growth yield assay in whole cells or by ATP-driven proton pumping assays in vitro. However it did facilitate removal of the -subunit by gel filtration at high pH, which we were able to exploit to prepare -depleted F₁. The G29D mutation had a much larger effect, with the K_d value being 25.5 nM (Table II), yielding a reduction in binding energy of 7.2 kJ/mol. This mutation has quite strong debilitating effects on rotation-based energy transmission between F₁ and F_o. This result exemplifies how energetically finely balanced the stator stalk is, in that it is able to tolerate only very small changes in binding affinity between  and F₁.

The results with G29D enzyme confirm that this residue is located at or very close to the -binding site. X-ray structures (15, 32) show this residue close to the surface of the N-terminal -barrel domain. Whether the effect of the mutation is due to an electrostatic effect of insertion of a carboxyl or due to a poorer fit of binding surfaces after inserting the larger side-chain remains conjectural. The development of the assay system described here should now accelerate understanding of the structure of the / interface by facilitating mutagenesis studies, and also of / interfaces if they are of functional significance. As noted in the Introduction the details of -binding at the top of F₁ remain intriguing.  binds in just one copy, potentially to three -subunits or / pairs. Possibly it needs only to bind to one  with high affinity to achieve the proper structure. Possibly the three N termini of  form a tripodal binding site, like the legs of a lunar module, with all three N termini combining to form one binding site for .

The effect of the W28L mutation on binding affinity, and especially the pronounced fluorescence enhancement response of residue Trp-28 upon binding of , indicate a location of this residue close to F₁. The NMR structure of  (27) shows that residue 28 lies in helix 2 (residues 24-39) at the protein surface, but with the side-chain pointing into the protein matrix, consistent with the relatively unpolar environment reported by the Trp spectrum. One model would be that helix 2 of  binds directly to F₁, and that the substitution W28L causes small conformational changes of the helix surface contours. This, however, does not agree well with the finding that residue Arg-94 of OSCP (equivalent to Arg-85) is crucial for binding (57). Arg-85 is located in a turn after helix 5, which consists of residues 71-83. The structure suggests also a second model, that the surface formed by residues from helix 1 (residues 5-20) and helix 5 might bind to F₁. Side-chains from helix 1 make contact with Trp-28, thus mutation of the latter might affect the binding surface through helix 1. Both binding models, but particularly the second, would decrease accessibility of Trp-28 from the medium upon binding, as suggested by the blue-shift of fluorescence upon binding (Fig. 3). Future mutagenesis of -subunit coupled with the quantitative assay should define a binding model.

Release of F₁ from E. coli membranes in soluble form is achieved in the presence of EDTA to chelate Mg²⁺ ions, and reconstitution of F₁F_o in vitro requires the presence of Mg²⁺ ions. The data in Table III show a large effect of Mg²⁺ ions on the affinity of binding of  to -depleted F₁ and provide an explanation for the above effects. At all pH values tested, K_d was higher in the presence than in the absence of Mg²⁺. This phenomenon was first recognized by Abrams and colleagues (60) who showed using Streptococcus faecalis F₁ that -subunit was lost on gel electrophoresis in the absence of Mg²⁺ but remained bound to F₁ in presence of 2 mM Mg²⁺. They concluded that Mg²⁺ (or another divalent cation) was naturally present in the enzyme to act as an anchor between  and F₁. The data reported here confirm and extend the earlier work by showing a substantial effect of Mg²⁺ on  binding. Speculatively, one can propose that Mg²⁺ ions bridging  and  are involved in binding  to F₁ (60). Studies on E. coli F₁ determined that, as purified, it contained 2 Mg²⁺/F₁ (mol/mol) with no other metal present (61). Intriguingly, isolated -subunit was found to bind 1 Mg²⁺ (mol/mol). Furthermore, it was shown later that purified E. coli F₁ preparations commonly contain only 0.65 mol /mol F₁ due to loss of  during purification (62). This would imply that the true content of - bridging Mg²⁺ ions might be 3 mol/mol F₁, i.e. one per . It is an interesting speculation. The data in Table III also affirm the large effect of raising pH values on weakening of -binding, an effect that was recognized empirically in the past and used to deplete F₁ of -subunit (43). It is clear that protonatable residues on  or , with pK_a values in the range of 8-9, are involved with or at least strongly influence -binding.

Summarizing, we report an assay for quantitative determination of binding of -subunit to F₁-ATPase. We show that mutations in - or in -subunits affect the K_d, and that the stator is finely balanced in terms of its resistance to strain since relatively small changes in K_d of  binding significantly impair function. We show that the C-terminal residues of  contribute no binding energy at all. Mg²⁺ is a critical component of -binding, suggesting possible - bridging metal site(s) in the enzyme, and high pH greatly decreased K_d, implicating protonatable side-chains in the binding site. The availability of a simple but quantitative assay for -binding now opens up the possibility of defining structure/function of the ATP synthase stator in detail.

	ACKNOWLEDGEMENT

We thank Prof. S. D. Dunn, University of Western Ontario, for a gift of plasmid pJC1 and helpful discussion.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant GM25349 (to A. E. S.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Biochemistry and Biophysics, Box 712, University of Rochester Medical Center, Rochester, NY 14642. Tel.: 585-275-2777; Fax: 585-271-2683; E-mail: alan_senior@urmc.rochester.edu.

Published, JBC Papers in Press, February 25, 2002, DOI 10.1074/jbc.M201047200

¹ E. coli residue numbers are used throughout the article. Based on amino acid sequence analysis, Mabuchi et al. (28) determined that the N-terminal Met was present in -subunit, whereas Mendel-Hartvig and Capaldi (29) reported that it was removed. In this work, to be consistent with our earlier studies (30), -subunit residues are numbered assuming that the N-terminal Met is residue 1.

	ABBREVIATIONS

The abbreviation used is: OSCP, oligomycin sensitivity conferral protein.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES