|
Originally published In Press as doi:10.1074/jbc.M109578200 on March 8, 2002
J. Biol. Chem., Vol. 277, Issue 21, 18840-18848, May 24, 2002
New Alternatively Spliced Form of Galectin-3, a Member
of the -Galactoside-binding Animal Lectin Family, Contains a
Predicted Transmembrane-spanning Domain and a Leucine Zipper
Motif*
Jeff P.
Gorski §¶,
Fu-Tong
Liu ,
Antonio
Artigues**,
Leonardo F.
Castagna , and
Philip
Osdoby§§
From the Division of Molecular Biology and
Biochemistry, School of Biological Sciences, and
§ Department of Oral Biology, Dental School, University of
Missouri-Kansas City, Kansas City, Missouri 64110, the
Department of Dermatology, University of California, Davis,
School of Medicine, Sacramento, California 95817, the ** Mass
Spectrometry Core Facility, School of Biological Sciences, University
of Missouri-Kansas City, Kansas City, Missouri 64110, the
 Agencia Córdoba Ciencia SE-Unidad
Center of Excellence in Products and Processes of the Province of
Cordoba, Cordoba 9420, Argentina, and the
§§ Department of Biology, Washington University,
St. Louis, Missouri 63130
Received for publication, October 3, 2001, and in revised form, March 8, 2002
 |
ABSTRACT |
Osteoclasts or their
precursors interact with the glycoprotein-enriched matrix of bone
during extravasation from the vasculature, and upon attachment prior to
resorption. Reverse transcriptase-PCR studies showed that two new
alternatively spliced forms of chicken galectin-3, termed Gal-3TM1 and
Gal-3TR1, were enriched and preferentially expressed in highly purified
chicken osteoclast-like cells. Gal-3TM1 and Gal-3TR1 mRNA were also
detected in chicken intestinal tissue, but not in kidney, liver, or
lung. Gal-3TM1 and Gal-3TR1 messages both contain an open reading frame
encoding a predicted 70-amino acid TM1 sequence inserted between the
N-terminal Gly/Pro repeat domain and the carbohydrate recognition
domain (exons 3 and 4). Gal-3TR1 mRNA contains an additional 241-bp
sequence, which encodes a truncated open reading frame between
the 4th and 5th exons, and, whose translation is expected to terminate
within the carbohydrate recognition domain encompassing exons 4, 5, and
6. Immunoblotting and affinity chromatography showed that purified
osteoclast preparations and intestinal homogenates contained a 36-kDa
lactose-binding galectin. Matrix-assisted laser desorption/ionization
time-of-flight mass spectrometric analyses on chymotryptic peptides
from the 36-kDa lectin confirmed its identity as Gal-3TM1. The TM1
insert contains a single transmembrane-spanning region and a leucine zipper-like stalk domain that is predicted to position the intact carbohydrate recognition domain of Gal-3TM1 on the exterior surface of
the plasma membrane. Immunofluorescent staining of chicken osteoclasts
confirmed the expression of Gal-3TM1 at the plasma membrane. Gal-3TM1
is the first example of a galectin superfamily member capable of being
expressed as a soluble protein and as a transmembrane protein.
 |
INTRODUCTION |
Carbohydrate on the outer membrane surface of cells has
long been suggested as a determinant of specific cell-cell and
cell-matrix recognition. In bone, carbohydrate receptors on osteoclasts
and osteoclast precursors could play a functional role in mediating cell-matrix interactions. Osteoclasts arise from mononuclear
hematopoietic precursors in bone marrow and share the same stem cell
origin as granulocytes and monocyte/macrophages. A variety of
carbohydrate receptors are known to be expressed by
monocyte/macrophages, including selectins (1), galectin-3 (Mac-2,
IgEBP) (2), mannose receptor (3), and sialoadhesin (4). To resorb bone,
osteoclast precursor cells must leave the vasculature, crawl to the
resorption site, fuse with other precursors, and attach to the bone
surface delimiting the area of bone to be resorbed and form a sealing
zone. Most research on osteoclast attachment has focused on the
vitronectin receptor and its -RGD- containing ligands (5-9). Although
these studies clearly demonstrate that the vitronectin receptor and its
ligands play an important role in osteoclast attachment, several pieces
of conflicting data are most easily explained by the existence of one
or more additional cell adhesion receptors (7, 10, 11).
The vascular basement membrane contains the glycoprotein
laminin, whereas primary bone matrix contains two major glycoproteins, bone sialoprotein (12) and
BAG-751 (13). Sato et
al. (14) showed that BAG-75 was able to block bone resorption by
an RGD-independent mechanism when either added directly to osteoclasts
and bone slices, or adsorbed first to the bone target prior to addition
of osteoclasts. Colucci et al. (15, 16) also showed that
osteoclasts bind to laminin by means of an RGD-independent mechanism.
Kukita et al. (17) found surface-adsorbed laminin was able
to block osteoclast differentiation in rat bone marrow cultures.
Finally, Niida et al. (18) and Takahashi et al.
(19) were the first to demonstrate that galectin-3 was expressed by
osteoclasts and TRAP-positive mononuclear precursors. Galectin-3 is the
major non-integrin laminin binding protein of macrophages (20), which
share a common lineage with osteoclasts. Galectin-3 is a galectin
superfamily member and displays a single carbohydrate recognition site
specific for galactose-containing oligosaccharides. Galectin-3, which
lacks a conventional signal sequence or transmembrane spanning domain,
is secreted by a non-endoplasmic reticulum/Golgi route (21), where it
commonly associates as a dimer with cell surfaces through one
carbohydrate recognition domain. Galectin-3 exhibits diverse functions,
e.g. in pre-RNA splicing (22), binding of circulating or
extracellular matrix glycoproteins like IgE or Mac-2 binding protein on
cell surfaces (23, 24), and as a regulator of apoptosis and cell growth
(25). Taken together, these data suggest a potential role for
galectin-3 in osteoclast function.
This study was undertaken to characterize the structural and functional
properties of lectins expressed by osteoclastic precursor cells and
osteoclasts in bone. Primary isolates of chicken osteoclasts were used
as a source of mRNA for RT-PCR, because the 121F monoclonal antibody based immunoaffinity method produces highly enriched populations (26). We report here characterization of two new alternatively spliced sequences of galectin-3 expressed exclusively by
chicken osteoclasts, Gal-3TM1 (galectin-3 containing
transmembrane-spanning region and leucine zipper motif) and Gal3-TR1
(galectin-3 containing transmembrane-spanning region, leucine zipper
motif, and truncated carbohydrate recognition domain).
 |
EXPERIMENTAL PROCEDURES |
Materials
Custom synthetic oligonucleotides were purchased from IDT, Inc.
(Coralville, IA). Chicken galectin-3 (27) primers used were defined by
numbers as follows (see also Fig. 1B for diagram): 1)
CCAATCCGTGTAACACCAATCAAGG; 2) GAATTCAAGGGACTTTTGGGCTCTCAGCAC; 3)
TTCAGAGTACGGTGCAGTTGGTCC; 4) TGGTGTTAGGCAGAACAGCACGTT; 5)
TCACAGTCCCCGTGATGGTTATGAG; 6) CTGCCTAACACCAAATCCCTGTC; 7)
CAAATCCCTGTCCTCTCCAGAAAG; 8) TGCTCCAGAACAATCGCACG; 9)
TGTCGAGACAGTATAAAATTCCCA. Human galectin-3 (28) primers: 11)
TGATGCGTTATCTGGGTCTG (#42-61); 12) AAGCACTGGTGAGGTCTATGTC (#754-733);
mouse galectin-3 (29) primers: 13) AGAGCACTACCCAGGAAAATG (#26-46); 14)
TAGGTGAGCATCGTTGACCG (739-720); rat galectin-3 (30) primers: 15)
GCACTAACCAGGAAAATGGCAGACG (#26-50); 16) CGCTCATAACACACAGGGCAGTTC (#877-854).
Sprague-Dawley male rats (250-275 g) were purchased from Sasco Inc.
(Willington, MA); access to food (Purina #5001 laboratory chow) and
water was unrestricted. Pathogen-free laying chickens were obtained
from Sparfass and maintained on a calcium-deficient diet as described
earlier (31). Frozen chicken kidneys were obtained from Pel-Freez Inc.
Methods
In Vitro Differentiation of Osteoclast-like Cells in Marrow
Cultures--
Marrow cells were isolated from segments of chicken,
mouse, and rat long bones, and osteoclast-like cells were produced by differentiation during culture of marrow cells according to a conventional protocol (32). Marrow cells were also prepared from
segments of human long bones obtained as surgical waste by clinical
collaborators at Washington University Medical Center; osteoclast-like
cells were produced in vitro as described by Kukita et
al. (33).
Isolation of Total RNA and Northern Blotting--
Total RNA was
isolated from purified chicken osteoclasts, marrow-derived
osteoclast-like cells, and fresh 4-week-old chick tissues using an
Ultraspec II total RNA kit (Biotecx Laboratories, Inc.). Northern
blotting followed a conventional protocol. Fifteen micrograms of
RNA/lane was electrophoresed on 1.0% agarose gels containing 0.04 M MOPS buffer (pH 7.0), 0.01 M sodium acetate, 1 mM EDTA, and 6.7% formaldehyde. Gels were then briefly
soaked in 20× SSC, blotted onto nylon membranes (Immobilon, Millipore, Inc.) in 20× SSC, and UV-cross-linked. A second identical gel was also
run and visualized with EtBr. Blots were pre-hybridized with Northern
Lights Prehybridization solution (Ambion, Inc.) at 42 °C for at
least 90 min. cDNA probes were radiolabeled with [ -32P]dATP (3000 Ci/mmol) by incubation with Klenow
fragment, dNTP mix, and specific primers. Free un-incorporated
nucleotides were removed, and labeled probes were then hybridized with
Northern blots for 15-18 h at 42 °C. Blots were washed twice with
3× SSC/0.1% SDS for 15 min at 42 °C and then twice with 0.5×
SSC/0.1% SDS for 15 min at 60 °C prior to phosphorimaging with a
Storm system (Molecular Dynamics, Inc.) or autoradiography.
RT-PCR--
In initial work, total RNA was isolated from chicken
giant cells derived from bone marrow cells cultured for 5 days (31). The reverse transcriptase step was carried for 50 min at 42 °C using
an oligo(dT)12-18 primer and Moloney murine leukemia virus
RNase H reverse transcriptase (Invitrogen, Inc.). After inactivation of the transcriptase, the cDNA was used as a template in PCR with chicken galectin-3 primers 1 and 5 (see
"Materials").
In subsequent studies, total RNA was purified from osteoclasts and
tissues isolated from chicks according to Collin-Osdoby et
al. (26). This procedure, which includes an immunoaffinity purification step with osteoclast-specific 121F antibody, produces >95% pure osteoclast preparations. RNA was then digested with DNase I
(15-40 min at 30 °C) and cDNA produced using an oligo(dT) primer and SuperScript II reverse transcriptase according to a protocol
provided by the supplier (Invitrogen). This reaction mixture and
associated control mixture (without reverse transcriptase) were then
treated with RNase H for 20 min at 37 °C and used as templates in
PCR runs.
Synthesis and Cloning of TM1 Insert cDNA Sequence--
Two
partially overlapping oligonucleotides of 105 and 107 bp representing
the majority of the TM1 insert sequence were chemically synthesized and
purified by polyacrylamide gel electrophoresis (IDT, Inc.). The oligos
were filled in by incubating with 4 units of Klenow fragment (Roche
Molecular Biochemicals), the enzyme was then heat-inactivated at
75 °C, and this double-stranded template was diluted 1/50 and used
in a polymerase chain reaction with specific primers (#9 and 4, see
"Materials"). A resultant band of 197 bp was isolated and labeled
as described above and used for Northern blotting.
Analysis of Hydrophobicity--
Hydrophobicity analyses were
carried out by applying the TMPred (35) and TopPred2 (36) programs to
galectin-3TM1 and other protein sequences of interest.
Marrow Ablation Surgery and Immunohistochemical Staining of
Primary Bone or Purified Osteoclasts--
Rats were anesthetized, and
bilateral tibial marrow ablation was performed as described by Gorski
et al. (37). Tibias were removed intact from rats on days
8-10 following ablation surgery and fixed/decalcified for 2 days in
Bouin's solution and then for 6-10 days in 4% formaldehyde
containing 0.85% sodium chloride and 10% acetic acid (changing the
latter solution every 2 days). Longitudinal sections of ablated tibias
were immunostained using an affinity-purified rabbit anti-rat
galectin-3 antibody (4 µg/ml IgG) (38) and a Vectastain ABC goat
secondary antibody kit with a glucose oxidase detection system and
colorimetric substrate kit (Vector Laboratories, Inc.). In some cases,
sections were also either double- or single-stained for TRAP (Sigma
Chemical Co.) following instructions from the supplier.
Purified chicken osteoclasts were fixed briefly in 3% (w/v)
paraformaldehyde in Hanks' balanced salt solution, permeabilized with
0.5% (w/v) Triton X-100 in 20 mM HEPES, 300 mM
sucrose, 50 mM sodium chloride, 3 mM magnesium
chloride, and then blocked 30 min in 1% bovine serum albumin in
phosphate-buffered salt solution. Cells were incubated with primary
anti-chicken retinal galectin antibodies (1/200), rinsed, incubated
with fluorescein-conjugated secondary antibodies, rinsed again, and
then stained with 0.3 µg/ml 4',6-diamidino-2-phenylindole (Molecular
Probes, Inc.) prior to viewing. Alternatively, purified chicken
osteoclasts were cultured overnight after isolation and then
surface-labeled without permeabilization as follows. After rinsing with
warm Hanks' balanced salt solution, cells were fixed in the cold for
15 min, rinsed with phosphate-buffered saline, and then blocked for
1 h as described above. Cells were sequentially incubated with
anti-chicken retinal galectin antibodies (1/200), rinsed with
phosphate-buffered saline, stained with (1/250) biotinylated secondary
antibody (goat anti-rabbit IgG) (Invitrogen) in blocking solution,
rinsed with phosphate-buffered saline, and then incubated in the dark
with (1/1000) fluorescence isothiocyanate-labeled streptavidin in
blocking solution. After rinsing with phosphate-buffered saline, cells
were either visualized directly or after incubation with 4 units/ml
phalloidin-Texas Red (Molecular Probes, Inc.) in phosphate-buffered
saline and then rinsing away excess stain. Slides with stained cells
were mounted with buffered glycerol mounting media and viewed with a
Leica confocal photomicroscope; fluorescein and Texas Red were
visualized using excitation and emission wavelength combinations of
494/518 nm and 595/615 nm, respectively.
Immunoblotting of Tissue/Cell Homogenates--
Adult chicken
kidneys (Pel-Freez, Inc.) or fresh-frozen intestines from
4-week-old, calcium-deficient chicks were homogenized with buffer A (75 mM potassium phosphate buffer (pH 7.2), containing 10 mM CHAPS, 75 mM sodium chloride, 2 mM EDTA, 10 mM benzamidine HCl, 2 mM dithiothreitol, 0.02% sodium azide, and 150 mM lactose as modified from (39)), and the homogenate was
denatured in solubilization solution containing inhibitors (40) and an
excess of reducing agent before electrophoresis on 4-20% gradient
gels (Gradipore, Ltd.). Purified chicken osteoclasts were denatured as
described above and electrophoresed. Gels were electroblotted onto a
PVDF-P membrane (Millipore, Inc.) and blocked. Blots were processed for
colorimetric immunodetection by incubation with (1/500) rabbit
anti-chicken liver anti-CLL I (C-16) lactose lectin antibody #1
(prepared by immunization with native protein) or #2 (prepared by
immunization with denatured protein) (41, 42) and (1/3000) horseradish
peroxidase-conjugated goat anti-rabbit IgG antibodies (Bio-Rad, Inc.)
(40). A positive control sample of kidney C-16 lectin was routinely
included on each gel and blot.
Purification of Lectins on Lactosyl-Sepharose--
Intestines (1 intestine/6 ml), kidneys (20 g/40 ml), or purified chicken osteoclasts
(0.6-ml cell pellet/15 ml) were homogenized and extracted at 4 °C
with buffer A and then centrifuged at 108,000 × gmax for 90 min. The supernatant fraction was
dialyzed against buffer A lacking lactose and then chromatographed on a
small column of lactosyl-Sepharose 4B (1-ml bed volume) (39). Unbound
material was removed from the column with 80 ml of buffer A lacking
lactose, and the bound fraction was eluted with buffer A. Selected
fractions were boiled with 0.1% (w/v) SDS and then dialyzed
individually against 0.05% SDS in water prior to lyophilization to
dryness (40). Samples then solubilized and electrophoresed on gradient gels. Gels were stained with Coomassie Brilliant Blue dye.
MALDI-TOF Mass Spectrometric Analysis of In-gel Protease
Digests--
Coomassie Blue-stained gel bands were cut out of
polyacrylamide gels, pooled, and processed for trypsin or chymotrypsin
in-gel digestion (43, 44). Peptides were sequentially extracted from gel pieces with water and with 50% acetonitrile-5% formic acid; pooled extracts were concentrated prior to spotting onto plates. MALDI
mass spectra of peptide digests were acquired on a Voyager DE PRO
reflectron time-of-flight mass spectrometer (Applied
Biosystems), using -cyano-4-hydroxycinnamic acid (10 mg/ml) as the
matrix (43, 44). Spectra were baseline-corrected and mass calibration applied using external standard (0.05% accuracy). The most intense ions on the spectrum and those with a signal-to-noise ratio of 45 and a
resolution of better than a 1000 were selected for data base screening
with the Protein Prospector program (MS-Fit) (Regents of the University
of California). Data base searching with MS-Fit was performed
using the following parameters: Species was restricted to Gallus
gallus, protein molecular mass range was 25-40 kDa, chymotryptic digest (with one to three missed cleavages), and cysteines
were modified by acrylamide and oxidation of methionines. Mass
tolerance used was ±0.05% based on external calibration.
 |
RESULTS |
Chicken Osteoclasts Preferentially Express Larger Alternatively
Spliced Forms of Galectin-3 mRNA--
As shown in Fig.
1A (left panel),
RT-PCR studies with RNA from marrow-derived chicken osteoclasts yielded
a larger than expected 753-bp product for galectin-3. A diagram
indicating the position of primers used in relation to the published
chicken galectin-3 sequence (27) is shown in Fig. 1B. A band
at 543 bp, the predicted product size, was barely detectable (Fig.
1A, left panel).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 1.
RT-PCR results demonstrate two new
alternatively spliced variants of chicken galectin-3.
A, summary of RT-PCR results with chicken giant cell or
osteoclast RNA. Left panel, initial demonstration of the
210-bp TM1 insert using giant cell RNA and primers 1 and 5 (see
"Materials" for detailed description). Expected 543-bp cDNA for
Gal-3 mRNA represents minor product. Middle panel,
demonstration that 634-bp cDNA containing the TM1 insert is
dependent upon reverse transcriptase step. Right panels,
identification of two TM1-insert-containing messages, 534 and 765 bp,
expressed by highly purified osteoclasts. EtBr, ethidium
bromide stained; Autorad, autoradiograph with
32P-labeled Gal-3TM1 probe. Numbers below gels
refer to primer pairs used (see "Materials"). B, models
comparing the sequences of Gal-3TM1 and Gal-3TR1 with that for
galectin-3. Thicker regions represent the TM1 and TR1
alternatively spliced insert sequences. Numbers above and
below the line refer to forward and reverse primers,
respectively, used in RT-PCR studies (see "Materials").
|
|
When the 753-bp cDNA product was subjected to automated DNA
sequencing, a nearly complete identity was observed with the published chicken galectin-3 sequence (27) and extended from position 330 (near
the translation start site) to 800 bp (Fig.
2). Only a single silent base
substitution (G for A) was noted at position 722. However, an
additional 210-bp open reading frame was found to be inserted between
positions 770 and 771 of the chicken galectin-3 sequence (Fig. 2).
Although the genomic structure of the chicken galectin-3 gene has yet
to be determined, this region is the site of the junction between the
third and fourth exons in both the human and mouse Lgals3
genes (45, 46) (Fig. 2). We designated this 210-bp open reading frame
as insert TM1 and carried out additional studies to confirm that
Gal-3TM1 was derived from expressed sequence.

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2.
cDNA and translated protein
sequences for chick Gal-3TM1 and Gal-3TR1 isoforms. As described
under "Methods," cDNAs were produced by RT-PCR with mRNA
isolated from highly purified chicken osteoclasts and sequenced.
Sequences were aligned using a ClustalW analysis (MacVector program,
version 7.0) and regions of identity denoted by the boxed
areas. The Gal-3TM1, Gal-3TR1, and chicken galectin-3 nucleic acid
sequences are enclosed within a box outlined by dashed
lines. Translated protein sequences are located immediately below
each corresponding section of nucleic acid sequence and are compared
with that for human galectin-3; these four protein sequences are
enclosed within a box with solid borders.
Numbers on the right side refer to the Gal-3TM1
cDNA and protein sequences, whereas numbers on the
left refer to the chicken galectin-3 sequences. Numbering of
the cDNA sequences, which starts at 333 bp, is based upon that for
the published chicken galectin-3 mRNA sequence (27). The limits of
individual exons for the human gene (45) are noted by arrows
immediately below the human galectin-3 protein sequence; individual
exons are identified by number. For comparison, the limits
of the chicken TM1 and TR1 exons are also depicted by
arrows. Chic Gal-3, chicken galectin-3; Hum
Gal-3, human galectin-3; TM1, additional 210-bp open
reading frame inserted between positions 770 and 771 of galectin-3
sequence; and TR1, additional 241-bp sequence inserted
between positions 1069 and 1070 of Gal-3TM1 and encoding the 11-residue
truncated carbohydrate recognition domain.
|
|
Subsequently, use of RNA from highly purified chicken osteoclast
preparations (26) consistently yielded RT-PCR products with the partial
Gal-3TM1 sequence (Fig. 1A, middle panel). No products were obtained in the absence of reverse transcriptase, indicating a dependence upon mRNA template, rather than
contaminating DNA. Finally, when a 634-bp product produced with a
Gal-3TM1-specific primer (Fig. 1A, middle panel)
was sequenced, the expected TM1 sequence was obtained (Fig. 2).
As illustrated in Fig. 1A after ethidium bromide staining
(EtBr, right panel), RT-PCR analysis of the
3'-end of the coding region (using primer pairs 6 + 8 and 7 + 8, see
"Materials") of the chicken osteoclast galectin-3TM1 message
identified two major products, a predicted 534-bp cDNA and an
unexpected 765-bp band, as well as a larger minor form. Controls
without added reverse transcriptase were blank. All three products
contained the TM1 insert as evidenced by Southern blotting with this
probe (Fig. 1A, Autorad, rightmost
panel). The sequence of the 534-bp cDNA overlapped with the
terminal 20 bp of the TM1 insert and then displayed nearly complete
identity with positions 772-1259 of the chicken galectin-3 sequence
(Fig. 2). Only four changes were identified. The first three of these
purine substitutions proved silent, whereas the 3'-most terminal
substitution resulted in a Gly to Glu change (predicted 6th exon). The
765-bp cDNA sequence was identical with that for Gal-3TM1, except
for an extra 241-bp insert (designated TR1), which followed the TM1 by
89 bp, and an A to G silent substitution on the 3'-side of the
insertion site (Fig. 2). Comparisons with genomic human and mouse
Lgals3 sequences predict that Gal-3TR1 protein should
terminate 11 residues after the 4th exon and contain only a partial
carbohydrate recognition domain encoded within the 4th, 5th, and 6th
exons (47).
Northern blotting was carried out to determine if the expression of
galectin-3, galectin-3TM1, or galectin-3TR1 changes during differentiation of osteoclast-like cells in marrow cultures. RNA was
isolated from marrow cultures on day 1 (representing replication phase)
and on day 5 (representing the differentiation phase) when osteoclast-like cells are present. In contrast to an earlier size estimate of chicken chondrocyte galectin-3 of 1.3 kb (27), Northern blots revealed two larger bands at 2.0 kb (Gal-3-TR1) and 1.5 kb
(Gal-3TM1) (Fig. 3, left
panel). However, a low level of expression of the 1.3-kb Gal-3
message would be difficult to detect in the presence of an excess of
the 1.5-kb species. Expression of the 1.5- and 2.0-kb forms was found
to rise dramatically in cultures treated for 5 days with vitamin D3 and
UMR-106 osteoblast cell-conditioned media, conditions that foster
differentiation of osteoclast-like cells displaying multinuclearity,
TRAP activity, and possessing the capacity to resorb bone (32, 33).
Importantly, the 1.5- (Gal-3TM1) and 2.0-kb (Gal-3-TR1) bands both
hybridized specifically with a TM1-specific probe (Fig. 3, right
panel). Taken together with the RT-PCR results and cDNA
sequences presented in Figs. 1A and 2, the Northern blotting
results document that chicken osteoclast-like cells preferentially
express new alternatively spliced messages for galectin-3TM1 and
galectin-3TR1.

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of Gal-3TM1 and Gal-3TR1 increases
during osteoclast differentiation in culture. Total RNA was
isolated from chicken marrow cultures on days 1 and 5 and
Northern-blotted onto nylon, and the resultant membranes were
hybridized with 32P-labeled Gal-3 or TM1 cDNA probe as
described under "Methods." The left and right
panels represent separate replicate blots hybridized with
radiolabeled probes for either chicken galectin-3 or the TM1 insert,
respectively. The middle panel depicts a similarly loaded
gel stained with ethidium bromide. Size estimates were made by
reference to the migration positions of 28 and 18 S rRNA bands.
|
|
Chicken Intestinal Tissue Also Expresses Galectin-3TM1--
To
determine whether expression of galectin-3 splice variants was
restricted to specific tissues, total RNA was isolated from 4-week-old
chick liver, lung, kidney, and intestinal tissues, and, used in RT-PCR
studies with galectin-3TM1/Gal-3TR1-specific or galectin-3-specific
primer pairs (Fig. 4). Replicate analyses indicate that Gal-3TM1 and Gal-3TR1 messages were expressed in intestine but not liver, lung, or kidney tissue (Fig. 4A).
By comparison, galectin-3 expression was detectable in intestine and
kidney (Fig. 4B).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 4.
Messages for Gal-3TM1 and Gal-3TR1 exhibit
restricted tissue expression. A, RT-PCR with splice
variant-specific primer pair reveals that Gal-3TM1 and Gal-3TR1 are
expressed in chicken intestine, but not liver, lung, or kidney tissue.
RT-PCR with total RNA used primers 6 and 8 (see "Materials"); see
"Methods" for experimental details. B, parallel studies
with galectin-3-specific primer pair detects expression in all four
chicken tissues, although the level in intestine and kidney seems
higher than that for liver and lung. RT-PCR with total RNA used primers
2 and 3 (see "Materials"). +, RT-PCR with reverse transcriptase;
, negative control without reverse transcriptase; Intest,
intestine.
|
|
Rat, Human, and Mouse Osteoclast-like Cells Express Galectin-3 but
Not Galectin-3TM1--
RNA was prepared from human and mouse
marrow-derived osteoclast-like cell cultures and used to evaluate
whether homologous galectin-3TM1 splice variants were expressed (Fig.
5). In addition, total RNA was also
isolated from primary bone undergoing active resorption in the rat
marrow ablation model (37) and processed similarly. Primers were
prepared from comparable regions of the human (28), mouse (29), and rat
(30) galectin-3 sequences and used in RT-PCR or 5'-RACE analyses.
Resultant cDNAs (Fig. 5) were subjected to automated DNA sequencing
to confirm their identity. Although these reactions all yielded
galectin-3 message, human and mouse osteoclast-like cells did not
express alternatively spliced insert sequences analogous to chicken TM1
and TR1. Although the third intron of the human Lgals3 gene
contains several open reading frames (>120 bp), BLAST searches failed
to detect a homologous TM1 insert sequence, possibly because of the
large intra-species sequence differences (not shown). Additional bands
were detected in 5'-RACE reactions with rat RNA (Fig. 5); however,
sequencing failed to yield a galectin-3-related product.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
Human, mouse, and rat osteoclast-like cells
express galectin-3 but not Gal-3TM1 and Gal-3TR1. Total RNA was
either isolated from cultures of human and mouse marrow-derived
osteoclast-like cells or from day 9 rat marrow ablation tissue enriched
in osteoclasts, and used for RT-PCR (human/mouse) or 5'-RACE (rat) with
species-specific Gal-3 primer pairs as described in "Methods."
Primer pairs were selected on the basis of paired alignments with the
chicken galectin-3 sequence to encompass the region expected to contain
the TM1 insert. Identity of expected galectin-3 cDNAs of 713 bp
(human), 712 bp (mouse), and 851 bp (rat) was confirmed by sequencing;
additional larger band (1350 bp) obtained after 5'-RACE (rat) proved
not to be Gal-3TM1 or Gal-3TR1. +, RT-PCR with reverse transcriptase;
, negative control without reverse transcriptase.
|
|
Chick Osteoclasts and Intestinal Cells Contain Gal-3TM1
Protein--
Additional biochemical studies were carried out to
establish the existence of Gal-3TM1 protein (estimated molecular weight of 36,000). As shown in Fig.
6A, a whole homogenate of
chick intestine and osteoclast preparations contain a 36-kDa Gal-3TM1
band reactive with two separate anti-chicken CLL I (C-16) lectin
antisera (41). A second, 14-kDa band was detected only in intestinal
homogenates, but not whole osteoclast fractions. These polyclonal
antibodies were shown previously to cross-react with porcine galectin-3
(42). Sequence alignment between CLL I (48) and chicken galectin-3 or
Gal-3TM1 reveals a 28% identity over homologous regions (data not
shown), a degree of homology consistent with partial cross-reactivity. Whole kidney homogenate, which expressed galectin-3 but not Gal-3TM1 message (Fig. 4), contains a 29-kDa presumptive galectin-3 band and a
16-kDa CLL I band instead (Fig. 6A). Due to heavy Coomassie Blue staining, it is not possible to make conclusions about the relative enrichment of these bands within homogenate fractions (not
shown). However, when a CHAPS-solubilized 100,000 × g
supernatant derived from either chick intestine or purified osteoclasts
was subjected to affinity chromatography on lactosyl-Sepharose 4B, the
36-kDa protein was found to bind specifically and eluted with lactose
(Fig. 6B). The osteoclast-derived lactose-eluate did not contain 14- to 16-kDa lectins detectable by protein staining, however,
a small amount of intestinal 14-kDa lectin was also purified by this
step (Fig. 6B). When a kidney supernatant fraction was treated similarly, the lactose-eluate contained predominantly the
16-kDa CLL I lectin along with a trace amount of the 29-kDa band (Fig.
6B). The identities of gel-purified lectin bands were then
analyzed by mass spectrometry on peptide digests.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 6.
Purified chicken osteoclasts and whole
intestinal homogenate contain functionally active 36-kDa galectin-3TM1
protein, whereas kidney homogenate does not. All results depicted
were obtained with 4-20% gradient SDS gels (see "Methods").
A, Western blots of whole homogenates of chick kidney,
intestine, and purified osteoclast preparations reveal 36-kDa Gal-3TM1
band cross-reactive with two polyclonal anti-chicken CLL I lectin
antibodies. Intestine also contains 14-kDa immunoreactive band, whereas
kidney homogenate contains 29- and 16-kDa bands. B,
purification of osteoclast- and intestine-derived 36-kDa Gal-3TM1 by
lactosyl-Sepharose affinity chromatography. The Coomassie Blue-stained
fractions depicted all represent the pooled lactose eluate fraction
from their respective chromatographic runs (see "Methods" for
details). The kidney preparation contains predominantly CLL I and a
trace of 29-kDa lectin, whereas the intestinal preparation contains
primarily 36-kDa Gal-3TM1 and a small amount of 14-kDa lectin. The
osteoclast-derived eluate contains only the 36-kDa Gal-3TM1 band.
Individual bands shown were subsequently cut out, digested in the gel
with trypsin or chymotrypsin, and analyzed by MALDI-TOF mass
spectrometry. Kid, kidney-derived; Int,
intestine-derived; OC, osteoclast-derived; CLL I,
16-kDa galectin; 1, result with antibody prepared by
immunization with native CLL I; 2, result with antibody
prepared by immunization with denatured CLL I; and, 14 kDa,
band identified as CLL II by size and MALDI-TOF.
|
|
MALDI-TOF analysis on chymotryptic peptides derived from the 36-kDa
intestinal lectin is summarized in Table
I. Nineteen predicted peptide
masses for Gal-3TM1, including seven from the TM1 region, were found to
match with experimental peaks and together comprise a 41% coverage of
this sequence. When the Gal-3TM1 sequence was added to the NCBI data
base, an MS-Fit search of all chicken proteins of 25- to 40-kDa found
Gal-3TM1 to yield the highest number of peptide masses matched and the
second highest MOWSE (molecular weight search peptide-mass database)
score. Galectin-3 was ranked 9th based on the number of peptide masses
matched with the 36-kDa lectin band. In a similar way (results not
shown), the 16-kDa kidney lectin (Fig. 6, right panel ) was
identified as CLL I (16-kDa lectin, CG-16; accession number P23668)
(48). Also, the peptide mass spectrum and size of the 14-kDa intestinal lectin are consistent with that predicted for CLL II (C-14 lectin, accession number AAA48779) (not shown). CLL I and CLL II proteins share
a 46% sequence identity, which would explain immunostaining of the
intestinal 14-kDa band (Fig. 6A). MALDI-TOF results for the
36-kDa lectin, along with its analogous molecular weight, immunoreactivity with anti-chicken CLL I antibodies, and
lactose-binding functional activity, establish its identity as
Gal-3TM1.
View this table:
[in this window]
[in a new window]
|
Table I
Analysis of MALDI-TOF chymotryptic peptide map of 36 kDa gel band
supports Gal-3TM1 identity
The table depicts results of MS-Fit analysis (Protein Prospector
program) with a maximum number of three missed cleavages. The sum of
peptides listed in the table represents 41% of the total Gal-3TM1
sequence.
|
|
To determine the intracellular distribution of Gal-3TM1, chicken
osteoclasts were immunofluorescently stained with anti-chicken CLL I
antibody #1 (Fig. 7). Confocal microscopy
of unpermeabilized osteoclasts revealed that Gal-3TM1 antigenicity was
localized at the plasma membrane (Fig. 7, A and
B, arrow). Double staining of permeabilized
osteoclasts with antibody and with 4',6-diamidino-2-phenylindole also
reveals that the Gal-3TM1 content of chicken nuclei (Fig. 7D, arrow) is low relative to that in the
cytoplasm (Fig. 7C, arrow). Clear spherical areas
devoid of galectin-3TM1 antigenicity are presumed to represent
intracellular vacuoles (Fig. 7, B-D, arrowheads). This situation is in contrast to that for
galectin-3 in rat osteoclasts and may be due to the TM1 insert.
Galectin-3 is clearly enriched in the nuclei of rat osteoclasts, which
appear to actively resorb bone in the marrow ablation model (Fig.
7F). The latter distribution pattern was also observed in
proliferating fibroblasts (38). Rat osteoclasts were defined on the
basis of TRAP staining, size, multinuclearity (n > 2),
and apposition to surfaces of bone trabeculae.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Comparison of representative
immunostaining patterns of Gal-3TM1 and galectin-3 with chicken and rat
multinucleated osteoclasts, respectively. A and
B, confocal image of non-permeabilized, chicken
osteoclast displays predominantly plasma membrane staining for Gal-3TM1
(green). A, vertical optical slice from
mid-region of cell. B, vertical optical slice from the same
cell representing surface-attached, basal membrane region.
Arrow, exterior plasma membrane face; arrowhead,
clear areas are presumed to be vacuoles. Original
magnification, ×1000. C and D, permeabilized
chicken osteoclast exhibits intracellular and peripheral membrane
staining, but not intranuclear or vacuolar staining, for Gal-3TM1.
C, permeabilized, immunofluorescently stained osteoclast
(green). D, the same osteoclast with intranuclear
4',6-diamidino-2-phenylindole-stained DNA signal (light
blue) overlaid upon immunofluorescent image (green).
Arrow, individual nucleus; arrowhead, vacuole.
Original magnification, ×600. E, negative, double-stained
control. Non-immune serum was substituted for anti-galectin antibody
and used in an identical immunofluorescence protocol with chicken
osteoclasts, which were also stained with phalloidin-Texas Red for
identification. The image shown represents combined control
immunofluorescent (green) and Texas Red (red)
signals. Original magnification, ×1000. F, multinucleated
rat osteoclasts in marrow-ablated bone colorimetrically stained for
galectin-3 antigen (black) and TRAP. The large
arrows denote an osteoclast whose five nuclei are preferentially
immunostained for galectin-3. Scale bar, 50 µm. Note:
A-E were stained with rabbit anti-chicken CLL I antibody
#1; F was stained with goat anti-rat galectin-3 (see
"Methods" for more details).
|
|
Encoded TM1 Protein Sequence Is Hydrophobic in Character--
Fig.
2 compares the predicted protein sequences of chicken galectin-3TM1 and
galectin-3TR1 with that for chicken and human galectin-3 (27, 28). To
gauge the potential significance of the larger alternatively spliced
insert sequence, the TM1 domain was scanned for characteristic protein
motifs. The existence of a single transmembrane-spanning region
encompassing residues 142 to 166 of Gal-3TM1 (represented by the
horizontal line in Fig. 8) was
predicted with the N terminus distributed intracellularly. Peak
hydrophobicity values for this transmembrane segment approached those
obtained for the transmembrane helices in bacteriorhodopsin (not shown)
(49). Importantly, analyses of the chicken galectin-3 sequence
(regions outside the two vertical bars in Fig. 8)
did not yield a positive hydrophobicity score. Comparisons of the Gal-3TM1 sequence against the PROSITE data base also identified two
overlapping sequences (residues 173-194 and 180-201), which fulfill
the criteria for a leucine zipper motif containing a total of four
consecutive leucine residues spaced seven residues apart. No
recognizable homeodomain or basic DNA binding region is associated with
this domain. The presumptive leucine zipper motif lies within the TM1
insert shared by Gal-3TM1 and Gal-3TR1 (Fig. 8). Gal-3TM1, but not
Gal-3TR1, also contains a variant of the conserved NWGK motif (residues
261-264), which is required for apoptotic activity by bcl-2 family
members (25, 50).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8.
Hydrophobicity plot of galectin-3TM1 sequence
identifies presumptive transmembrane spanning domain. The
hydrophobicity of the Gal-3TM1 sequence was analyzed by TMPred program
(35), and the results are plotted with the N terminus on the left
side. The heavier tracing reflects the preferred model
with the N terminus inside. The vertical bars on the graph
denote the limits of the 70-residue TM1 insert domain. The
horizontal bar on the figure indicates the position of the
predicted single transmembrane-spanning region involving residues
142-166; an alternative overlapping region (residues 134-157)
exhibited a slightly lower hydrophobicity score.
|
|
 |
DISCUSSION |
The data presented here support the following conclusions. First,
highly purified chick osteoclasts produced in vivo and
osteoclasts produced by differentiation of marrow precursors in culture
exclusively express two new alternatively spliced mRNA forms of
chicken galectin-3. These forms each contain a 210-bp TM1 open reading
frame but are distinguished by the presence or absence of an additional
241-bp TR1 insert sequence. TR1 encodes a stop codon and is predicted to yield a truncated Gal-3TR1 protein lacking a complete carbohydrate recognition domain. Second, Gal-3TM1 and Gal-3TR1 messages were also
identified in chick intestinal tissue, but not in kidney, liver, or
lung. Third, the results of homology searches with these sequences
indicate that the 70-residue TM1 insert contains a single transmembrane
spanning region followed by a leucine zipper stalk domain, which is
predicted to position the carbohydrate recognition domain of Gal-3TM1
on the exterior face of the plasma membrane. Fourth, the presence of a
36-kDa Gal-3TM1 protein in osteoclast and intestine homogenates was
confirmed on the basis of its size, its purification via
lactosyl-Sepharose chromatography, reactivity with antibodies
cross-reactive with chicken galectin-3, and its peptide masses which
matched those predicted for the TM1 insert and other regions. Confocal
immunofluorescent staining of chicken osteoclasts confirmed the
expression of Gal-3TM1 at the plasma membrane. Gal-3TM1 is the first
example of a galectin family lectin capable of being expressed as a
soluble protein and as a transmembrane protein with its carbohydrate
recognition domain expressed on the exterior face of the plasma
membrane (or the luminal side of intracellular membrane systems). The
presence of a leucine zipper-like motif provides a potential mechanism
to form homo- and/or heterodimeric complexes at these sites.
Although the work of Niida et al. (18), Colnot et
al. (51), as well as results presented here, clearly demonstrate
the presence of galectin-3 protein in human, mouse, and rat osteoclasts in vivo, this report is the first to identify and detect the
expression of alternative splice forms Gal-3TM1 and Gal-3TR1 by
osteoclasts isolated from calcium-deficient chickens. This distinctive
expression pattern and the role of osteoclasts and intestinal cells in
regulation of serum calcium raises the possibility that Gal-3TM1 and
Gal-3TR1 may have been induced by exposure to calcium deficiency
in vivo. For example, calcitonin receptor expression on
chicken osteoclasts seems to depend upon the serum calcium level of the
birds used to prepare the osteoclasts. Calcitonin receptors can be
demonstrated biochemically and/or functionally on osteoclasts from
deficient hosts (32, 52). However, osteoclasts isolated from chickens fed a normal calcium diet do not express calcitonin receptors or
respond to salmon calcitonin (53). Additional studies will be necessary
to test this rationale for Gal-3TM1 regulation.
Definition of Gal-3TM1 and Gal-3TR1 as alternatively spliced messages
is based upon positioning of insert sequences at conserved exon-intron
junctions for the mouse and human Lgals3 genes (45, 46) and
the open reading frame of the TM1 insert sequence. Also, the size of
intron sequences in the mouse Lgals3 gene range from 409 to
1404 bp (46), which are all longer than either of the 210- to 241-bp
TM1 and TR1 insert sequences. Average chicken intron size is comparable
to that for mammalian species (54). Finally, support also comes from
the fact that the low affinity IgE Fc receptor (CD23), itself a C
(calcium-dependent)-type lectin, is expressed as a soluble
and transmembrane domain containing alternatively spliced forms
(55).
Searches of GenBankTM indicate that Gal-3TM1 is related to
other transmembrane proteins. First, the TM1 sequence shares a 27-40% homology with several membrane transporter and channel proteins, e.g. the kidney urea transporter (56), skeletal muscle
chloride channel (foot;f2;10), chicken rhodopsin (58), and the
organic anion transporter polypeptide-related protein 3 (foot;f3;10). These homologies do not extend to the adjacent chicken galectin-3 sequence indicating the region of similarity is restricted primarily to
the 70-residue TM1 insert. Second, similar sequence comparisons with
other galectin super-family members and C-type lectins, including the
liver asialoglycoprotein receptor, cd69, cd23 low affinity IgE Fc
receptor, ly49c, murine C-type macrophage lectin, trout lectin (60),
and nkg2-A failed to reveal significant homologies. Regardless, the
latter type II transmembrane C-type lectins provide a useful structural
paradigm (61, 62), because, like galectin-3, they do not contain
N-terminal signal sequences, yet they possess a signal-anchor domain
that acts as an internal signal sequence (63). In this way, we predict
that Gal-3TM1, like the trout C-type lectin (60), exhibits a type II
transmembrane topology with an N-terminal cytosolic domain,
transmembrane domain, a leucine zipper stalk domain, and an
extracellular C-terminal carbohydrate recognition domain.
Although secreted via a non-classical ER/Golgi-independent mechanism
(21), galectin-3 is known to be associated with cell surfaces. The
mechanism is thought to depend upon the propensity of galectin-3 to
dimerize. The N-terminal half of galectin-3 has been shown to
self-associate with itself; this domain is primarily composed of
unusual Gly- and Pro-rich repeats (64). Because galectin-3 can be
released from cells like macrophages with lactose, it has been assumed
that galectin-3 dimers associate with cell surface glycoproteins with
one of their two carbohydrate recognition binding sites. Recognition of
extracellular lactosyl ligands is believed to be mediated by the
remaining free binding site. For example, binding of IgE to macrophages
and mast cells via galectin-3 is inhibited by lactose, whereas
galectin-3 itself can be released by lactose (23). We speculate that
the structure of Gal-3TM1 may have several functional implications. By
forming homo-dimers via their shared leucine zipper domains, the
moderate affinity of individual Gal-3TM1 carbohydrate recognition
domains would be effectively increased through a multiplicity effect.
The presence of a cytoplasmic N-terminal tail containing the Gly/Pro
repeats also offers a mechanism to regulate the density, distribution, or lifetime of cell surface Gal-3TM1 receptors via interactions with
the cytoskeleton.
Previous studies of lactose-binding lectins showed that galectin-4 (36 kDa), galectin-6 (33 kDa), galectin-9 (36 kDa), and CLL II (C-14) are
expressed in intestine (57, 65-66). Studies by Iglesias et
al. (42) and Beyer et al. (57) have demonstrated that
chicken CLL I and CLL II are structurally and functionally distinct.
Previous studies in chickens have not identified higher molecular
weight forms of galectin-3 in intestine. We suggest that this may be
due to prior use of adult intestinal tissue, which, in contrast to the
4-week-old calcium-deficient chick tissue used here, may not express
Gal-3TM1 or Gal-3TR1.
Evidence for a functional role for osteoclast galectin-3 or Gal-3TM1
remains indirect. Analyses of osteoclastogenesis in culture have shown
that galectin-3 is expressed by mononuclear osteoclast precursor cells
prior to that for TRAP and calcitonin receptor (59), however,
expression drops after formation of mature osteoclasts relative to
precursor cells (34). Colucci et al. (15, 16) showed that
osteoclast binding to laminin, which specifically recognizes
galectin-3, occurs by means of an RGD-independent mechanism, but they
did not test the effect of lactose. Also, Kukita et al. (17)
found that surface-adsorbed laminin, like BAG-75 from bone matrix (14),
was able to block osteoclast differentiation in rat bone marrow
cultures. We suggest that Gal-3TM1 on chick osteoclast precursor cell
surfaces participates in attachment to the substratum during migration
across the vascular wall to
bone4 and/or in recognition
of partners during fusion into osteoclasts upon reaching bone.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Patricia Collin-Osdoby, Cathy
Brown, Gail Palmer, Fred Anderson, Linda Rothe, Steve Ryan, Shynda
Miles, and Jennifer Watson for excellent technical assistance.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
(NIH) Grant DE-11197 and the University of Missouri Research Board (to
J. G.) and by NIH Grant AG-1543 (to P. O.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF479564 and AF479565.
¶
To whom correspondence should be addressed: Division of
Molecular Biology and Biochemistry, School of Biological Sciences, Rm.
109B BSB, 5007 Rockhill Rd., University of Missouri-Kansas City, Kansas
City, MO 64110. Tel.: 816-235-2537; Fax: 816-235-5595; E-mail:
GorskiJ@umkc.edu.
Published, JBC Papers in Press, March 8, 2002, DOI 10.1074/jbc.M109578200
4
Recent quantitative studies show that purified
rat galectin-3 binds as well to isolated bone acidic glycoprotein-75 as
to monoclonal anti-DNP IgE, the commonly used standard ligand for this
receptor. Binding is completely blocked in both cases by lactose but
not sucrose (J. P. Gorski, F.-T. Liu, and P. Osdoby, unpublished results).
 |
ABBREVIATIONS |
The abbreviations used are:
BAG-75, bone acidic
glycoprotein-75;
TRAP, tartrate resistant acid phosphatase;
PVDF-P, polyvinylidene difluoride;
MALDI-TOF, matrix-assisted laser
desorption/ionization time-of-flight;
RT, reverse transcriptase;
CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate;
TM, transmembrane;
MOPS, 4-morpholinepropanesulfonic acid;
CLL I, chicken lactose lectin-I.
 |
REFERENCES |
| 1.
|
Osborn, L.
(1990)
Cell
62,
3-6[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Cherayil, B. J.,
Chaitovitz, S.,
Wong, C.,
and Pillai, S.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
7324-7328[Abstract/Free Full Text]
|
| 3.
|
Taylor, M. E.,
Conary, J. T.,
Lennartx, M. R.,
Stahl, P. D.,
and Drickamer, K.
(1990)
J. Biol. Chem.
265,
12156-12162[Abstract/Free Full Text]
|
| 4.
|
Crocker, P. R.,
Kelm, S.,
Dubois, C.,
Martin, B.,
McWilliam, A. S.,
Shotton, K. M.,
Paulson, J. C.,
and Gordon, S.
(1991)
EMBO J.
10,
1661-1669[Medline]
[Order article via Infotrieve]
|
| 5.
|
Shinar, D. M.,
Schmidt, A.,
Halpern, D.,
Rodan, G. A.,
and Weinreb, M.
(1993)
J. Bone Miner. Res.
8,
403-414[Medline]
[Order article via Infotrieve]
|
| 6.
|
Reinholt, F. P.,
Hultenby, K.,
Oldberg, A.,
and Heinegard, D.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
4473-4475[Abstract/Free Full Text]
|
| 7.
|
Miyauchi, A.,
Alvarez, J.,
Greenfield, E. M.,
Teti, A.,
Grano, M.,
Colucci, S.,
Zambonin-Zallone, A.,
Ross, F. P.,
Teitelbaum, S. L.,
Cheresch, D.,
and Hruska, K. A.
(1991)
J. Biol. Chem.
266,
20369-20374[Abstract/Free Full Text]
|
| 8.
|
Helfrich, M. H.,
Besbitt, S. A.,
Dorey, E. L.,
and Horton, M. A.
(1992)
J. Bone Miner. Res.
7,
335-343[Medline]
[Order article via Infotrieve]
|
| 9.
|
Ross, F. O. P.,
Chappel, J.,
Alvarez, J. I.,
Sander, D.,
Butler, W. T.,
Farach-Carson, M. C.,
Mintz, K. A.,
Gehron Robey, P.,
Teitelbaum, S. L.,
and Cheresh, D. A.
(1993)
J. Biol. Chem.
268,
9901-9907[Abstract/Free Full Text]
|
| 10.
|
Lakkakorpi, P.,
Tuukkanen, J.,
Hentunen, T.,
Jarvelin, K.,
and Vaananen, K.
(1989)
J. Bone Miner. Res.
4,
817-825[Medline]
[Order article via Infotrieve]
|
| 11.
|
Lakkakorpi, P.,
Horton, M. A.,
Helfrich, M. H.,
Karhukorpi, E. K.,
and Vaananen, K.
(1991)
J. Cell Biol.
115,
1179-1186[Abstract/Free Full Text]
|
| 12.
|
Midura, R. J.,
and Hascall, V. C.
(1996)
Glycobiology
6,
677-681[Free Full Text]
|
| 13.
|
Gorski, J. P.,
and Shimizu, K.
(1988)
J. Biol. Chem.
263,
15938-15945[Abstract/Free Full Text]
|
| 14.
|
Sato, M.,
Grasser, W.,
Harms, S.,
Fullenkamp, C.,
and Gorski, J. P.
(1992)
FASEB J.
6,
2966-2976[Abstract]
|
| 15.
|
Colucci, S.,
Grano, M.,
Zigrino, P.,
Santacroce, G.,
Zambonin, G.,
Teti, A.,
and Zambonin-Zallone, A.
(1993)
Boll. Soc. Ital. Biol. Sper.
69,
295-300[Medline]
[Order article via Infotrieve]
|
| 16.
|
Colucci, S.,
Giannelli, G.,
Grano, M.,
Faccio, R.,
Quaranta, V.,
and Zambonin-Zallone, A.
(1996)
J. Cell Sci.
109,
1527-1535[Abstract]
|
| 17.
|
Kukita, T.,
Hata, K.,
Kukita, A.,
and Iijima, T.
(1998)
Calcif. Tissue Int.
63,
140-142[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Niida, S.,
Amizuka, N.,
Hara, F.,
Ozawa, H.,
and Kodama, H.
(1994)
J. Bone Miner. Res.
9,
873-881[Medline]
[Order article via Infotrieve]
|
| 19.
|
Takahashi, N.,
Udagawa, N.,
Tanaka, S.,
Murakami, H.,
Owan, I.,
Tamura, T.,
and Suda, T.
(1994)
Dev. Biol.
163,
212-221[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Woo, H. J.,
Shaw, L. M.,
Messier, J. M.,
and Mercurio, A. M.
(1990)
J. Biol. Chem.
265,
7097-7099[Abstract/Free Full Text]
|
| 21.
|
Menon, R. P.,
and Hughes, R. C.
(1999)
Eur. J. Biochem.
264,
569-576[Medline]
[Order article via Infotrieve]
|
| 22.
|
Dagher, S. F.,
Wang, J. L.,
and Patterson, R. J.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
1213-1217[Abstract/Free Full Text]
|
| 23.
|
Frigeri, L. G.,
and Liu, F. T.
(1992)
J. Immunol.
148,
861-868[Abstract]
|
| 24.
|
Rosenberg, I.,
Cherayil, B. J.,
Isselbacker, K. J.,
and Pillai, S.
(1991)
J. Biol. Chem.
266,
18731-18736[Abstract/Free Full Text]
|
| 25.
|
Yang, R.-Y.,
Hsu, D. H.,
and Liu, F.-T.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
6737-6742[Abstract/Free Full Text]
|
| 26.
|
Collin-Osdoby, P.,
Oursler, M. J.,
Webber, D.,
and Osdoby, P.
(1991)
J. Bone Miner. Res.
6,
1353-1365[Medline]
[Order article via Infotrieve]
|
| 27.
|
Nurminskaya, M.,
and Linsenmayer, T. F.
(1996)
Dev. Dyn.
206,
260-271[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Robertson, M. W.,
Albrandt, K. A.,
Keller, D.,
and Liu, F.-T.
(1990)
Biochemistry
29,
8093-8100[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Cherayil, B. J.,
Weiner, S. J.,
and Pillai, S.
(1989)
J. Exp. Med.
170,
1959-1972[Abstract/Free Full Text]
|
| 30.
|
Albrandt, K.,
Orida, N. K.,
and Liu, F.-T.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
6859-6863[Abstract/Free Full Text]
|
| 31.
|
Osdoby, P.,
Martini, M. C.,
and Caplan, A. I.
(1982)
J. Exp. Zool.
224,
331-344[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Collin-Osdoby, P.,
Oursler, M. J.,
Rothe, L.,
Webber, D.,
Anderson, F.,
and Osdoby, P.
(1995)
J. Bone Miner. Res.
10,
45-58[Medline]
[Order article via Infotrieve]
|
| 33.
|
Kukita, T.,
McManus, L. M.,
Miller, M.,
Civin, C.,
and Roodman, G. D.
(1989)
Lab. Invest.
60,
532-538[Medline]
[Order article via Infotrieve]
|
| 34.
|
Higuchi, Y.,
Ito, M.,
Tajima, M.,
Higuchi, S.,
Miyamoto, N.,
Nishio, M.,
Kawano, M.,
Kusagawa, S.,
Tsurudome, M.,
Sudo, A.,
Katou, K.,
Uchida, A.,
and Ito, Y.
(1999)
Bone
25,
17-24[Medline]
[Order article via Infotrieve]
|
| 35.
|
Hofmann, K.,
and Stoffel, W.
(1993)
Biol. Chem. Hoppe-Seyler
347,
166-170
|
| 36.
|
von Heijne, G.
(1992)
J. Mol. Biol.
225,
487-494[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Gorski, J. P.,
Apone, S.,
Shaffer, K. A.,
Batchelder, A.,
Jean, W.,
Williams, J. A.,
Shacter, E.,
and Eyre, D. R.
(2000)
Bone
27,
103-110[Medline]
[Order article via Infotrieve]
|
| 38.
|
Hubert, M.,
Wang, S. Y.,
Wang, J. L.,
Seve, A. P.,
and Hubert, J.
(1995)
Exp. Cell Res.
220,
397-406[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Leffler, H.,
Masiarz, F. R.,
and Barondes, S. H.
(1989)
Biochemistry
28,
9222-9229[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Gorski, J. P.,
Griffin, D.,
Dudley, G.,
Stanford, C.,
Thomas, R.,
Huang, C.,
Lai, E.,
Karr, B.,
and Solursh, M.
(1990)
J. Biol. Chem.
265,
14956-14963[Abstract/Free Full Text]
|
| 41.
|
Castagna, L. F.,
and Landa, C. A.
(1994)
J. Neurosci. Res.
37,
750-758[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Iglesias, M. M.,
Rabinovich, G. A.,
Ambrosio, A. L.,
Castagna, L. F.,
Sotomayor, C. E.,
and Wolfenstein-Todel, C.
(1998)
Glycobiology
8,
59-65[Abstract/Free Full Text]
|
| 43.
|
Rosenfeld, J.,
Capdevielle, J.,
Guillemot, J. C.,
and Ferrara, P.
(1992)
Anal. Biochem.
203,
173-179[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Hellman, U.,
Wernstedt, C.,
Gonez, J.,
and Heldin, C. H.
(1995)
Anal. Biochem.
224,
451-455[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Kadrofske, M. M.,
Openo, K. P.,
and Wang, J. L.
(1998)
Arch. Biochem. Biophys.
349,
7-20[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Rosenberg, I. M.,
Iyer, R.,
Cherayil, B.,
Chiodino, C.,
and Pillai, S.
(1993)
J. Biol. Chem.
268,
12393-12400[Abstract/Free Full Text]
|
| 47.
|
Seetharaman, J.,
Kanigsberg, A.,
Slaaby, R.,
Leffler, H.,
Barondes, S. H.,
and Rini, J. M.
(1998)
J. Biol. Chem.
273,
13047-13052[Abstract/Free Full Text]
|
| 48.
|
Sakakura, Y.,
Hirabayashi, J.,
Oda, Y.,
Ohyama, Y.,
and Kasai, K.
(1990)
J. Biol. Chem.
265,
21573-21579[Abstract/Free Full Text]
|
| 49.
|
Essen, L.,
Siegert, R.,
Lehmann, W. D.,
and Oesterhelt, D.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
11673-11678[Abstract/Free Full Text]
|
| 50.
|
Yin, X. M.,
Oltvai, Z. N.,
and Korsmeyer, S. J.
(1994)
Nature
369,
321-323[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Colnot, C.,
Sidhu, S. S.,
Poirier, F.,
and Balmain, N.
(1999)
Cell. Mol. Biol. (Noisy-le-Grand)
45,
1191-1202[Medline]
[Order article via Infotrieve]
|
| 52.
|
Eliam, M. C.,
Basle, M.,
Bouizar, Z.,
Bielakoff, J.,
Moukhtar, M.,
and de Vernejoul, M. C.
(1988)
J. Endocrinol.
119,
243-248[Abstract/Free Full Text]
|
| 53.
|
Nicholson, G. C.,
Moseley, J. M.,
Sexton, P. M.,
and Martin, T. J.
(1987)
J. Bone Miner. Res.
2,
53-59[Medline]
[Order article via Infotrieve]
|
| 54.
|
Vinogradov, A. E.
(1999)
J. Mol. Evol.
49,
376-384[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Yoshikawa, T.,
Matsui, M.,
Gon, Y.,
Yoshioka, T.,
Hirama, M.,
Lynch, R. G.,
Naito, K.,
and Yodoi, J.
(1999)
Mol. Immunol.
36,
1223-1233[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Olives, B.,
Martial, S.,
Mattei, M. G.,
Matassi, G.,
Rousselet, G.,
Ripoche, P.,
Cartron, J. P.,
and Bailly, P.
(1996)
FEBS Lett.
386,
156-160[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Beyer, E. C.,
Zweig, S. E.,
and Barondes, S. H.
(1980)
J. Biol. Chem.
255,
4236-4239[Abstract/Free Full Text]
|
| 58.
|
Takao, M.,
Yasui, A.,
and Tokunaga, F.
(1988)
Vision Res.
28,
471-480[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Tsurukai, T.,
Takahashi, N.,
Jimi, E.,
Nakamura, I.,
Udagawa, N.,
Nogimori, K.,
Tamura, M.,
and Suda, T.
(1998)
J. Cell. Physiol.
177,
26-35[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Zhang, H.,
Robison, B.,
Thorgaard, G. H.,
and Ristow, S. S.
(2000)
Biochim. Biophys. Acta
1494,
14-22[Medline]
[Order article via Infotrieve]
|
| 61.
|
Hamann, J.,
Fiebig, H.,
and Strauss, M.
(1993)
J. Immunol.
150,
4920-4927[Abstract]
|
| 62.
|
Balch, S. G.,
McKnight, A. J.,
Seldin, M. F.,
and Gordon, S.
(1998)
J. Biol. Chem.
273,
18656-18664[Abstract/Free Full Text]
|
| 63.
|
Wahlberg, J. M.,
and Spiess, M.
(1997)
J. Cell Biol.
137,
555-562[Abstract/Free Full Text]
|
| 64.
|
Hsu, D. K.,
Zuberi, R.,
and Liu, F.-T.
(1992)
J. Biol. Chem.
267,
14167-14174[Abstract/Free Full Text]
|
| 65.
|
Gitt, M. A.,
Colnot, C.,
Poirier, F.,
Nani, K. J.,
Barondes, S. H.,
and Leffler, H.
(1998)
J. Biol. Chem.
273,
2954-2960[Abstract/Free Full Text]
|
| 66.
|
Wada, J.,
Ota, K.,
Kumar, A.,
Wallner, E. I.,
and Kanwar, Y. S.
(1997)
J. Clin. Invest.
99,
2452-2461[Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Wang, Y. Wang, N. T. Huffman, C. Cui, X. Yao, S. Midura, R. J. Midura, and J. P. Gorski
Confocal Laser Raman Microspectroscopy of Biomineralization Foci in UMR 106 Osteoblastic Cultures Reveals Temporally Synchronized Protein Changes Preceding and Accompanying Mineral Crystal Deposition
J. Biol. Chem.,
March 13, 2009;
284(11):
7100 - 7113.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. W. Kahsai, J. Cui, H. U. Kaniskan, P. P. Garner, and G. Fenteany
Analogs of Tetrahydroisoquinoline Natural Products That Inhibit Cell Migration and Target Galectin-3 Outside of Its Carbohydrate-binding Site
J. Biol. Chem.,
September 5, 2008;
283(36):
24534 - 24545.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. T. Huffman, J. A. Keightley, C. Chaoying, R. J. Midura, D. Lovitch, P. A. Veno, S. L. Dallas, and J. P. Gorski
Association of Specific Proteolytic Processing of Bone Sialoprotein and Bone Acidic Glycoprotein-75 with Mineralization within Biomineralization Foci
J. Biol. Chem.,
September 7, 2007;
282(36):
26002 - 26013.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Nishi, A. Itoh, H. Shoji, H. Miyanaka, and T. Nakamura
Galectin-8 and galectin-9 are novel substrates for thrombin
Glycobiology,
November 1, 2006;
16(11):
15C - 20C.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Jouault, M. El Abed-El Behi, M. Martinez-Esparza, L. Breuilh, P.-A. Trinel, M. Chamaillard, F. Trottein, and D. Poulain
Specific Recognition of Candida albicans by Macrophages Requires Galectin-3 to Discriminate Saccharomyces cerevisiae and Needs Association with TLR2 for Signaling
J. Immunol.,
October 1, 2006;
177(7):
4679 - 4687.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Ahmed, S.-J. Du, N. O'Leary, and G. R. Vasta
Biochemical and molecular characterization of galectins from zebrafish (Danio rerio): notochord-specific expression of a prototype galectin during early embryogenesis
Glycobiology,
March 1, 2004;
14(3):
219 - 232.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|