HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 21, 18891-18897, May 24, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/21/18891    most recent M201649200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Weeber, E. J. Articles by Craigen, W. J. Search for Related Content PubMed PubMed Citation Articles by Weeber, E. J. Articles by Craigen, W. J. Social Bookmarking                      What's this?

The Role of Mitochondrial Porins and the Permeability Transition Pore in Learning and Synaptic Plasticity^*

Edwin J. Weeber^§, Michael Levy^§, Margaret J. Sampson^¶§, Keltoum Anflous^¶, Dawna L. Armstrong, Sarah E. Brown, J. David Sweatt, and William J. Craigen^¶**

From the  Division of Neuroscience, ^¶ Department of Molecular and Human Genetics,  Department of Pathology, Baylor College of Medicine, Houston, Texas 77030

Received for publication, February 18, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Mitochondrial outer membrane permeability is conferred by a family of porin proteins. Mitochondrial porins conduct small molecules and constitute one component of the permeability transition pore that opens in response to apoptotic signals. Because mitochondrial porins have significant roles in diverse cellular processes including regulation of mitochondrial ATP and calcium flux, we sought to determine their importance in learning and synaptic plasticity in mice. We show that fear conditioning and spatial learning are disrupted in porin-deficient mice. Electrophysiological recordings of porin-deficient hippocampal slices reveal deficits in long and short term synaptic plasticity. Inhibition of the mitochondrial permeability transition pore by cyclosporin A in wild-type hippocampal slices reproduces the electrophysiological phenotype of porin-deficient mice. These results demonstrate a dynamic functional role for mitochondrial porins and the permeability transition pore in learning and synaptic plasticity.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Porins, also known as voltage-dependent anion channels (VDACs),¹ are the most abundant proteins in the mitochondrial outer membrane (1). They have highly conserved structural and electrophysiological characteristics across plant, yeast, mouse, and human species; mammals have three VDAC isoforms (VDAC1, VDAC2, and VDAC3) encoded by separate autosomal genes with the VDAC3 transcript undergoing alternative splicing in a tissue-specific manner (2, 3). Electrophysiological studies of artificial bilayer-reconstituted mouse VDAC isoforms have shown subtly different channel properties, but they all display a slightly anionic-selective permeability of a wide variety of ions in the "open" state and a slightly cationic-selective permeability in the "closed" state (4). Lack of the yeast VDAC (por1) leads to a temperature-sensitive growth restriction on a non-fermentable carbon source that, depending on which mammalian isoform is used, can be either completely or partially rescued (2), suggesting that each isoform has a discrete function.

There is considerable evidence that VDACs form the outer pore component of the mitochondrial permeability transition (MPT) pore complex together with the adenine nucleotide transporter in the mitochondrial inner membrane and cyclophilin D in the matrix (6, 7). Although previous research into the function of the MPT has focused on a pathological role in apoptosis and necrosis, more recent studies suggest that the MPT exists as a functional pore under a variety of physiological conditions (8, 9). For example, the MPT has been implicated in mitochondrial calcium-induced calcium release based upon the observation that the calcium release phase can be blocked by low doses of the MPT inhibitor cyclosporin A (CsA) (10, 11). High doses of cyclosporin A attenuate hippocampal long term depression, a long lasting form of synaptic plasticity that was attributed to the inhibition of calcineurin (also known as phosphatase 2B) (12). In the present study, we used a dose of cyclosporin 25-fold less in hippocampal slices to specifically target cyclophilin D, which is very sensitive to CsA (K_i = 3.1-3.6 nM for CsA) (13), and our results are consistent with published studies of the effects of CsA on mitochondrial function.

Approximately half of all presynaptic terminals in the rat hippocampal CA3CA1 region contain at least one mitochondrion (14), but the function of these complex organelles in learning and memory has yet to be determined. Several studies have reported the importance of ATP production (15, 16) and mitochondrial calcium buffering (17, 18) in normal synaptic transmission, and mitochondria were recently demonstrated to be important in short term synaptic plasticity at the crayfish neuromuscular junction (19). Participation of mitochondria in synaptic events ultimately depends on ion/metabolite flux through porins, the only known pores in the outer mitochondrial membrane. Using low doses of cyclosporin A and mice that lack the VDAC1 and/or the VDAC3 isoforms, we sought to determine the role of VDACs and the MPT in learning and synaptic plasticity.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Generation of VDAC-deficient Mice-- The gene targeting strategies for the VDAC1 and VDAC3 genes in embryonic stem cells has been described previously (5). In brief, the VDAC1 targeting vector was designed to delete a 3.7-kb HindIII fragment containing exons 2-5 of the VDAC1 gene, including the translation initiation codon (2). After the generation of chimeras using standard techniques (20), genotyping of VDAC1 animals was performed using a four-primer multiplex PCR assay. The PCR primer sets used are (5'-3'): neomycin resistance gene-specific-primer, CTGCGAATCGGGAGCGGCGATACCG; wild-type-specific primer 1, GGCCAGGAATGGTAGCTCATGCC; wild-type-specific primer 2, GGATGGATCAGGGTAGATCAG; and wild-type-specific primer 3, GCTGTGCGCCACCCAGTGGTG. The PCR conditions were: 94 °C for 1 min, 56 °C for 1 min, and 72 °C for 1 min and 30 s, 40 cycles). The mutant allele PCR product (neo primer + primer 1) is 1.4 kb, and the wild-type PCR product (primer 2 + primer 3) is 700 bp. The generation and genotyping of VDAC3 mice has been described previously (21). Mice deficient for both VDAC1 and VDAC3 were generated by mating VDAC1^+//VDAC3^+/ males to VDAC1^//VDAC3^+/ females since VDAC1^//VDAC3^+/ males are infertile.²

Behavioral Testing-- Prior to behavioral testing, we performed a series of control experiments to test for normal sensory signaling in VDAC-deficient mice in an attempt to exclude possible derangements of sensory or motor function as a cause of potential learning deficits. To assess sensory responsiveness to noxious stimuli, we performed the hot plate and shock threshold tests as described previously (22). We found that VDAC-deficient mice exhibited normal sensory responsiveness to a 55 °C hot plate, as measured by hind paw-lick latency, and to shock threshold sensitivity tests, as measured by flinching, jumping, and vocalization to increasing shock intensities (data not shown). In two tests of motor function responsiveness, the open-field and rotor rod assessments, we found no significant difference in general activity or rotor rod performance of VDAC-deficient mice as compared with littermate wild-type controls (data not shown). This battery of standard behavior tests prevents the misinterpretation of hyperactivity or abnormal motor coordination as an apparent fear conditioning phenotype.

Mice were housed on a 12-h light/dark schedule. All experiments were performed in compliance with the Baylor College of Medicine Institutional Animal Care and Use Committee and national regulations and policies. For cued and contextual fear conditioning, animals were placed in the fear conditioning apparatus for 2 min, and then a 30-s acoustic-conditioned stimulus (white noise) was delivered. During the last 2 s of the tone, a 1.5-mA shock (unconditioned stimulus) was applied to the floor grid. This protocol was repeated twice with 2 min between pairings. The stimulus strength and number of training pairs were chosen based on pilot experiments to optimize learning. To assess for contextual learning, the animals were placed back into the training context at 24 h post-training and scored for freezing for 5 min. To assess for cued learning, the animals were placed in a different context (novel odor, cage floor, and visual cues) 24 h after training. Baseline behavior was measured for 3 min in the novel context, and then the white noise was presented for 3 min. Learning was assessed by measuring freezing behavior (i.e. motionless position) every 5 s. The scorer of the behavioral experiments was blinded to animal genotypes.

Spatial learning was performed in a Morris water maze consisting of a circular pool (1.38-m Nalge pool) filled with opaque water at room temperature. Mice were trained to locate an escape platform (15 cm × 15 cm) hidden beneath the water level (3 cm). Each mouse was given four trials per day for 8 consecutive days for which the time to find the platform (escape latency), the total distance traveled, and the swim speed of the animals were measured. Each animal was given a maximum of 50 s to find the platform. On days 7 and 8, mice were given a probe trial in which the platform was removed, and the animal was given 50 s to search the training pool for the platform. The time spent in each quadrant was recorded in addition to the number of times the animal crossed the area where the platform had been during the training sessions.

Hippocampal Slice Physiology-- Hippocampal slices (400 µm) were prepared as described previously (23). Hippocampal slices were bathed (1 ml/min) with artificial cerebral spinal fluid (125 mM NaCl, 2.5 mM KCl, 1.24 mM NaH₂PO₄, 25 mM NaHCO₃, 10 mM D-glucose, 2 mM CaCl₂, 1 mM MgCl₂, and 10 µM cyclosporin A as indicated) in an interface chamber maintained at either 25 or 30 °C. The Schaffer collateral synapse was stimulated, and the field EPSP (fEPSP) was recorded in area CA1 stratum radiatum. Responses were monitored for 20 min before paired-pulse facilitation (PPF), post-tetanic potentiation (PTP), or long term potentiation (LTP) was induced to ensure a stable baseline. Measurements are shown as the average slope of the fEPSP from six individual traces and are standardized to 20 min of baseline recordings. Baseline stimulus intensities were adjusted to produce an fEPSP at 50% of the maximal response. N-methyl-D-aspartate-dependent LTP was induced with two sets of high frequency stimulation with each set consisting of two trains of 100 Hz of stimulation for 1 s, separated by 20 s. Stimulus intensities used for the high frequency stimulation were matched to that used in the baseline recordings. To minimize day-to-day variability in slice preparations and recordings, mutant and wild-type hippocampal slices were prepared simultaneously and placed side-by-side in the same recording chamber. Cyclosporin A was dissolved in 1 ml of 99% ethanol and added to stirring artificial cerebrospinal fluid over 10 min to increase solubilization; the cyclosporin/artificial cerebrospinal fluid was stirred throughout its use as well. Thorough washing of all plastic tubes and parts exposed to cyclosporin A with ethanol and water prevented contamination of control slices.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

VDAC-deficient Mice-- To generate VDAC1^/ mice, gene targeting was used to delete exons 2-5. The mutated allele lacks four coding exons, removing the start codon and rendering the mRNA unstable. Heterozygous mice appear to have no obvious phenotype, but when mated, there is a reduced number of homozygous deficient mice as compared with the expected 1:2:1 Mendelian ratio, indicating partial embryonic lethality. When VDAC1^+/ mice were intercrossed and the resulting offspring were genotyped, ~40% of the expected number of VDAC1^/ mice and 88% of VDAC1^+/ mice were identified (163^+/+:286^+/:68^/). Timed matings were used to demonstrate that embryonic death occurs between days 10.5 and 11.5 of gestation.³ Surviving VDAC1^/ mice are fertile, appear otherwise indistinguishable from wild-type littermates, and exhibit normal exercise tolerance.⁴ VDAC3^/ mice generated previously by gene targeting (21) similarly harbor a null allele due to deletion of the last four exons of the gene, but all genotypes are born in expected numbers when heterozygous mice are mated. However, VDAC3^/ males are infertile due to structural abnormalities in the sperm tail leading to sperm immotility. Mice deficient for both VDAC1 and VDAC3 are born less frequently than would be expected and have a degree of growth retardation but otherwise appear healthy and long-lived.

VDAC Expression in the Hippocampus-- Immunohistochemistry was used to examine the distribution of VDAC isoforms within regions of the mouse brain. Antibody staining of hippocampal sections from wild-type mice using anti-VDAC1 and anti-VDAC3-specific antibodies (24) demonstrates that both isoforms are expressed in neurons of the hippocampus (Fig. 1). Staining can be seen in dentate, CA1, CA2, CA3, and CA4 cells in addition to cells of the subiculum. Western blotting of total protein extracts from hippocampal brain slices confirms that both VDAC1 and VDAC3 are expressed at approximately equal amounts relative to an -actin control antibody (Fig. 1c).

View larger version (100K): [in this window] [in a new window]   Fig. 1.   Generation of VDAC knockout mice and immunohistological characterization. Exons 2-5 of VDAC1 were replaced by a Neo cassette by homologous recombination in embryonic stem cells (a). Northern blot analysis reveals the complete absence of VDAC1 mRNA in all tissues tested including muscle, kidney, liver, and testes (b). Western blot analysis of wild-type (w.t.) mouse hippocampal homogenates shows the presence of VDAC1 and VDAC3 (c). In panels D and E, immunohistochemistry using anti-VDAC1 (d) and anti-VDAC3 specific antibodies (e) confirms the localization of VDAC1 and VDAC3 to the dentate, CA1, CA2, CA3, and CA4, as well as to the cerebral cortex (brown stain).

Learning and Memory in VDAC-deficient Mice-- Examination of VDAC1^/ and VDAC3^/ mice revealed no obvious neuronal structural phenotype. Anatomical sections of brain tissue appear normal under light microscopy (not shown). To determine whether VDACs have a role in hippocampal dependent forms of learning and memory, we used fear conditioning to compare the learning/memory ability between VDAC-deficient mice and littermate controls. Associative fear-conditioned learning is performed by using an aversive stimulus (a mild foot shock) paired with an auditory-conditioned stimulus (white noise) within a novel environment. When presented with the auditory stimulus 2 min later, VDAC-deficient mice and control mice exhibit similar freezing behavior in anticipation of the aversive foot shock to follow (Fig. 2). However, when tested 24 h after training, control mice exhibit marked fear in response to re-presentation of either the context (Fig. 2, Contextual Fear Conditioning) or the auditory cue delivered in a different context (Fig. 2, Cued Fear Conditioning). VDAC3^/ mice, and VDAC1^//VDAC3^/ mice show a significant deficit in contextual fear conditioning. However, VDAC1^/ mice display freezing behavior indistinguishable from that of wild-type controls (Fig. 2). All of the VDAC-deficient mice show a significant cued fear conditioning deficit, a hippocampus-independent learning task (Fig. 2). Our observations indicate that VDAC3, but not VDAC1, is necessary for hippocampus-dependent contextual fear conditioning and implicate both VDAC1 and VDAC3 as necessary for cued fear conditioning.

View larger version (31K): [in this window] [in a new window]   Fig. 2.   Associative learning impairments in VDAC-deficient mice. Initial training of VDAC mutant animals reveals normal freezing in response to the association of a mild foot shock and an auditory cue in the presence of a novel context (a). 24 h following training, mice were reintroduced to the training context (b). Wild-type mice and VDAC1-deficient mice show similar freezing behavior (* = p < 0.05). In comparison, VDAC3 and VDAC1/3 mice exhibit reduced contextual freezing behavior. When compared with control mice (n = 7), VDAC-deficient mice display a significantly reduced freezing behavior in response to the auditory cue in a novel context (c) (VDAC1, n = 7; VDAC3, n = 9; VDAC1/3, n = 5, * = p < 0.001).

Given the effect of VDAC deficiency on contextual fear conditioning, we examined hippocampus-dependent spatial learning in VDAC-deficient mice using the hidden platform version of the Morris water maze. Following successive days of training, wild-type mice show a significant reduction in the time needed by the mouse to find the hidden platform (escape latency). In contrast, by day 6 of training, all VDAC-deficient mice showed a considerably greater latency than that of wild-type controls (Fig. 3) despite no significant difference in swim speed (data not shown). Following removal of the platform (probe test), VDAC-deficient mice did not preferentially spend more time in the trained quadrant or cross the trained site (Fig. 3). Only the wild-type mice exhibited a search strategy during probe test measurements, spending the majority of time in the appropriate quadrant. Therefore, VDAC1 and VDAC3 are necessary for normal spatial learning as assessed by the Morris water maze.

View larger version (21K): [in this window] [in a new window]   Fig. 3.   VDAC-deficient mice exhibit spatial learning deficits. Spatial learning in a Morris water maze showing the mean latency (±S.E.) to escape from the pool to a submerged platform (four trials per day per block) is presented as a function of 1 training block for wild-type (, n = 18), VDAC1 (, n = 15), VDAC3 (, n = 15), and VDAC1/3 (, n = 8)(number of n for training is consistent with that of probe trails) (a). During the probe trials on days 5 and 6, wild-type littermate controls spent significantly more time searching in the trained quadrant (TQ) than the quadrants to the right (QR), left (QL), or opposite (OP) from the trained quadrant (b). VDAC-deficient mice did not exhibit a selective search strategy, resulting in a significant difference in the time spent in the trained quadrant as compared with that of controls. Wild-type mice showed a significant increase in the probability of crossing the platform site but VDAC-deficient mice did not (p < 0.001 for all) (c).

Hippocampal Synaptic Plasticity in VDAC-deficient Mice-- Experimental evidence suggests a connection between short and long term synaptic plasticity and certain hippocampal learning tasks (25). Therefore, we evaluated the importance of VDACs in hippocampal short and long term plasticity. PPF, a short-lived form of plasticity believed to be involved in some forms of learning and memory (26), is widely regarded as a presynaptic phenomenon caused by residual calcium present in the presynaptic terminal following a depolarization that, in turn, facilitates neurotransmitter release in response to a second depolarization (27). We found that hippocampal slices lacking VDAC3 show a significant reduction in PPF when the two depolarizations are within 100 ms of each other. Lack of VDAC1 results in normal PPF, and hippocampal slices deficient for both VDAC isoforms display the same deficit as VDAC3 deficiency (Fig. 4).

View larger version (36K): [in this window] [in a new window]   Fig. 4.   Absence of VDACs leads to impairments in short and/or long term plasticity. , wild type, n = 11; , VDAC1, n = 7; , VDAC3, n = 9; , VDAC1/3, n = 9. PPF is impaired in VDAC3 and VDAC1/3-deficient mice for stimulus pairings 100 ms apart (A) (* = p < 0.05). Because PPF varies with the size of the first response, the stimulation was adjusted so that the slope EPSP of the first stimulus for all slices was the same. Representative traces are shown for mutant (a) and wild-type (b). Calibration bars = 1 mV/2 ms. Post-tetanic potentiation of area CA1, induced by one high frequency stimulation (100 Hz for 1 s) of the Schaffer-collateral pathway in the presence of 100 µM 2-amino 5-phosphonovaleric acid, shows no significant difference in PTP among the VDAC-deficient mice and no difference as compared with wild-type controls (B). Long term potentiation, induced with two trains of 100 Hz for 1 s tetani separated by 20 s, is significantly attenuated in VDAC1-deficient mice, trending toward an impairment in VDAC3-deficient mice and markedly impaired in VDAC1/3-deficient mice (C).

PTP is another form of short term synaptic plasticity dependent on residual calcium (28), but unlike PPF, PTP is elicited by a single high frequency depolarization that cause a much greater elevation of presynaptic calcium. When the MPT was demonstrated previously to be a conduit for mitochondrial calcium-induced calcium release (10), it was hypothesized that the residual calcium in the presynaptic terminal that underlies PTP involves mitochondrial calcium buffering. That idea was first tested by Tang and Zucker; in that report, tetraphenylphosphonium⁺, a lipophilic cation that depolarizes mitochondria, attenuates PTP (19). However, the concentration of TPP⁺ used in the study has been criticized as likely to cause significant mitochondrial swelling and dysfunction (29). Although mitochondrial calcium buffering may be involved in PTP, we found no significant reduction in PTP in any of the VDAC-deficient hippocampal slices (Fig. 4). Thus, our results indicate that neither VDAC1 nor VDAC3 is required for normal PTP.

LTP, a long-lasting increase in the amplitude of synaptic response that has been correlated with many long-lasting forms of learning and memory (30), is significantly impaired in VDAC1^/ slices and shows a trend toward impairment in VDAC3^/ slices. Lack of both isoforms causes a compounded effect of marked LTP attenuation (Fig. 4).

MPT Inhibition and Synaptic Plasticity-- Cyclosporin A (CsA) binds with high affinity to mitochondrial cyclophilin D and thereby prevents the opening of the mitochondrial permeability transition pore (6). Slices exposed to 10 µM CsA exhibit attenuation in PPF and LTP that is strikingly similar to VDAC1^//VDAC3^/ slices and similarly show no deficit in PTP (Fig. 5) or alteration of baseline synaptic transmission (not shown). Calcineurin, a phosphatase inhibited by FK506 and high doses of cyclosporin A, has been shown to be involved in long term depression (12, 31, 32) and in some forms of long term potentiation (33, 34). However, in contrast to low dose CsA, FK506 does not affect induction of LTP by 100 Hz of high frequency stimulation used in this study (12). Also in contrast to low dose CsA, FK506 has no effect on presynaptic plasticity (35) and enhances baseline synaptic transmission (36). Mice genetically lacking calcineurin have enhanced 100-Hz LTP and PPF (37), and mice overexpressing calcineurin have reduced PPF (38). Finally, although the absence of calcineurin does not impair hippocampal-dependent fear conditioning or spatial learning (32), intracranial injections of low doses of cyclosporin A into day-old chicks disrupts memory formation (39) by a calcineurin-independent mechanism (40). Taken together with our findings, these studies strongly suggest a different mechanism of action for low dose cyclosporin A. Considering the similarity of CsA exposure and VDAC1/3 absence on three forms of synaptic plasticity, our results are most consistent with a cyclosporin-mediated inhibition of the MPT.

View larger version (17K): [in this window] [in a new window]   Fig. 5.   10 µM cyclosporin A attenuates paired-pulse facilitation and long term potentiation but not post-tetanic potentiation. , wild-type; , CsA. Paired pulse facilitation comparison between wild-type (n = 8) and CsA-exposed (n = 8) slices shows deficits in the CsA-exposed slices at all stimulus pairings tested (A) (* = p < 0.01). Post-tetanic potentiation is not affected by incubation in CsA (wild-type (n = 6), CsA (n = 7)) (B). Incubation of slices in CsA results in a long term potentiation deficit (wild-type (n = 6), CsA (n = 5)) (C).

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The results reported herein demonstrate that normal mitochondrial permeability is essential for learning and memory tasks. The molecular basis for these learning deficits appears unique to each VDAC isoform, as revealed by studies of hippocampal synaptic plasticity. Although it is possible that the reduction in mitochondrial outer membrane permeability leads to developmental abnormalities in neuronal architecture, a pathological characterization of VDAC-deficient mice did not detect an anatomical defect despite the potential role of VDACs in apoptosis. In addition, VDAC-deficient mice do not display obvious abnormal behavior unrelated to learning, nor did they show a significant change in synaptic transmission. These observations, along with the finding that cyclosporin A can recapitulate the mutant phenotype in wild-type hippocampal slices, strongly suggest that the role of VDACs and the MPT in learning and synaptic plasticity is functional and dynamic rather than developmental in nature.

The generation of a phenocopy of VDAC deficiency following treatment with a low concentration of cyclosporin A suggests that the dynamic function of VDACs in synaptic plasticity is related to its involvement in the MPT. Considering the role of the MPT in calcium regulation in isolated brain mitochondria, it is likely that the consequence of cyclosporin A exposure or absence of VDACs on mitochondrial calcium regulation in the presynaptic terminal is responsible for the effect on synaptic plasticity. Because the mitochondrion is located some distance away from the presynaptic membrane with respect to sites of calcium entry, mitochondrial calcium regulation is not likely to take place during or immediately following a synaptic depolarization but rather plays a more general role in controlling baseline calcium levels in the presynaptic terminal. Presynaptic background calcium may affect kinases involved in presynaptic plasticity that do not affect synaptic transmission, such as CAMKII (41, 42).

Associative learning differences between the different VDAC-deficient mice further indicate that mitochondrial permeability serves distinct functions in different brain regions as highlighted by the finding that VDAC3, but not VDAC1, is necessary for hippocampus-dependent contextual fear conditioning. This suggests that VDACs play different roles in different mitochondrial populations, or alternatively, may reflect differences in the requirement for PPF and LTP in contextual learning. Interestingly, although the amygdala is important for both cued and contextual fear conditioning, VDAC1-deficient mice show an impairment only in cued fear conditioning. This may be due to the contribution of VDACs to individual nuclei within the amygdala. For example, the lateral amygdaloid nucleus receives auditory input involved in cued fear conditioning, whereas the basolateral and basomedial amygdaloid nuclei receive hippocampal afferents important for contextual fear conditioning (43). The absence of VDAC1 may only affect the lateral amygdaloid nucleus, impairing cued fear conditioning but leaving contextual fear conditioning intact.

Given the heterogeneous molecular basis for mitochondrial diseases, it remains uncertain whether there are common pathogenic mechanisms; however, there are numerous ways to induce the MPT, which may be a common final pathway for a variety of diseases (44, 45). This is the first characterization of the role of mitochondrial VDACs and the MPT in learning and synaptic plasticity and the first analysis of the individual contributions of the VDAC1 and VDAC3 isoforms to learning and synaptic plasticity. The effect of cyclosporin A in recapitulating the phenotype supports the view that VDACs are a component of the MPT and provides further evidence for a physiological role for the MPT in learning and synaptic plasticity.

	ACKNOWLEDGEMENT

We thank Bobbie Antalffy for technical assistance.

	FOOTNOTES

^* This work was supported in part by the Baylor College of Medicine Child Health Research Center and Mental Retardation Research Center, Grant R01 55713 from the National Institutes of Health, and by grants from the National Research Service Award.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ These authors contributed equally to this work.

^** To whom correspondence should be addressed: Dept. of Molecular and Human Genetics, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Tel.: 713-798-8305; Fax: 713-798-8704; E-mail: wcraigen@bcm.tmc.edu.

Published, JBC Papers in Press, March 20, 2002, DOI 10.1074/jbc.M201649200

² M. J. Sampson and W. J. Craigen, unpublished data.

³ M. J. Sampson, K. Anflous, and W. J. Craigen, unpublished data.

⁴ K. Anflous and W. J. Craigen, unpublished data.

	ABBREVIATIONS

The abbreviations used are: VDAC, voltage-dependent anion channel; CsA, cyclosporin A; PPF, paired-pulse facilitation; PTP, post-tetanic potentiation; LTP, long term potentiation; MPT, mitochondrial permeability transition; EPSP, excitatory postsynaptic potentials; fEPSP, field EPSP.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. J. Tong Mitochondrial Delivery Is Essential for Synaptic Potentiation Biol. Bull., April 1, 2007; 212(2): 169 - 175. [Abstract] [Full Text] [PDF]

				J. A. Moron, N. S. Abul-Husn, R. Rozenfeld, G. Dolios, R. Wang, and L. A. Devi Morphine Administration Alters the Profile of Hippocampal Postsynaptic Density-associated Proteins: A Proteomics Study Focusing on Endocytic Proteins Mol. Cell. Proteomics, January 1, 2007; 6(1): 29 - 42. [Abstract] [Full Text] [PDF]

				E. Jonas BCL-xL Regulates Synaptic Plasticity Mol. Interv., August 1, 2006; 6(4): 208 - 222. [Abstract] [Full Text] [PDF]

				I. J. Rampil, D. H. Moller, and A. H. Bell Isoflurane modulates genomic expression in rat amygdala. Anesth. Analg., May 1, 2006; 102(5): 1431 - 1438. [Abstract] [Full Text] [PDF]

				R. Z. Sabirov, T. Sheiko, H. Liu, D. Deng, Y. Okada, and W. J. Craigen Genetic Demonstration That the Plasma Membrane Maxianion Channel and Voltage-dependent Anion Channels Are Unrelated Proteins J. Biol. Chem., January 27, 2006; 281(4): 1897 - 1904. [Abstract] [Full Text] [PDF]

				M. Heglind, A. Cederberg, J. Aquino, G. Lucas, P. Ernfors, and S. Enerback Lack of the Central Nervous System- and Neural Crest-Expressed Forkhead Gene Foxs1 Affects Motor Function and Body Weight Mol. Cell. Biol., July 1, 2005; 25(13): 5616 - 5625. [Abstract] [Full Text] [PDF]

				S. F. Okada, W. K. O'Neal, P. Huang, R. A. Nicholas, L. E. Ostrowski, W. J. Craigen, E. R. Lazarowski, and R. C. Boucher Voltage-dependent Anion Channel-1 (VDAC-1) Contributes to ATP Release and Cell Volume Regulation in Murine Cells J. Gen. Physiol., October 25, 2004; 124(5): 513 - 526. [Abstract] [Full Text] [PDF]

				R. Darbandi-Tonkabon, B. D. Manion, W. R. Hastings, W. J. Craigen, G. Akk, J. R. Bracamontes, Y. He, T. V. Sheiko, J. H. Steinbach, S. J. Mennerick, et al. Neuroactive Steroid Interactions with Voltage-Dependent Anion Channels: Lack of Relationship to GABAA Receptor Modulation and Anesthesia J. Pharmacol. Exp. Ther., February 1, 2004; 308(2): 502 - 511. [Abstract] [Full Text] [PDF]

				A. G. Komarov, B. H. Graham, W. J. Craigen, and M. Colombini The Physiological Properties of a Novel Family of VDAC-Like Proteins from Drosophila melanogaster Biophys. J., January 1, 2004; 86(1): 152 - 162. [Abstract] [Full Text] [PDF]

				E. H.-Y. Cheng, T. V. Sheiko, J. K. Fisher, W. J. Craigen, and S. J. Korsmeyer VDAC2 Inhibits BAK Activation and Mitochondrial Apoptosis Science, July 25, 2003; 301(5632): 513 - 517. [Abstract] [Full Text] [PDF]

				M. Levy, G. C. Faas, P. Saggau, W. J. Craigen, and J. D. Sweatt Mitochondrial Regulation of Synaptic Plasticity in the Hippocampus J. Biol. Chem., May 9, 2003; 278(20): 17727 - 17734. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/21/18891    most recent M201649200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager