Originally published In Press as doi:10.1074/jbc.M109087200 on March 13, 2002
J. Biol. Chem., Vol. 277, Issue 21, 18744-18752, May 24, 2002
Heterogeneous Nuclear Ribonucleoprotein A1 Interferes with
the Binding of the Human T Cell Leukemia Virus Type 1 Rex Regulatory
Protein to Its Response Element*
Madeleine Duc
Dodon
,
Samir
Hamaia,
Juliette
Martin§, and
Louis
Gazzolo
From the Immuno-Virologie Moléculaire and Cellulaire, UMR
5537, CNRS-Université Claude Bernard/Lyon 1, Faculté de Médecine RTH Laennec, Rue G. Paradin,
69372 Lyon Cedex 8, France
Received for publication, September 20, 2001, and in revised form, March 11, 2002
 |
ABSTRACT |
The human T cell leukemia virus, type 1 (HTLV-1),
Rex protein mediates the nuclear export of unspliced and incompletely
spliced viral mRNAs. This post-transcriptional activity is
dependent in part on the binding of this protein to
cis-regulatory sequences termed the Rex-response element
(XRE). We have proposed previously that the decreased functionality
exhibited by Rex in human lymphoblastoid Jurkat T cells may be linked
to alterations in the Rex/XRE interactions. The analysis of the
ribonucleoprotein complexes formed between Jurkat nuclear proteins and
XRE-RNA led to the identification of a 36-kDa protein as heterogeneous
nuclear ribonucleoprotein (hnRNP) A1. In vitro binding
assays revealed that hnRNP A1 proteins were found to interfere with the
binding of Rex to XRE, whereas nuclear extracts depleted of these
proteins were unable to disrupt Rex-XRE complexes. Furthermore, A1
proteins from Jurkat cells were acting in a
concentration-dependent manner, suggesting that the amount
of these RNA-binding proteins is a critical parameter in controlling
Rex activity. We indeed observed a lower level of hnRNP A1 in in
vitro HTLV-1-transformed virus-producing T cells than that
detected in Jurkat cells. Likewise, overexpression of hnRNP A1 proteins
in 293T cells and in Jurkat cells led to a decrease in the expression
of a reporter gene dependent on Rex/XRE interactions. Such a decrease
was not observed when the expression of the same reporter gene by cells
overexpressing hnRNP A1 was dependent on the interactions of human
immunodeficiency virus Rev protein with the Rev-response element.
These findings indicate that hnRNP A1 by competing with Rex for the
formation of REX-XRE complexes is specifically involved in the
modulation of the post-transcriptional activity of Rex.
| |
INTRODUCTION |
The replication of complex retroviruses is controlled at both
transcriptional and post-transcriptional levels, by specific regulatory
proteins encoded by the viral genome (1-4). Thus, cytoplasmic
expression of spliced and unspliced transcripts encoding the
gag-pol and env gene products is
dependent on a RNA-binding viral protein, the 27-kDa Rex protein of
human T cell leukemia virus, type 1 (HTLV-1),1 or the 19-kDa Rev
of human immunodeficiency virus, type 1 (HIV-1). The
post-transcriptional activity of both proteins is dependent on their
interactions with RNA cis-acting sequences, referred to as
the Rex-response element (XRE) and the Rev-response element (RRE), respectively. These proteins display two functional
domains, an N-terminal basic domain, acting mainly as a
sequence-specific RNA-binding domain, and a C-terminal
leucine-rich domain termed the activation domain, acting as a nuclear
export signal. These leucine-rich sequences are interchangeable between
Rex and Rev, underlining that the specificity of each protein relies on
the interaction of the RNA-binding domain with its response element (5-8).
We have reported previously (9) that Rex functionality was impaired in
lymphoblastoid Jurkat T cells, as shown by the failure of these cells
to produce HTLV-1 envelope glycoproteins after transfection with a
Rex/XRE-dependent env construct together with a
Rex expression plasmid. Conversely, synthesis of HTLV-1 envelope glycoproteins was observed in Jurkat cells transfected with a Rev/RRE-dependent env construct together with a
Rev expression plasmid. These results therefore indicated that the
inability of these lymphoblastoid cells to support Rex function is
linked to the deficiency of this viral regulatory protein to bind
its response element. They in turn pointed to host cell
proteins that would interfere with Rex/XRE interactions.
In the present study, we report that nuclear proteins from Jurkat cells
are able to bind the XRE sequences. Purification on RNA affinity column
and immunoblot analysis showed that one of these proteins with an
apparent mass of 36-kDa is hnRNP A1. We then demonstrated that
hnRNP A1-containing nuclear extracts are able to compete with Rex for
binding to XRE-RNA using in vitro binding assays.
Furthermore, nuclear extracts immunodepleted of hnRNP A1 were unable to
disrupt Rex-XRE complexes. In these experiments, the amount of these
RNA-binding proteins appears to be a critical parameter in controlling
Rex activity. We indeed observed a lower level of hnRNP A1 in in
vitro HTLV-1-transformed virus-producing T cells than that
detected in Jurkat cells. Finally, overexpression of hnRNP A1 in 293T
cells was found to correlate with an inhibition of
XRE-dependent mRNA accumulation in the cytoplasm of
these cells. Collectively, these findings suggest that hnRNP A1
inhibits Rex intervention in the cytoplasmic expression of genomic and
singly spliced HTLV-1 mRNAs.
| |
MATERIALS AND METHODS |
Cell Culture, Transfection, and CAT Assays--
Jurkat
lymphoblastoid T cells were incubated at 37 °C in a 5%
CO2 atmosphere in RPMI 1640 medium (Invitrogen)
supplemented with 10% heat-inactivated fetal calf serum and 20 IU/ml
penicillin, 20 µg/ml streptomycin. We used in this study three
HTLV-1-transformed T cell lines, C91PL (10), MT2 (11), and HUT-102
(12), which were cultured in complete RPMI medium. Cord blood
lymphocytes were isolated from freshly collected heparinized cord blood
by Ficoll-Paque (Amersham Biosciences) density gradient centrifugation. Adherent cells were removed by incubation of the cells for 1 h at
37 °C on a plastic Petri dish (Falcon). Non-adherent cells seeded at
2 × 106 cells/ml were stimulated with 1 µg/ml
phytohemagglutinin (Welcome reagent Ldt) and expanded in a 5%
CO2 atmosphere at 37 °C in RPMI 1640 medium supplemented
with 10% fetal calf serum and 50 units/ml interleukin-2 (Roche
Molecular Biochemicals). One week later, analysis by flow cytometry
showed that more than 90% of these cells were CD4+T lymphocytes. The
human epithelial 293T cells were cultured in Dulbecco's minimum
Eagle's medium (Invitrogen) supplemented with 10% fetal calf serum
and 20 IU/ml penicillin, 20 µg/ml streptomycin. These cells seeded at
1.2 × 105 cells per well of a 12-well plate were
transfected using the calcium phosphate coprecipitation technique (13).
Jurkat cells were transfected by using the X-tremeGENE Q2 transfection
reagent (Roche Molecular Biochemicals) according to the procedure
described by the manufacturer. The amount of plasmid used in each
transfection assay is indicated in the figure legends. Cells were
harvested 48 h after transfection, resuspended in 60 µl of lysis
buffer (100 mM Tris, pH 7.8, 0.7% Nonidet P-40), and lysed
by three repeated freeze-thaw cycles. Lysates were used to monitor
protein expression and to evaluate CAT activity (14). The values of CAT
activity, obtained from the same amount of protein, are the means of
three experiments performed in triplicate with the standard deviation of the means. In Jurkat cells, the transfection efficiency was assessed
by transfecting 100 ng of the RSV-SEAP plasmid in each assay. The
obtained values were then normalized related to values of SEAP activity
as determined by using a chemiluminescent reporter kit (PerkinElmer
Life Sciences).
Preparation of Nuclear Protein Extracts--
Nuclear extracts
from Jurkat cells were prepared according to the procedure of
Andrews and Faller (15), derived from the technique described by Dignam
et al. (16). The nuclear extracts were then dialyzed against
extraction buffer containing 20 mM Hepes, pH 7.9, 20%
glycerol, 100 mM KCl, 0.2 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 0.5 mM dithiothreitol (DTT). The nuclear extracts were
centrifuged for 5 min at 25,000 × g, and protein concentration was determined by the standard Bradford method. These
extracts were stored at 
80 °C, until use.
Depletion of hnRNP A1 from the nuclear extract of Jurkat cells was
performed through the use of immunomagnetic beads. Briefly, nuclear
extracts (15 µg) were incubated with 0.5 µl of either the mouse
anti-hnRNP A1 monoclonal antibody 4B10 or a monoclonal antibody
isotypic (IgG 2b) control (Immunotech) or of extraction buffer, in a
final volume of 30 µl with this buffer. After an incubation for 30 min on ice, immunomagnetic beads (Dynabeads M-450, Dynal) coated with
goat anti-mouse IgG (2 × 106 beads/assay) were added.
Each sample was then incubated at 4 °C for 30 min. The beads were
then removed with a magnet, and Dynabeads M-450 were added again.
Another incubation was performed for 30 min at 4 °C. After removing
the beads, unbound nuclear proteins were collected, assayed for hnRNP
A1 content by Western blot analysis, and immediately used in binding experiments.
Production of Recombinant Rex Protein--
The HTLV-1 Rex coding
sequence was PCR-amplified with the following oligonucleotide
primers: sense 5'-GCGCATATGCCCAAGACCCG-3' (introducing an
NdeI site on ATG) and antisense
5'-GCGCGGTATCCGGGAACATTGGTG-3'. The PCR-amplified fragment was
inserted into the vector pET8c(His)6 (a gift of P. Chavrier, INSERM, Marseille, France). Escherichia coli
strain BL-21(DE3)Lys containing pET8c-Rex was induced with isopropyl-
-D-galactopyranoside at a final concentration
of 0.5 mM during the exponential phase growth (with an
A600 of 0.5) of the bacterial culture for
4 h at 37 °C. Cells were harvested by centrifugation and then
frozen and thawed in 6 M guanidine hydrochloride, 0.1 M phosphate buffer, pH 8. After repeated sonications of the bacterial extract followed by a spin for 15 min at 10,000 × g, the proteins were purified on nickel-nitrilotriacetic
acid-agarose column chelating resin (Qiagen) according to the
manufacturer's protocol. Recombinant proteins were eluted in buffer
containing 50 mM Tris-HCl, pH 8.0, 20 mM KCl,
and 500 mM imidazole. After determination of protein
concentration by the standard Bradford method, fractions were stored at
80 °C.
DNA Constructs and in Vitro Transcription--
Plasmids referred
to as pKS-XRE and pKS-RRE were constructed by excision with
ClaI of the complete XRE and RRE sequences, from the two
respective variants of PDM138 (17). These sequences were then
reinserted into the ClaI site of the plasmid BluescriptKSII+ (Stratagene) located between the T3 and T7 promoters. Constructs were
verified by DNA sequencing. To generate biotinylated RNAs, pKS-XRE and
pKS-RRE templates were linearized with HindIII and XhoI, respectively, and were transcribed using the in
vitro transcription kit (Promega) in the presence of equal amounts
of biotin-21-UTP (CLONTECH) and UTP to ensure
incorporation of two biotin molecules per transcript. Biotinylated RNAs
were purified by passage through Quick spin columns (Roche Molecular Biochemicals).
Radiolabeled XRE-RNA probes were obtained by in vitro
transcription using T7 RNA polymerase in the presence of
[
-32P]UTP. A typical reaction was carried out in 20 µl of T7 polymerase buffer containing 0.2 µg/µl DNA template,
ATP, GTP, and CTP, 2.5 mM each, 100 µM UTP,
and 50 µCi [-32P]UTP at 3,000 Ci/mmol (ICN
Biomedicals) with 1 µl of RNA polymerase (20 units/µl; Promega).
After purification, the labeled RNA was heat-denatured (85 °C for 2 min) and re-natured at room temperature for 20 min before use.
The pFLAG-hnRNP A1 expression vector was generated by PCR, using
the primer CGGGATCCATGGACTACAAGGATGACGATGACAAGTCACAGTCTCCTAAAGA coding
for both the FLAG coding sequence and part of the N terminus of
hnRNP A1, and the primer GGAATTCTTAAAATCTTCTGCCACT, complementary to the 3' end of the hnRNP A1 cDNA. The PCR-amplified product was
digested by BamHI and EcoRI and cloned into
plasmid pcDNA3.1 (Invitrogen). The truncated hnRNP A1 
C was
similarly constructed using a PCR-amplified fragment that represents
hnRNP A1 (amino acids 1-245).
The pCAT-XRE and pCAT-RRE plasmids were derived from the reporter
plasmid pDM138 containing the chloramphenicol acetyltransferase (CAT)
gene and the XRE or the RRE sequences (17). They express, under the
control of the cytomegalovirus promoter, a two-exon, one-intron
precursor RNA in which the CAT gene and the XRE or the RRE are located
within the intron (see Fig. 6A). The rex and rev expression plasmids, containing the wild type Rex or Rev
sequences under the control of the cytomegalovirus promoter, were gifts from B. C. Cullen. The control plasmid pCMV was constructed as described previously (18).
Northwestern Analysis of RNA-binding Proteins--
Nuclear
proteins (4 µg) were separated by SDS-10% PAGE and transferred to a
nitrocellulose membrane (0.22-µm pore size, Schleicher & Schuell).
The membrane, first blocked with phosphate-buffered saline (PBS)
containing 5% dry milk and 1 mM DTT for 1 h, was washed with a buffer containing 25 mM Hepes, pH 7.5, 10 mM NaCl, 5 mM MgCl2, and 1 mM DTT. Proteins immobilized on the membrane were denatured
in 6 M guanidine hydrochloride and slowly renatured on the
membrane by diluting the denaturation buffer during consecutive washes
of 10 min each. 32P-XRE RNA probe (1 × 106 cpm) was then incubated with the renatured
membrane-bound proteins at 25 °C for 1 h. After three washes to
remove the unbound probe, membranes were autoradiographed at 70 °C
for 1 h.
RNA Affinity Purification--
Biotinylated RNA transcripts were
immobilized on streptavidin beads (Dynabeads M-280, Dynal), and the RNA
affinity beads were equilibrated in buffer containing 20 mM
Hepes, pH 7.9, 100 mM KCl, 0.1% Triton X-100, 0.5 mM DTT, 12% glycerol, 0.2 mM EDTA, 0.2 mM PMSF. A 1-ml volume of Jurkat nuclear extract
supplemented with 0.1 mg of heparin was added to the beads and
incubated for 4 h at 4 °C with gentle mixing. The mixture was
extensively washed with 100 volumes of buffer containing 0.01% Nonidet
P-40. The bound proteins were eluted with the same buffer containing 1 M NaCl, and then dialyzed against 20 mM Hepes,
pH 7.9, 100 mM KCl, 0.5 mM DTT, 4% glycerol,
0.2 mM EDTA, 0.2 mM PMSF buffer. The eluate was
then concentrated to ~50 µl using Centricon-10 (Amicon) concentrators. Proteins were resolved by 10% SDS-PAGE.
In Vitro Binding Assays to Biotinylated XRE-RNA--
Different
amounts of Jurkat nuclear extracts were incubated for 10 min on ice
with biotinylated XRE-RNA (200 ng) and with recombinant Rex protein (10 ng) in a final volume of 100 µl of binding buffer 2.5 mM
EDTA, 0.1% Triton X-100, 12% glycerol, 1 µg/ml yeast tRNA, 80 units/ml RNasin, 0.2 mg/ml heparin, 0.1 mM PMSF, 0.5 mM DTT. Then, 100 µl of streptavidin-coated Dynabeads M-280 (8 × 107/ml) blocked with yeast tRNA were
added, and samples were rocked for 2.5 h. The beads were washed
four times in the same buffer containing 0.01% Nonidet P-40 using a
magnet. Bound proteins were released from beads in SDS-sample loading
buffer, and protein complexes were separated on 10% SDS-PAGE.
Western Blot Analysis--
The indicated amounts of nuclear
extracts were suspended into SDS sample loading buffer. Transiently
transfected cells were lysed in SDS sample loading buffer, and equal
amounts of proteins were subjected to 10 or 12% SDS-PAGE. They were
subsequently blotted onto nitrocellulose membrane (BA, Schleicher & Schuell). The membrane was then blocked overnight at 4 °C in
blocking buffer (PBS and 0.1% Tween 20) supplemented 10% nonfat
powdered milk and probed with the appropriate antibody diluted in
blocking buffer plus 10% nonfat powdered milk. The following
antibodies were used: rabbit polyclonal anti-Rex antibody, mouse
monoclonal anti-hnRNP A1, and anti-hnRNP C antibodies (4B10 and 4F4,
respectively; gifts from G. Dreyfuss), control murine IgG2b antibody
(Immunotech), mouse monoclonal anti-FLAG M2 (Sigma), mouse monoclonal
anti-U1 snRNP (H111, gift from R. Lührmann), followed with an
anti-rabbit (Immunotech, France) or anti-mouse (Dako) immunoglobulin
G-horseradish peroxidase-conjugated antibody. Blots were then developed
using an enhanced chemiluminescence detection system (Renaissance,
PerkinElmer Life Sciences). Bands were visualized by using Hyperfilm
(Amersham Biosciences).
Immunofluorescence Staining--
Cells were washed in PBS, fixed
in 3% paraformaldehyde for 20 min at room temperature and
permeabilized with Triton X-100 as described previously (18). The
anti-FLAG or 4B10 antibody was diluted in 5% goat serum and added to
cells for 1 h at room temperature. After three washes in PBS,
fluorescein-isothiocyanate-conjugated goat anti-mouse antibodies (Dako)
were added to cells for 1 h at room temperature. Cells were then
washed and examined under a microscope.
| |
RESULTS |
Nuclear Proteins from Jurkat T Cells Interfere with the Binding of
Rex to Its Response Element--
To approach the molecular mechanisms
underlying the decreased functionality of the Rex protein in Jurkat
lymphoblastoid T cells, we investigated whether nuclear proteins from
Jurkat cells were able to recognize XRE sequences. To that aim, we
elected to use an RNA selection assay in which biotinylated RNA
obtained by in vitro transcription was adsorbed to
streptavidin-agarose beads and then incubated for 3 h with the
recombinant Rex protein. The biotinylated ribonucleoprotein complexes
were then isolated on streptavidin-coated beads, and the amount of Rex
bound to the RNA probe was assessed by Western blot analysis. Thus, Rex
was shown to bind an XRE-RNA probe but not to an antisense XRE-RNA probe (Fig. 1A, compare
lanes 1 and 3). The addition of nuclear proteins
from Jurkat cells led to a decreased amount of Rex bound to the XRE-RNA
probe (compare lanes 1 and 2). Furthermore, we confirmed previous data demonstrating that Rex binds the RRE (19), and
we showed that this viral protein interacted with biotinylated RRE-RNA
of HIV-1 (lane 5). Interestingly, the formation of Rex-RRE complexes was not altered after addition of nuclear proteins (compare lanes 5 and 6). Since cellular proteins have been
shown to bind the RRE (Ref. 20 and data not shown), this observation
indicates in turn that they are unable to prevent Rex accessing the
RRE.
View larger version (33K):
[in this window]
[in a new window]
|
Fig. 1.
Jurkat nuclear proteins compete with
Rex in binding to the XRE sequences. A, specific binding of
Rex to the XRE in vitro. Biotinylated XRE RNA (lanes
1 and 2) or XRE RNA in an antisense orientation
(lanes 3 and 4) or RRE RNA
(lanes 5 and 6) was incubated with recombinant
Rex protein in the presence (lanes 2, 4, and
6) or in the absence (lanes 1, 3, and
5) of Jurkat nuclear extracts (NE).
Streptavidin-coated Dynabeads were added to the reaction and incubated
for 3 h. Captured ribonucleoprotein complexes were analyzed
by SDS-PAGE and blotted on nitrocellulose. The membrane was incubated
with the anti-Rex antibody and revealed by chemiluminescence.
B, Western blot analysis of the Rex-XRE complexes.
Jurkat nuclear extract (1.6 µg) and biotinylated XRE RNA (20 ng) were
incubated with increasing amounts of recombinant Rex protein (up to 3 ng). Streptavidin-coated Dynabeads were then added as in A. After immunoblotting and revelation, films were scanned for
densitometry, and the relative amounts of bound Rex protein
(y axis) were plotted against amounts of added Rex
(x axis), without addition of nuclear extracts
(circle), or with addition of nuclear extracts
(square). Inset, detection of Rex in the
presence of nuclear extracts by Western blot analysis of the
biotin pull-down assay (lane 1), of the biotin supernatant
(lane 2), and of the input (lane 3).
|
|
To characterize further the interference of nuclear proteins with Rex
binding to the XRE, biotinylated XRE-RNA was incubated for 3 h
with increasing amounts of the recombinant Rex protein (up to 3 ng)
either alone or together with an identical amount (1.5 µg) of nuclear
proteins from Jurkat cells. Under these conditions, the amount of Rex
bound to the XRE probe was found to decrease gradually (Fig.
1B). To note that Rex was stable in the presence of nuclear
extract as assessed by Western blot analysis of the biotin supernatant
(see Fig. 1B, inset, lane 2). They results clearly underline that XRE-binding nuclear proteins from Jurkat T cells
specifically interfere with the binding of Rex to its response element.
hnRNP A1 Is an XRE-binding Nuclear Protein, Which Behaves as an
Inhibitor of Rex/XRE Interactions--
To identify the XRE-binding
nuclear proteins from Jurkat T cells, nuclear extracts were submitted
to a Northwestern blotting analysis by using a radiolabeled XRE probe.
The autoradiography revealed that, beside several minor proteins, three
main proteins with apparent molecular masses of 94, 36, and 30 kDa,
respectively, were found to bind the XRE RNA (Fig.
2A).
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Identification of Jurkat nuclear proteins
binding to the XRE RNA probe. A, Northwestern
(NW) blot analysis of 4 µg of nuclear proteins that were
separated by SDS-10% PAGE, transferred to a nitrocellulose membrane,
denatured, renatured, and probed with 32P-XRE RNA.
Molecular masses are indicated on the left (low molecular
weight electrophoresis calibration kit, Amersham Biosciences).
B, Western blot (WB) analysis of proteins eluted
from biotinylated XRE RNA. Blots were incubated with the 4B10
anti-hnRNP A1 antibody (lane 1) or with the 4F4 anti-hnRNP C
antibody (lane 2) and revealed by an enhanced
chemiluminescence detection system. C, analysis of bound
proteins from the XRE affinity column was performed by Sypro-red
staining of a 12% SDS-PAGE. Molecular masses are indicated on the
left.
|
|
We focused our attention on the 36-kDa protein, mainly because of the
presence in the XRE of a UAGGUA sequence related to the consensus hnRNP
A1-binding site (21). RNA affinity chromatography was performed in
which Jurkat nuclear proteins were incubated with biotinylated XRE-RNA
immobilized on beads. Analysis of bound proteins from this RNA affinity
column was performed by Sypro-red staining of an SDS-electrophoresis
gel and revealed the presence of four main bands, with an apparent
molecular mass of 95, 60, 55, and 36 kDa (Fig. 2C). Western
blot analysis of these proteins in the presence of the 4B10 monoclonal
antibody to hnRNP A1 clearly showed that the 36-kDa protein was indeed
reactive (Fig. 2B, lane 1) with that antibody but not with
the hnRNP C antibody (lane 2). These observations clearly
indicate the presence of hnRNP A1 on the XRE-RNA.
Next, in vitro binding assays using biotinylated XRE-RNA
were performed, in which a constant amount of recombinant Rex was incubated with different amounts of nuclear proteins. After isolation of the biotinylated RNP complexes on streptavidin-coated beads and
extensive washings, the relative amounts of Rex and of hnRNP A1 within
the RNP complexes were evaluated by Western blot analysis, by
successively probing the membranes with the anti-Rex and the anti-hnRNP
A1 antibodies. Under these conditions, the amount of Rex bound to the
XRE probe was gradually reduced, after incubation with two different
amounts (1 and 10 µg) of Jurkat nuclear proteins (Fig.
3). This decrease was found to correlate
with an increase in the amounts of hnRNP A1 in RNP complexes. These
results underscore the interactions of hnRNP A1 with the XRE and
propose that hnRNP A1 is able to compete with Rex in binding the
XRE.
View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
hnRNP A1 inhibits the in vitro
formation of Rex-XRE complexes. Indicated amounts of nuclear
proteins from Jurkat cells were incubated with biotinylated XRE probe
in the presence of Rex protein (2 ng) and streptavidin-coated Dynabeads
for 3 h at 4 °C, as indicated under "Materials and
Methods." The presence of Rex (upper panel) and hnRNP A1
(lower panel) proteins in the complexes were then assessed
by Western blot analysis, by using successively the polyclonal anti-Rex
and the monoclonal anti-hnRNP A1 (4B10) antibodies.
|
|
To ascertain further that hnRNP A1 is affecting the formation of
Rex-XRE complexes, we proceeded to the immunodepletion of hnRNP A1 from
nuclear extracts of Jurkat cells. We first determined that 15 µg of
nuclear proteins were found to inhibit the binding of 10 ng of
recombinant Rex to XRE (Fig.
4A). Consequently, this amount
of nuclear proteins was immunodepleted of hnRNP A1 by incubation for
1 h in the presence of the murine monoclonal antibody to hnRNP A1
(4B10). In parallel control experiments, incubations were performed either without antibody (mock-treated) or with a murine isotype-matched antibody. Each extract was then incubated with anti-mouse
immunoglobulin-coated magnetic beads. After removal of the beads, the
Western blot analysis of nuclear proteins confirmed that treatment with
the hnRNP A1 antibody led to the partial depletion of that RNA-binding
protein (Fig. 4B, lane 2). On the contrary, hnRNP
A1 was still present among nuclear proteins either mock-treated or
incubated with the murine isotype-matched antibody (lanes 1 and 3). Then each of these three nuclear extracts was
incubated with biotinylated XRE-RNA together with recombinant Rex. The
Western blot analysis performed to verify the presence of Rex on the
XRE probe showed that a significant amount of Rex bound to XRE was
detected but only after incubation with the hnRNP A1-depleted nuclear
proteins (Fig. 4C, compare lane 2 to lanes
1 and 3). These results confirm that hnRNP A1 behaves
as an in vitro inhibitor of Rex/XRE interactions.
View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Jurkat nuclear proteins depleted of hnRNP A1
do not inhibit the formation of the Rex-XRE complexes.
A, recombinant Rex protein (2 ng) was incubated with the
biotinylated XRE RNA (20 ng) and with different amounts of nuclear
proteins from Jurkat cells. Binding assays performed under these
conditions indicate that 15 µg of nuclear proteins are sufficient to
fully inhibit the formation of Rex-XRE complexes. B, Western
blot analysis of hnRNP A1-depleted nuclear extract (NE)
using immunomagnetic beads. The nuclear extract of Jurkat cells (15 µg) either untreated (lane 1) or treated with the mouse
4B10 anti-hnRNP A1 antibody (lane 2) or with a control
isotypic (IgG2b) monoclonal antibody (lane 3) was
immunoblotted using the 4B10 antibody (Ab). C,
effects of the treated nuclear extracts on the formation of the Rex-XRE
complexes. Fifteen µg of each nuclear extract obtained as described
in B were assayed in the in vitro binding assay
performed along the experimental procedure described in A. When hnRNP A1-depleted nuclear extract was used, the formation of
Rex-XRE complexes was not altered (lane 2).
|
|
The above results imply that hnRNP A1 by interfering with Rex/XRE
interactions is able to inhibit the post-transcriptional activity of
Rex. As the production of viral particles by in vitro HTLV-1
transformed T cells is attesting to an efficient Rex activity in these
cells, we speculate that the amount of hnRNP A1 in these cells should
be lower than that found in Jurkat lymphoblastoid T cells. To verify
this hypothesis, the relative abundance of hnRNP A1 in nuclear extracts
from three HTLV-1-transformed (C91PL, HUT-102, MT2) cells and from
Jurkat cells was measured by a semi-quantitative Western blot analysis
using increasing amounts of nuclear proteins (from 31 to 125 ng).
Membranes were then probed with anti-hnRNP A1 (4B10) and anti-U1-snRNP
(H111) antibodies (Fig. 5, A
and C, respectively). The content of hnRNP A1 in each cell
line was then expressed as a ratio to that of U1 snRNP. This analysis
indicated that the level of hnRNP A1 expressed in the three
HTLV-1-transformed T cell lines was from 5.4- to 3.4-fold lower than
that in Jurkat T cells (Fig. 5B). To ascertain that this
protein is not present in the extracts because of association with
HTLV-1 RNA, nuclear extracts were lysed in SDS denaturation buffer and
analyzed by immunoblotting. Under these conditions, a low level of
hnRNP A1 protein was still observed in these HTLV-1-transformed cells
(not shown). Furthermore, the analysis of nuclear proteins prepared from uninfected cord blood lymphocytes revealed that the amount of
hnRNP A1 detected in these cells was quite similar to that found in
Jurkat cells. Collectively, our data imply that a low level of hnRNP A1
in HTLV-1-transformed T lymphocytes correlates with an efficient
activity of Rex.
View larger version (44K):
[in this window]
[in a new window]
|
Fig. 5.
Low expression of hnRNP A1 in the nuclear
extract from HTLV-1 producing T cells. A, increasing
amounts of nuclear proteins from the indicated T cell lines and from
cord blood lymphocytes (CBL) were fractionated by 12%
SDS-PAGE and electroblotted onto nitrocellulose membranes. Blots were
probed with the 4B10 anti-hnRNP A1 antibody, and the signals were
detected by enhanced chemiluminescence. Lanes 1,
4, 7, 10, and 13 correspond
to 125 ng of proteins; lanes 2, 5, 8,
11, and 14 correspond to 62.5 ng of proteins; and
lanes 3, 6, 9, 12, and
15 correspond to 31 ng of proteins. B, amounts of
hnRNP A1 proteins were determined by densitometric analysis of the
immunoreactive bands compared with that obtained with the control
antibody. C, immunoblotting of nuclear proteins from
indicated T cells using the monoclonal antibody H111 recognizing the
70-kDa U1-snRNP.
|
|
hnRNP A1 Modulates the Post-transcriptional Activity of
Rex--
To delineate further the involvement of hnRNP A1 as an
in vivo inhibitor of Rex/XRE interactions, the functional
consequences of an overexpression of this protein were next evaluated.
To that aim, 293T cells were transiently transfected either with a
FLAG-tagged-hnRNP A1 (FLAG-A1) expression plasmid or with the
pcDNA3.1 control plasmid. Overexpression of hnRNP A1 was evaluated
by immunofluorescence and Western blot assays. The immunofluorescence
study using the 4B10 antibody clearly showed the presence of a
significant number of brighter cells among cells transfected with the
FLAG-A1 vector, compared with cells transfected with the control
plasmid (Fig. 6B). As
expected, the tagged hnRNP A1 revealed by incubating cells with an
anti-FLAG antibody was found in the nucleus of the transfected cells.
The Western blot analysis performed with the same antibodies indicated
that the band of endogenous hnRNP A1 (36 kDa) is overlapping that of
the FLAG-A1 protein (Fig. 6C). Finally, a slight increase of
the overall amount of hnRNP A1 was observed in the FLAG-A1-transfected cells, when compared with that in control cells.
View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
Overexpression of hnRNP A1 in 293T cells
inhibits the XRE-dependent mRNA export pathway.
A, schematic view of the reporter plasmid pCAT-XRE and the
FLAG-tagged hnRNP A1 protein used in this assay. The sequence
corresponding to this tagged protein was inserted into the pcDNA
3.1 plasmid. B, paraformaldehyde-fixed 293T cells
transfected with either the FLAG-A1 vector or with the pcDNA 3.1 plasmid were incubated with either the 4B10 anti-hnRNP A1 antibody or
an anti-FLAG antibody, followed by a fluorescein
isothiocyanate-conjugated anti-mouse antibody. C, Western
blot analysis of the expression of the FLAG-hnRNP A1 and of the
endogenous hnRNP A1 in 293T cells transfected as described in
B. Proteins were detected by using an enhanced
chemiluminescence detection system. D, effect of the
overexpression of hnRNP A1 on CAT expression dependent on Rex/XRE or
Rev/RRE interactions. Cells were transfected with 150 ng of the
pCAT-XRE or pCAT-RRE or pDM138 reporter plasmids with or without the
rex- or rev-expression vectors (100 ng) in
combination with either the FLAG-A1 vector (300 ng) or the pcDNA3.1
control plasmid. CAT activity was assessed in cell lysates prepared
48 h after transfection. The results shown are expressed as
picomoles of [3H]acetylchloramphenicol produced per min.
The values of CAT activity are the means of one representative
experiment (out of four experiments) performed in triplicate with the
S.D. of the means. The lower panels represent the expression
of the FLAG-A1 in these experiments, evaluated by Western blotting
using a chemiluminescent detection system. E, effect of the
concentration-dependent expression of hnRNP A1 on CAT
expression mediated by Rex/XRE interactions. Cells were transfected
with 150 ng of the pCAT-XRE reporter plasmid with or without the
rex-expression vector (100 ng) in combination with indicated
amounts of the FLAG-A1 vector. The results shown are expressed as the
percent inhibition of Rex transactivation evaluated as follows:
100 (CAT activity in Rex and FLAG-A1-transfected cells/CAT
activity in Rex transfected cells). The values represent the averages
of triplicates from two independent experiments.
|
|
The potential effect of hnRNP A1 on Rex activity was then assayed using
the XRE-regulated CAT reporter gene vector (pCAT-XRE). It encodes a
single intron that contains both the CAT- and the XRE-coding sequences
(Fig. 6A). CAT expression is dependent on the Rex/XRE
interactions and correlates with the nuclear export and cytoplasmic
accumulation of unspliced cat mRNAs. Thus, when 293T
cells were cotransfected with this reporter plasmid together with the
rex-expression plasmid, a 57-fold increase in CAT activity was observed, compared with that in 293T cells transfected with the
pCAT-XRE alone (Fig. 6D, XRE panel, compare
lanes 3 and 4). Next, 293T cells were
cotransfected with the FLAG-A1 plasmid together with the XRE-CAT
reporter plasmid, in the presence or absence of the Rex expression
vector. Overexpression of hnRNP A1 was assessed by the presence of the
36-kDa band revealed by the anti-FLAG antibody (see immunoblot
analysis, lower panel, lanes 1, 2, 5,
6, 9, and 10). The overexpressed hnRNP
A1 led to a 9-fold decrease in CAT activity, when compared with cells
transfected with Rex alone (Fig. 6D, XRE panel,
compare lanes 2 and 4). It is worth noting that
the FLAG-hnRNP A1 alone (in the absence of Rex) does not behave as an
RNA export protein (lanes 1 and 3). To ascertain that the effects observed were indeed specific of XRE-regulated gene
expression, the impact of hnRNP A1 overexpression on mRNA export
mediated by the Rev/RRE interactions was investigated. To that purpose,
293T cells were co-transfected with the Rev-dependent reporter plasmid (pCAT-RRE) and a Rev vector, either with the FLAG-A1
vector or with the pcDNA3.1 control plasmid. Overexpression of
hnRNP A1 did not decrease Rev function, as CAT activity was found to be
slightly higher, when compared with cells transfected with Rev alone
(Fig. 6D, RRE panel, compare lanes 6 and 8). Likewise, CAT activity was not modified in 293T
cells co-transfected with the control reporter plasmid (pDM-CAT) in the
absence or in the presence of the FLAG-A1 expression plasmid (Fig.
6D, pDM panel, compare lanes 10 and
12). Finally, inhibition of Rex transactivation by hnRNP A1
was found to be dose-dependent (Fig. 6E).
Indeed, a 1.5-6-fold decrease of CAT activity was observed as the
amount of the transfected FLAG-A1-vector increased from 30 to 300 ng, thus indicating that hnRNP A1 modulates Rex activity. These data indicate that the overexpression of hnRNP A1 is specifically linked to
an inhibition of the Rex-mediated cytoplasmic expression of XRE-containing mRNAs.
We next explore the role of hnRNP A1 in Jurkat cells in which Rex
exhibits an impaired functionality. To that aim, we transiently transfected Jurkat cells with the XRE-regulated CAT reporter gene in
the presence of the rex-expression plasmid together either with a FLAG-tagged hnRNP A1 or with a FLAG-tagged mutant hnRNP A1
referred to as FLAG A1 C. This mutant, deleted of 75 amino acids in
the C-terminal region, lacks part of the glycine-rich domain and the M9
sequence allowing hnRNP A1 to shuttle between the nucleus and the
cytoplasm. Immunoblotting of the cell lysates performed with the
anti-FLAG antibody revealed equal amounts of a 36-kDa protein in the
FLAG A1-transfected cells and of a 29-kDa protein in the FLAG A1
C-transfected cells (Fig. 7,
lower panel). No protein was detected in cells transfected
with the pcDNA vector. When overexpressed, hnRNP A1 led to an
inhibition of Rex activity. Indeed, a 50% decrease in CAT activity was
observed in Jurkat cells cotransfected with the FLAG-A1 plasmid
together with the pCAT-XRE and the rex-expression plasmids,
when compared with cells co-transfected only with the pCAT-XRE and Rex
vectors (Fig. 7, compare lanes 2 and 4).
Conversely, after transfection of Jurkat cells with the FLAG-A1 C
plasmid, no inhibition in CAT activity could be observed (compare
lanes 2 and 6), indicating that this mutated
protein had no effect on CAT expression. Taken together, these results
underline that hnRNP A1 exerts a specific inhibitory action on Rex
function.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 7.
A C-terminal truncated hnRNP A1 overexpressed
in Jurkat cells does not inhibit the XRE-dependent mRNA
export pathway. Cells were transfected with 1 µg of the pCAT-XRE
reporter plasmid with (lanes 2, 4, and
6) or without (lanes 1, 3, and
5) the rex-expression vector (500 ng) in
combination with either the FLAG-A1 vector (500 ng) (lanes 3 and 4) or the FLAG-mutated A1C (lanes 5 and
6) or the pcDNA 3.1 control plasmid (lanes 1 and 2). CAT activity was assessed in cell lysates prepared
48 h after transfection. The values of CAT activity are the means
of three experiments performed in triplicate with the S.D. of the
means. The lower panel represents the expression of the
FLAG-A1 and the FLAG A1 C in these experiments, evaluated by Western
blotting using a chemiluminescent detection system.
|
|
| |
DISCUSSION |
The expression of HTLV-1 and of HIV-1 structural and enzymatic
proteins is regulated by viral regulatory proteins, which operate at
the transcriptional and post-transcriptional levels. In particular, both viruses encode trans-acting proteins, Rex and Rev,
respectively, which allow the nucleo-cytoplasmic export of unspliced
and singly spliced mRNAs (1, 3). The functionality of these
proteins depends on binding to viral RNAs and on interacting with CRM1 (a cellular protein belonging to the importin/karyopherin family transport receptors), via their activation domains, which act as
nuclear export signals (22-24). The leucine-rich activation domains of
Rex and Rev are functionally interchangeable, underlining that the
specificity of these RNA-binding proteins is dependent on the
recognition of highly structured sequences defining their response
elements, XRE and RRE, respectively (5-7).
In the present study, we have addressed the molecular and cellular
mechanisms underlying the decreased functionality of Rex in Jurkat
lymphoblastoid T cells, in which incidentally Rev was found to be fully
efficient (9). We therefore investigated whether Rex interaction with
the XRE might be impaired in these cells. We first showed that Jurkat
nuclear proteins are able to interfere with Rex binding to the XRE. By
means of Northwestern assays, we characterized one protein with a
molecular mass of 36 kDa able to recognize and to bind XRE sequences.
Immunoblot of Jurkat nuclear proteins bound to the XRE RNA probe
identified this 36-kDa protein as hnRNP A1. We confirmed by in
vitro competition assays that hnRNP A1 has the ability to disrupt
the Rex-XRE complexes. These data therefore provide evidence that hnRNP
A1 competes with Rex in binding XRE in a
concentration-dependent manner, suggesting that the amount
of these RNA-binding proteins is a critical parameter in controlling
Rex activity. Indeed, when compared with that detected in Jurkat cells,
a lower amount of hnRNP A1 was found to characterize HTLV-1-producing T
cell lines, in which Rex is functionally efficient. Furthermore,
overexpression of hnRNP A1 led to a decrease in the Rex/XRE-dependent expression of a reporter gene. As
expected, the Rev/RRE-dependent expression of the same
reporter gene was not affected by the overexpression of hnRNP A1.
Consequently, the present study supports the premise that among
cellular proteins implicated in the life cycle of HTLV-1, hnRNP A1 is
endowed with the ability to restrict the production of structural and
enzymatic viral proteins.
One intriguing finding of the present study concerns the different
levels of hnRNP A1 detected in uninfected cord blood lymphocytes and in
in vitro HTLV-1-transformed cells. In the former, the amount of hnRNP A1 was quite similar to that found in Jurkat cells, whereas, for example, C91PL cells that were obtained after co-cultivating cord
blood cells with X-irradiated producing T cells were expressing a lower
amount of hnRNP A1. It could be assumed that the decrease in hnRNP A1
expression occurs during the immortalization process, which spans over
several weeks. Alternatively, the presence of a few cells with a low
expression of hnRNP A1 in the population of cord blood lymphocytes may
also be considered.
hnRNP proteins are the major pre-mRNA binding proteins in
eukaryotic cell nuclei and play important roles in the biogenesis of
mRNAs (25). Indeed, they remained associated with these molecules during the processing of pre-mRNAs into mRNAs, which are then transported from the nucleus into the cytoplasm, where they are translated (26). Among these RNA-binding proteins, the 36-kDa hnRNP A1
protein plays essential functions in RNA metabolic processes. It binds
to most RNA polymerase II transcripts (21), and because of its
abundance and of its intracellular trafficking, it is influencing gene
expression both in the nucleus and cytoplasmic compartments (27). In
the nucleus, hnRNP A1 is implicated in pre-mRNA processing by
binding intronic sequences and regulating alternative splicing in
vitro and in vivo (reviewed in Refs. 25, 26, 28, and 29).
Furthermore, hnRNP A1, which shuttles between the nucleus and the
cytoplasm, has been implicated in the nucleo-cytoplasmic transport,
signaled by a 38-amino acid C-terminal sequence, termed M9 (between
amino acids 268 and 305) (30, 31). Few observations have been devoted
so far to the intervention of hnRNP A1 in the replication of viruses.
Thus, hnRNP A1 has been shown to bind HTLV-2 RNA regulatory elements,
suggesting that it may alter viral RNA processing (32, 33). More
recently, this RNA-binding protein was found to repress HIV-1 splicing
(34). Interestingly, hnRNPA 1 has been shown to stimulate
synergistically the HIV-1 Rev-dependent export of unspliced
mRNA (35). Finally, the participation of hnRNP A1 in the
transcription and replication of a cytoplasmic RNA virus, mouse
hepatitis virus, has been delineated (36).
Further characterization of hnRNP A1-binding sites to the HTLV-1
XRE-RNA will help to elucidate the precise mechanism by which hnRNP A1
is able to interfere in the Rex-mediated export of mRNAs from the
nucleus. The XRE-RNA consists of two stems and four stem-loops. Alterations of these stem-loops and the stem structures strongly reduced Rex function and have indicated that the central part of the
stem-loop D is sufficient to mediate Rex function (37). This stem-loop,
which functions upon duplication as efficiently as the full-length XRE,
contains a high affinity binding site for Rex, as revealed by a
quantitative gel retardation assay (37-39). The search for binding
sites for hnRNP A1 in the XRE identifies two putative high
affinity-binding sequences. Thus, a 6-nt UAGGUA sequence (nt
8768-8773) is similar to the winner UAGGG(A/U) binding sequence.
Furthermore, a 9-nt CUACCUAGA sequence (nt 8825-8833) is similar to
the hnRNP A1-binding sites CUAGACUAGA in the HIV-1 tat exon (40) and
the UUAGAUUAGA in the trans-regulatory region of mouse
hepatitis virus RNA (41). Interestingly, the two sequences identified
in the XRE are found in the stem of the stem-loop D. Therefore, it
could be speculated that hnRNP A1 binds these sequences, thus hindering
the binding of Rex to its XRE-binding site.
In conclusion, our data provide direct experimental evidence that hnRNP
A1, by interfering with the formation of Rex-XRE complexes, may be
involved in the post-transcriptional activity of the Rex protein. Based
on our results, we propose that the competition between hnRNP A1 and
Rex is modulating the post-transcriptional regulation of HTLV-1
expression. Finally, the dependence of Rex functionality on hnRNP A1 by
revealing another level in the control of this retrovirus life cycle
might provide novel insights on HTLV-1 pathogenesis.
| |
ACKNOWLEDGEMENTS |
We thank Christian Devaux and Alain Sergeant
for discussions and critical reading of the manuscript. We are grateful
to Gideon Dreyfuss for sharing reagents.
| |
FOOTNOTES |
*
This work was supported in part by an institutional grant
from CNRS and by a grant from Agence Nationale de Recherches sur le
SIDA (to M. D. D.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: INSERM U412, 46, Allée d'Italie, 69364 Lyon Cedex 07, France. Tel.:
33-4-72-72-81-75; Fax: 33-4-72-72-80-80; E-mail:
Madeleine.Duc.Dodon@ens-lyon.fr.
§
Supported by a fellowship from CNRS.
Published, JBC Papers in Press, March 13, 2002, DOI 10.1074/jbc.M109087200
1
The abbreviations used are: HTLV-1, human T cell
leukemia virus type 1; HIV, human immunodeficiency virus; XRE,
Rex-response element; RRE, Rev-response element; hnRNP, heterogeneous
nuclear ribonucleoprotein; CAT, chloramphenicol acetyltransferase; PBS, phosphate-buffered solution; PMSF, phenylmethylsulfonyl fluoride; snRNP, small nuclear ribonucleoprotein; DTT, dithiothreitol; nt, nucleotide.
| |
REFERENCES |
| 1.
|
Cullen, B. R.
(1992)
Microbiol. Rev.
56,
375-394[Abstract/Free Full Text]
|
| 2.
|
Green, P. L.,
and Chen, I. S. Y.
(1994)
in
The Retroviridae
(Levy, J. A., ed), Vol. 3
, pp. 277-311, Plenum Publishing Corp., New York
|
| 3.
|
Parslow, T. G.
(1993)
in
Human Retroviruses
(Cullen, B. R., ed)
, pp. 101-136, Oxford University Press, New York
|
| 4.
|
Yoshida, M.
(1995)
J. Cancer Res. Clin. Oncol.
121,
521-528[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Bogerd, H. P.,
Huckaby, G. L.,
Ahmed, Y. F.,
Hanly, S. M.,
and Greene, W. C.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
5704-5708[Abstract/Free Full Text]
|
| 6.
|
Hanly, S. M.,
Rimsky, L. T.,
Malim, M. H.,
Kim, J. H.,
Hauber, J.,
Duc Dodon, M., Le, S.-Y.,
Maizel, J. V.,
Cullen, B. R.,
and Greene, W. C.
(1989)
Genes Dev.
3,
1534-1544[Abstract/Free Full Text]
|
| 7.
|
Rimsky, L.,
Hauber, J.,
Dukovich, M.,
Malim, M. H.,
Langlois, A.,
Cullen, B. R.,
and Greene, W. C.
(1988)
Nature
335,
738-740[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Weichselbraun, I.,
Farrington, G. K.,
Rusche, J. R.,
Böhnlein, E.,
and Hauber, J.
(1992)
J. Virol.
66,
2583-2587[Abstract/Free Full Text]
|
| 9.
|
Hamaia, S.,
Casse, H.,
Gazzolo, L.,
and Duc Dodon, M.
(1997)
J. Virol.
71,
8514-8521[Abstract]
|
| 10.
|
Popovic, M.,
Lange-Wantzin, G.,
Mann, D.,
and Gallo, R. C.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
5402-5406[Abstract/Free Full Text]
|
| 11.
|
Miyoshi, I.,
Kubonishi, I.,
Yoshimoto, S.,
Akagi, T.,
Ohtsuki, Y.,
Shiraishi, Y.,
Nagata, K.,
and Hinuma, Y.
(1981)
Nature
294,
770-771[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Gazdar, A. F.,
Carney, D. N.,
Bunn, P. A.,
Russell, E. F.,
Jaffe, E. S.,
Schecter, G. P.,
and Guccion, J. G.
(1980)
Blood
55,
409-412[Free Full Text]
|
| 13.
|
Chen, C.,
and Okayama, H.
(1987)
Mol. Cell. Biol.
7,
2745-2752[Abstract/Free Full Text]
|
| 14.
|
Neumann, J. R.,
Morency, C. A.,
and Russian, K. O.
(1987)
BioTecniques
5,
444-447
|
| 15.
|
Andrews, N. C.,
and Faller, D. V.
(1991)
Nucleic Acids Res.
19,
2499[Free Full Text]
|
| 16.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489[Abstract/Free Full Text]
|
| 17.
|
Hope, T. J.,
Bond, B. L.,
McDonald, D.,
Klein, N. P.,
and Parslow, T. G.
(1991)
J. Virol.
65,
6001-6007[Abstract/Free Full Text]
|
| 18.
|
Diaz, J. J.,
Duc Dodon, M.,
Schaerer-Uthurralt, N.,
Simonin, D.,
Kindbeiter, K.,
Gazzolo, L.,
and Madjar, J. J.
(1996)
Nature
379,
273-277[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Unge, T.,
Solomin, L.,
Mellini, M.,
Derse, D.,
Felber, B.,
and Pavlakis, G. N.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
7145-7149[Abstract/Free Full Text]
|
| 20.
|
Shukla, R. R.,
Kimmel, P. L.,
and Kumar, A.
(1994)
J. Virol.
68,
2224-2229[Abstract/Free Full Text]
|
| 21.
|
Burd, C. G.,
and Dreyfuss, G.
(1994)
EMBO J.
13,
1197-1204[Medline]
[Order article via Infotrieve]
|
| 22.
|
Bogerd, H. P.,
Fridell, R. A.,
Benson, R. E.,
Hua, J.,
and Cullen, B. R.
(1996)
Mol. Cell. Biol.
16,
4207-4214[Abstract]
|
| 23.
|
Fornerod, M.,
Ohno, M.,
Yoshida, M.,
and Mattaj, M.
(1997)
Cell
90,
1051-1060[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Stade, K.,
Ford, C. S.,
Guthrie, C.,
and Weiss, K.
(1997)
Cell
90,
1041-1050[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Dreyfuss, G.,
Matunis, M. J.,
Pinol-Roma, S.,
and Burd, C. G.
(1993)
Annu. Rev. Biochem.
62,
289-321[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Kiledjian, M.,
Burd, C. G.,
Görlach, M.,
Portman, D. S.,
and Dreyfuss, G.
(1996)
in
RNA-Protein Interactions
(Nagai, K.
, and Mattaj, I. W., eds)
, pp. 127-149, Oxford University Press, New York
|
| 27.
|
Pinol-Roma, S.,
and Dreyfuss, G.
(1992)
Nature
355,
730-732[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Caceres, J. F.,
and Krainer, A. R.
(1997)
in
Eukaryotic mRNA Processing
(Krainer, A. R., ed)
, pp. 174-212, IRL Press, Oxford, United Kingdom
|
| 29.
|
Del Gatto-Konczak, F.,
Olive, M.,
Gesnel, M. C.,
and Breathnach, R.
(1999)
Mol. Cell. Biol.
19,
251-260[Abstract/Free Full Text]
|
| 30.
|
Izaurralde, E.,
Jarmolowski, A.,
Beisel, C.,
Mattaj, I. W.,
and Dreyfuss, G.
(1997)
J. Cell Biol.
137,
27-35[Abstract/Free Full Text]
|
| 31.
|
Michael, W. M.,
Choi, M.,
and Dreyfuss, G.
(1995)
Cell
83,
415-422[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Black, A. C.,
Ruland, C. T.,
Luo, J.,
Bakker, A.,
Fraser, J. K.,
and Rosenblatt, J. D.
(1994)
Virology
200,
29-41[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Black, A. C.,
Luo, J.,
Watanabe, C.,
Chun, S.,
Bakker, A.,
Fraser, J. K.,
Morgan, J. P.,
and Rosenblatt, J. D.
(1995)
J. Virol.
69,
6852-6858[Abstract]
|
| 34.
|
Caputi, M.,
Mayeda, A.,
Krainer, A. R.,
and Zahler, A. M.
(1999)
EMBO J.
18,
4060-4067[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Najera, I.,
Krieg, M.,
and Karn, J.
(1999)
J. Mol. Biol.
285,
1951-1964[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Shi, S. T.,
Huang, P., Li, H. P.,
and Lai, M. M. C.
(2000)
EMBO J.
19,
4701-4711[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Grassmann, R.,
Berchtold, S.,
Aepinus, C.,
Ballaun, C.,
Böhnlein, E.,
and Fleckenstein, B.
(1991)
J. Virol.
65,
3721-3727[Abstract/Free Full Text]
|
| 38.
|
Ballaun, C.,
Farrington, G. K.,
Dobrovnik, M.,
Rusche, J.,
Hauber, J.,
and Böhnlein, E.
(1991)
J. Virol.
65,
4408-4413[Abstract/Free Full Text]
|
| 39.
|
Gröne, M.,
Hoffmann, E.,
Berchtold, S.,
Cullen, B. R.,
and Grassmann, R.
(1994)
Virology
204,
144-152[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Si, Z.,
Amendt, B. A.,
and Stoltzfus, C. M.
(1997)
Nucleic Acids Res.
25,
861-867[Abstract/Free Full Text]
|
| 41.
|
Li, H. P.,
Zhang, X.,
Duncan, R.,
Comai, L.,
and Lai, M. M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
9544-9549[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
V. Beriault, J.-F. Clement, K. Levesque, C. LeBel, X. Yong, B. Chabot, E. A. Cohen, A. W. Cochrane, W. F. C. Rigby, and A. J. Mouland
A Late Role for the Association of hnRNP A2 with the HIV-1 hnRNP A2 Response Elements in Genomic RNA, Gag, and Vpr Localization
J. Biol. Chem.,
October 15, 2004;
279(42):
44141 - 44153.
[Abstract]
[Full Text]
[PDF]
|
|
|
TOP
ABSTRACT
INTRODUCTION
