HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 22, 19251-19254, May 31, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/22/19251    most recent C200150200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gu, J. Articles by Yuan, Z.-M. Search for Related Content PubMed PubMed Citation Articles by Gu, J. Articles by Yuan, Z.-M.

ACCELERATED PUBLICATION
Mutual Dependence of MDM2 and MDMX in Their Functional Inactivation of p53^*

Jijie Gu^§¶, Hidehiko Kawai^§, Linghu Nie, Hiroyuki Kitao, Dmitri Wiederschain^¶, Aart G. Jochemsen, John Parant^**, Guillermina Lozano^**, and Zhi-Min Yuan

From the  Department of Cancer Cell Biology, Harvard School of Public Health, Boston, Massachusetts 02115, the  Department of Molecular and Cell Biology and Centre for Biomedical Genetics, Leiden University Medical Centre, 2300 RA Leiden, The Netherlands, and the ^** Department of Molecular Genetics, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

Received for publication, March 14, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

MDMX, an MDM2-related protein, has emerged as yet another essential negative regulator of p53 tumor suppressor, since loss of MDMX expression results in p53-dependent embryonic lethality in mice. However, it remains unknown why neither homologue can compensate for the loss of the other. In addition, results of biochemical studies have suggested that MDMX inhibits MDM2-mediated p53 degradation, thus contradicting its role as defined in gene knockout experiments. Using cells deficient in either MDM2 or MDMX, we demonstrated that these two p53 inhibitors are in fact functionally dependent on each other. In the absence of MDMX, MDM2 is largely ineffective in down-regulating p53 because of its extremely short half-life. MDMX renders MDM2 protein sufficiently stable to function at its full potential for p53 degradation. On the other hand, MDMX, which is a cytoplasmic protein, depends on MDM2 to redistribute into the nucleus and be able to inactivate p53. We also showed that MDMX, when exceedingly overexpressed, inhibits MDM2-mediated p53 degradation by competing with MDM2 for p53 binding. Our findings therefore provide a molecular basis for the nonoverlapping activities of these two p53 inhibitors previously revealed in genetic studies.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

The tumor suppressor gene p53 encodes a transcription factor that is activated in response to various forms of stress, leading to the induction of a number of genes whose products mediate either cell cycle arrest or apoptosis (1). Under most physiological conditions, p53 activity is tightly controlled, primarily through the ability of MDM2 to target p53 for degradation, which ensures cell survival. Current model of p53 activation suggests that diverse stress signals converge on a single regulatory node, namely the p53-MDM2 module, and interfere with the ability of MDM2 to target p53 for degradation (2). Analogous to MDM2, MDMX ablation is also associated with p53-dependent embryonic death in mice, placing MDMX in the category of essential p53 negative regulators (3). In contrast to MDM2, however, MDMX lacks ubiquitin E3 ligase activity and is unable to target p53 for ubiquitin-proteasome-dependent proteolysis (4). Moreover, MDMX was reported to inhibit MDM2-mediated p53 degradation (4-6), contradicting the role of MDMX as defined by the genetic study. To resolve these conflicting results and gain better understanding of why neither gene product can compensate for the loss of the other, we generated MDMX-deficient cells using small interference RNA (siRNA)¹ and carried out biochemical analysis of MDM2 in these cells. In conjunction with the use of MEFs derived from either single or double knock-out mice, our loss-of-function approach allowed us to obtain compelling evidence at the molecular level to highlight mutual dependence of MDM2 and MDMX in their functional inhibition of p53 and provide support for the findings obtained in genetic studies.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Cell Culture, Transfection-- 293T, U2OS, H1299 cells (American Type Culture Collection), p53^//MDMX^/MEFs (Dr. G. Lozano, University of Texas M. D. Anderson Cancer Center), p53^/MEFs and p53^//MDM2^/ MEFs (Dr. Carl Maki, Harvard School of Public Health), were maintained in minimal essential medium supplemented with 10% fetal bovine serum. MDMX siRNA (AAAACUGCCGCUUUUGAAGAU) was generated by Dharmacon Research, Inc. (Lafayette, CO). Cells were transfected by LipofectAMINE method as described (7). Luciferase activity was measured 24 h post-transfection using Lumat 9507 luminometer (EG&G Berthold) as described previously (7). Total RNA was extracted and purified from cells using RNeasy Mini Kit (Qiagen). RT-PCR was performed using Qiagen Onestep RT-PCR kit with the corresponding primers.

Preparation of Whole Cell Extracts and Immunoprecipitation Analysis-- Cells were transfected in 60-mm plates with 5 µg of DNA and harvested at 24-h post-transfection. Cells were lysed in 200 µl of lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 1% Triton X-100, 150 mM NaCl, 1 mM dithiothreitol, 10% glycerol, 0.2 mM phenylmethylsulfonyl fluoride, and protease inhibitors) by incubating on ice for 30 min, and the extracts were centrifuged at 13,000 rpm for 15 min to remove cell debris. Protein concentrations were determined using Bio-Rad protein assay. After addition of 5× loading buffer, the samples were incubated at 95 °C for 5 min and resolved by SDS-PAGE. For immunoprecipitation, cell lysates were prepared in 0.5% Triton X-100 lysis buffer and incubated with the indicated antibody for 4 h followed by incubation with protein A/G beads (Oncogene Science, Cambridge, MA) for additional 4 h. Immune complexes and whole lysates were separated by SDS-PAGE. Proteins were transferred onto nitrocellulose membranes (Schleicher & Schuell) and probed with the indicated antibody. Proteins were visualized with an enhanced chemiluminescence detection system (PerkinElmer Life Sciences).

Subcellular Distribution Assay-- Cells were grown on Chamber Slides (Nunc, Naperville, IL) and transfected with the indicated vector. Cells were washed with cold phosphate-buffered saline (PBS) 24 h after transfection and fixed with 4% paraformaldehyde (Sigma) for 30 min at 4 °C. After washing with PBS, cells were permeabilized with ice-cold 0.2% Triton X-100 for 5 min, blocked with 0.5% bovine serum albumin for 30 min, and then incubated with the indicated antibody for 1 h. The slides were incubated with secondary antibody (Texas Red X goat antimouse IgG, Molecular Probe) and DAPI (10 µg/ml, Sigma). Following PBS wash, the slides were mounted with Fluoromount-G (Southern Biotechnology Associates) containing 2.5 mg/ml n-propyl gallate (Sigma). Specimens were examined under a fluorescent microscope (Zeiss). Cytoplasmic and nuclear fractions were isolated as described previously (7).

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Gene knock-out experiments in mice have demonstrated a crucial role for both MDM2 and MDMX in functional inactivation of p53 and, interestingly, neither gene product can substitute for the loss of the other (3). To understand these nonoverlapping activities, we abrogated MDMX expression by siRNA (8) in U2OS cells and then analyzed MDM2-mediated p53 inactivation. U2OS cells were chosen because they express detectable MDM2 and MDMX and have wild type p53. RT-PCR analysis showed a significantly lower amount of MDMX mRNA in cells that were transfected with siRNA when compared with the control cells (Fig. 1a). This down-regulation of MDMX expression was confirmed at the protein level by IP-Western analysis using anti-MDMX antibody (Fig. 1b). Interestingly, down-regulation of MDMX expression was associated with a significant increase of the p53 protein levels (Fig. 1c). Unchanged levels of other cellular proteins, such as replication protein A or Cdc2, demonstrated that this effect on p53 was specific (Fig. 1c). In light of the fact that MDMX lacks the ability to degrade p53 (4, 5), we asked whether this increase in p53 abundance resulted from altered MDM2 levels by measuring MDM2 levels in the MDMX siRNA-transfected cells. Significantly, the MDM2 protein levels in U2OS cells deficient in MDMX were indeed considerably lower than those in the control cells (Fig. 1d, lanes 1 and 2). A similar result was obtained in H1299 cells (Fig. 1d, lanes 3 and 4). To confirm this observation further, we used mouse embryonic fibroblast cells derived form MDMX and p53 double knock-out mice (p53^//MDMX^/ MEFs). While MDM2 expression was associated with a modest decrease of p53 levels in p53^//MDMX^/ MEFs (Fig. 1e, lane 2), the ability of MDM2 to degrade p53 was substantially enhanced when MDMX was introduced back into these cells (Fig. 1e, lane 5). Notably, the MDM2 levels were significantly elevated in the MEFs with restored MDMX expression (Fig. 1e, lane 5, panel 2). To determine whether this effect of MDMX was truly mediated through MDM2, we generated the N-terminal deletion mutant of MDMX (MDMXdelN) that lacks the p53-binding domain but is proficient in MDM2 binding. Remarkably, MDMXdelN also induced an up-regulation of MDM2 levels and restored the efficiency of MDM2-mediated p53 degradation to the same extent as wild type MDMX (Fig. 1e, lane 6). Coupled with the observation that MDMX or MDMXdelN alone was unable to affect p53 levels (Fig. 1e, lane 3 or 4), it appears that MDMX enhances the efficiency of MDM2-targeted p53 degradation by up-regulating MDM2 levels.

View larger version (33K): [in this window] [in a new window]   Fig. 1.   Deficiency in MDMX is associated with an impaired ability of MDM2 to target p53 for degradation. a, U2OS cells were transfected with either interference RNA (0.6 nmol) specific to MDMX or control. 0.5 µg of enhanced GFP vector was included as transfection efficiency control. mRNA was isolated 48 h post-transfection and analyzed by RT-PCR using primers specific to MDMX, p53, or GAPDH. b, lysates isolated from cells transfected with siRNA or with control vector were immunoprecipitated with anti-MDMX antibody p55 and then immunobloted with anti-MDMX antibody 6B1A. c, cell lysates prepared as in B were also analyzed by Western blot with the indicated antibodies: anti-p53 (Ab-6, Calbiochem), anti-replication fork protein A (Ab-3, Calbiochem), anti-Cdc2 p34/PSTAIRE (sc-53, Santa Cruz), anti--actin (AC-15, Sigma). d, U2OS (lanes 1 and 2) or H1299 (lanes 3 and 4) cells were cotransfected with either siRNA (0.6 nmol) specific to MDMX or control and plasmids encoding MDMX or MDM2. The MDMX or MDM2 levels were determined 48 h after transfection. -Actin was used as a loading control. e, p53//MDMX/ MEFs were transfected with the indicated plasmids and the cells were harvested 48 h after transfection for Western analysis using the indicated antibodies. -Actin was used as a loading control. f, Western blots of p53//MDMX/ MEF cell lysates 48 h after cotransfection with MDM2 (2.5 µg) and empty vector (2.5 µg, lanes 1-4), MDMX (2.5 µg, lanes 5-8), or MDMXdelRF (2.5 µg, lanes 9-12). Time intervals at the top of the lanes indicate the number of hours after cyclohexamide (20 µg/ml) addition. The effects of each construct on MDM2 steady state level can be observed by comparing with time "0" for each sample. Anti-MDMX immunoblot was performed to show MDMX or MDMXdelRF levels (top or middle panels). Anti--actin blot served as a loading control (bottom panel). Densitometric measurement of MDM2 Western blots are depicted above. Vector, ; MDMX, , MDMXdelRF, . All values were calculated as a percentage of the total starting MDM2 level at time 0.

To examine whether elevated MDM2 levels in the MDMX-expressing cells could be due to increased stability of MDM2, the half-life of this protein was examined. MDMX indeed significantly stabilized MDM2, which otherwise was an extremely unstable protein (Fig. 1f, lanes 1-4 versus lanes 5-8). The ability of MDMX to up-regulate MDM2 levels depended on the hetero-complex formation between the two proteins as MDMXdelRF mutant, which is deficient in binding to MDM2 (9), failed to prolong the half-life of MDM2 (Fig. 1f, lanes 9-12). Our results therefore indicate that MDMX confers additional stability on MDM2 by prolonging its half-life and thereby enhances MDM2's ability to target p53 for degradation.

While our findings are consistent with the results derived from genetic studies, they contradict recent reports that show MDMX acting to inhibit MDM2-mediated p53 degradation, even in the presence of up-regulated MDM2 protein levels (4-6). To resolve this issue, we set out to investigate the effect of MDMX in more detail. When coexpressed with p53 in 293T cells, MDM2, but not MDMX, down-regulated p53 levels (Fig. 2a, lanes 1-3 versus lanes 4-6). MDMX expression was in fact associated with a modest increase of p53 levels (Fig. 2a, lane 4 versus lane 6), an observation consistent with the published data (3, 4). When MDM2 and MDMX were coexpressed along with p53, the MDM2 levels were elevated with increasing amount of MDMX, whereas the steady state levels of the p53 protein varied, depending on the ratio of MDMX/MDM2 plasmids used (Fig. 2a, lanes 7-11). When the ratio of MDMX/MDM2 was less than 2:1, MDMX significantly enhanced the ability of MDM2 to degrade p53 (Fig. 2a, lanes 9 and 10). Once the ratio was greater than 2:1, however, MDM2 was found to be completely inactive in p53 degradation, as evidenced by an increase rather than a decrease in p53 levels (Fig. 2a, lane 11). A similar result was also obtained in U2OS cells (Fig. 2a, bottom), indicating that this observation is not cell-type specific.

View larger version (44K): [in this window] [in a new window]   Fig. 2.   The effect of MDMX on MDM2-mediated p53 proteolysis depends on the ratio of MDMX/MDM2. a, Plasmid encoding p53 (1 µg) was cotransfected into 293T or U2OS cells with an increasing amount of MDM2 (lanes 1-3: 0, 1, or 3 µg, repectively), MDMX (lanes 4-6: 0, 1, or 3 µg, respectively), or with MDM2 (1 µg) and increasing amount of MDMX (lanes 8-11: 0, 1, 2, and 4 µg, respectively). Cell lysates isolated from the transfectants 48 h post transfection were analyzed for MDM2, MDMX, p53, or -actin with the corresponding antibody. b, plasmids encoding p53 (1 µg) and MDM2 (1 µg) were cotransfected with an increasing amount of MDMX (lanes 1-3, 0, 2, and 4 µg, repectively), and the lysates were immunoprecipitated with anti-p53 and probed using antibody against MDM2 (top), MDMX (middle), or p53 (bottom) by Western blot analysis. c, p53/ or p53//MDMX/ MEFs were transfected with the indicated plasmids, and cell lysates were subjected to luciferase analysis. pRLTK-Renilla was included as an internal transfection efficiency control, and an empty vector was included to balance the total amount DNA used in each transfection. Values are means ± S.E. from two separate experiments.

To further understand this differential effect on p53 levels, cells expressing p53 along with MDMX and MDM2 were subjected to immunoprecipitation with an anti-p53 antibody. Western analysis of the immunocomplexes with anti-MDMX or anti-MDM2 demonstrated that with the increasing ratio of MDMX over MDM2, MDMX almost completely replaced MDM2 as the protein bound to p53 (Fig. 2b). Our results therefore demonstrate that MDMX can indeed enhance the ability of MDM2 to target p53 for degradation when the ratio of MDMX to MDM2 is close to 1:1. However, when the level of MDMX is significantly higher than that of MDM2, MDMX impedes on the MDM2-mediated p53 degradation by competing with MDM2 for p53 binding.

The inefficiency of MDM2-mediated p53 degradation in the MDMX-null cells can also suggest an impaired ability of MDM2 to functionally inhibit p53. A transcriptional assay utilizing reporter construct containing the luciferase gene driven by the p53-responsive promoter was conducted to compare the inhibitory potential of MDM2 in p53^//MDMX^/ and p53^/ MEFs. As depicted in Fig. 2c, MDM2 was indeed found less efficient in the inhibition of p53-mediated luciferase expression in p53^//MDMX^/ cells than that in p53^/ cells, consistent with the compromised MDM2-mediated p53 degradation in the MDMX-deficient cells.

Since we found that the activity of MDM2 strongly depends on MDMX, we were interested in knowing how the function of MDMX can be affected by MDM2. First we examined the effect of MDM2 expression on MDMX subcellular distribution. Similar to recently published data (10), GFP-MDMX proteins, when expressed in U2OS cells, were found mainly localized in the cytoplasm, in sharp contrast with the predominantly nuclear distributed GFP-MDM2 (Fig. 3a, top versus middle). Treatment of cells with leptomycin B, a nuclear export inhibitor, did not alter nuclear exclusion of MDMX (Fig. 3a, bottom), indicating the inability of MDMX to be nuclear imported. Similar cytoplasmic localization of MDMX was observed when a non-tagged MDMX expression vector was transfected into U2OS cells or p53^//MDM2^/ MEFs (Fig. 3b). To test whether results obtained from transfection truly reflect the distribution of endogenous MDMX, cytoplasmic and nuclear fractions isolated from p53^//MDM2^/ MEFs were subjected to IP-Western analysis with an anti-MDMX antibody. As shown in Fig. 3c, the MDMX proteins were again detected only in the cytoplasmic, but not in the nuclear fraction, supporting the results obtained in transfection experiments. Since the NLS of MDM2 is not conserved in MDMX, it appears that in contrast to the mainly nuclear distributed MDM2, MDMX is a cytoplasmic protein.

View larger version (35K): [in this window] [in a new window]   Fig. 3.   MDMX is a cytoplasmic protein that is not functional in the absence of MDM2. a, plasmid encoding GFP-MDM2 (top) or GFP-MDMX (middle) was transfected into U2OS cells, and the green proteins were visualized under a fluorescent microscope 48 h post-transfection. The MDMX-expressing cells were also treated with leptomycin B (10 ng/ml) 6 h before fixation (bottom). Cellular nuclei were identified by DAPI staining (right). b, Plasmid encoding non-tagged MDMX was transfected into U2OS cells (left) or p53//MDM2/ MEFs (right). The transfectants were fixed, stained with an anti-MDMX (6B1A) antibody, and visualized under a fluorescent microscope. c, nuclear and cytoplasmic fractions of p53//MDM2/ MEFs were immunoprecipitated with anti-MDMX antibody (p55) followed by Western blot with anti-MDMX 6B1A antibody. d, vectors containing pG13-Luc and p53 were transfected along with MDM2 or MDMX into p53//MDM2/ MEFs. pRLTK-Renilla was included as an internal transfection efficiency control, and an empty vector was used to balance the total amount DNA in each transfection. Luciferase assay was performed 24 h post-transfection as described previously. The numbers are mean ± S.E. from two experiments performed in triplicate. e, cell lysates as in d were analyzed by Western blot using the indicated antibodies. f, plasmid encoding GFP-MDMX was cotransfected either with pCMV vector or with the indicated construct into U2OS cells. Cells were fixed at 48 h post-transfection, stained with anti-MDM2 or DAPI, and visualized under a fluorescent microscope. g, vectors containing pG13-Luc and p53 were transfected along with MDM2, MDMX, or the indicated mutants into p53//MDM2/ MEFs. pRLTK-Renilla was included as a transfection control, and an empty vector was added to balance the total amount DNA in each transfection. Luciferase assay was performed 24 h post-transfection as described previously. The numbers are mean ± S.E. from two experiments performed in triplicate.

Cytoplasmic distribution of MDMX would be expected to translate into this protein's inability to functionally inactivate p53. Once again, luciferase-based functional assay was performed in p53^//MDM2^/ MEFs to test this possibility. Under the same conditions that allowed MDM2 to efficiently abrogate p53 transcriptional activity, MDMX exhibited very little effect (Fig. 3d). Measurement of the protein levels demonstrated that inability of MDMX to efficiently block p53 transcriptional activity was not a consequence of lower levels of p53 protein expressed (Fig. 3e, lane 4). Although failure of MDMX to inhibit p53 transcriptional activity is consistent with its cytoplasmic localization, this result seems to contradict the essential role of MDMX in functional inactivation of p53, as revealed in genetic studies. Since MDM2 and MDMX form a hetero-complex, we asked whether MDM2 could contribute to the inhibitory function of MDMX.

We first examined whether MDM2/MDMX complex formation affects subcellular distribution of MDMX by cotransfecting vector encoding GFP-MDMX with a control or MDM2-expressing plasmid. Interestingly, examination of the green fluorescent proteins revealed that coexpression of MDM2 was associated with an induction of nuclear redistribution of the MDMX protein (Fig. 3f, top panel 1 versus top panel 2). As predicted by the results of in vitro binding experiments, MDM2 colocalized with MDMX in the cells (Fig. 3f, panel 2), indicative of complex formation between the two proteins. It has been shown that the Zn²⁺ finger and RING domains of MDM2 are responsible for binding of MDM2 to MDMX (9). Corresponding mutants of MDM2 were then generated to test whether the MDM2/MDMX complex formation was necessary for nuclear redistribution of MDMX. Results of these experiments indeed support the requirement of hetero-complex formation for MDMX nuclear localization. As shown in Fig. 3f, top panels 3 and 4, coexpression of MDM2 mutants which cannot bind to MDMX failed to induce nuclear relocalization of MDMX, even though MDM2 mutant proteins remained predominantly nuclear localized (Fig. 3f, middle panels 3 and 4). In contrast, the p53-binding mutant of MDM2, MDM2/G58A, retained the ability to induce MDMX nuclear distribution (Fig. 3f, top panel 7). Additionally, the MDMX deletion mutant lacking its RING domain, which is required for binding to MDM2, was found no longer redistributing into the nucleus along with MDM2 (Fig. 3f, top panel 5). Since MDMX does not have its own NLS, the NLS of MDM2 would likely be contributing to nuclear distribution of the MDM2/MDMX complexes. MDM2 NLS deletion mutant was then prepared to test this possibility. As expected, removal of the NLS resulted in an exclusively cytoplasmic distribution of the MDM2 mutant proteins (Fig. 3f, middle panel 6). Interestingly, when coexpressed with MDMX, both proteins were found to colocalize in the cytoplasm (Fig. 3f, top panel 6). Taken together, our data show that nuclear redistribution of MDMX requires both the MDM2/MDMX hetero-complex formation and the NLS of MDM2.

We next asked whether coexpression of MDM2 would render MDMX capable of inactivating p53. The MDM2 mutant that was defective in binding to p53 but competent in directing MDMX into the nucleus was used to test this possibility in a functional assay. As shown in Fig. 3g, while this MDM2 mutant (column 4) and MDMX (column 7) were inactive when transfected alone, coexpression of the two proteins was associated with a significant inhibition of p53-induced luciferase activity (Fig. 3g, column 9). In contrast, coexpression of MDM2/G58AdelNLS (Fig. 3g, column 10) or MDM2/G58AdelRF (Fig. 3g, column 11) with MDMX did not have any effect, consistent with the requirement of the MDM2/MDMX hetero-complex formation and the NLS of MDM2 for MDMX's nuclear redistribution and its ability to functionally inhibit p53. Lack of MDMXdelNT's (Fig. 3g, column 12) inhibitory effect toward p53-driven transcription indicated that the observed functional p53 inhibition was mediated through the interaction between MDMX and p53. Together, our results clearly demonstrate that MDM2-depedent nuclear relocalization of MDMX is essential for its functional inhibition of p53.

We demonstrate here that in the absence of MDM2, MDMX is a cytoplasmic protein that is incompetent in its functional inactivation of p53. Formation of MDM2/MDMX hetero-complex, however, induces nuclear redistribution of MDMX and renders MDMX fully capable of inhibiting p53, indicating that the presence of MDM2 is required for the MDMX-mediated p53 inactivation. MDM2, on the other hand, is inefficient in its functional inhibition of p53 in the absence of MDMX, largely due to its rapid self-ubiquitination and degradation. MDMX stabilizes the MDM2 protein and thus ensures that MDM2 can function at its full capacity. MDMX does so by binding to MDM2 to form hetero-complexes that impede on MDM2 self-ubiquitination without affecting its ability to target p53 for degradation. The substantially prolonged half-life of MDM2 and its enhanced efficiency in p53 degradation in the presence of MDMX support this notion. Moreover, the finding that binding affinity between MDMX and MDM2 is greater than that between their respective homo-complexes (8) implies important biological role of MDMX in the regulation of MDM2-targeted p53 degradation. In conclusion, our results provide multiple lines of evidence to highlight the mutual dependence of the two homologues in their functional inactivation of p53 and explain the nonoverlapping activities elicited by MDMX and MDM2 in the cell. In our view, MDMX occupies a unique and very critical position in the regulation of p53-MDM2 module that acts as a major integrator of signals induced by genotoxic and oncogenic stress.

	ACKNOWLEDGEMENT

We are grateful to Dr. Carl Maki, Harvard School of Public Health, for p53^/ and p53^//MDM2^/ MEFs.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant RO1(CA85679-01A) (to Z.-M. Y.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ These two authors made equal contribution to this work.

^¶ Supported by National Institutes of Health Training Grant T32 ES07155.

To whom correspondence should be addressed: Dept. of Cancer Cell Biology (Bldg. 1, Rm. 209), Harvard School of Public Health, 665 Huntington Ave., Boston, MA 02115. Tel.: 617-432-0763; Fax: 617-432-0107; E-mail: zyuan@hsph.harvard.edu.

Published, JBC Papers in Press, April 12, 2002

	ABBREVIATIONS

The abbreviations used are: siRNA, small interference RNA; RT, reverse transcriptase; PBS, phosphate-buffered saline; DAPI, 4',6'-diamidino-2-phenylindole; IP, immunoprecipitation; GFP, green fluorescent protein; NLS, nuclear localization sequence; MEF, mouse embryonic fibroblast.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

This article has been cited by other articles:

				V. Lopez-Pajares, M. M. Kim, and Z.-M. Yuan Phosphorylation of MDMX Mediated by Akt Leads to Stabilization and Induces 14-3-3 Binding J. Biol. Chem., May 16, 2008; 283(20): 13707 - 13713. [Abstract] [Full Text] [PDF]

				D. M. Gilkes, Y. Pan, D. Coppola, T. Yeatman, G. W. Reuther, and J. Chen Regulation of MDMX Expression by Mitogenic Signaling Mol. Cell. Biol., March 15, 2008; 28(6): 1999 - 2010. [Abstract] [Full Text] [PDF]

				Y. Jin, S. X. Zeng, X.-X. Sun, H. Lee, C. Blattner, Z. Xiao, and H. Lu MDMX Promotes Proteasomal Turnover of p21 at G1 and Early S Phases Independently of, but in Cooperation with, MDM2 Mol. Cell. Biol., February 15, 2008; 28(4): 1218 - 1229. [Abstract] [Full Text] [PDF]

				F. B. Furnari, T. Fenton, R. M. Bachoo, A. Mukasa, J. M. Stommel, A. Stegh, W. C. Hahn, K. L. Ligon, D. N. Louis, C. Brennan, et al. Malignant astrocytic glioma: genetics, biology, and paths to treatment Genes & Dev., November 1, 2007; 21(21): 2683 - 2710. [Abstract] [Full Text] [PDF]

				B. Hu, D. M. Gilkes, and J. Chen Efficient p53 Activation and Apoptosis by Simultaneous Disruption of Binding to MDM2 and MDMX Cancer Res., September 15, 2007; 67(18): 8810 - 8817. [Abstract] [Full Text] [PDF]

				H. Kawai, V. Lopez-Pajares, M. M. Kim, D. Wiederschain, and Z.-M. Yuan RING Domain-Mediated Interaction Is a Requirement for MDM2's E3 Ligase Activity Cancer Res., July 1, 2007; 67(13): 6026 - 6030. [Abstract] [Full Text] [PDF]

				C. Kannemeier, R. Liao, and P. Sun The RING Finger Domain of MDM2 Is Essential for MDM2-mediated TGF-beta Resistance Mol. Biol. Cell, June 1, 2007; 18(6): 2367 - 2377. [Abstract] [Full Text] [PDF]

				J.-C. W. Marine, M. A. Dyer, and A. G. Jochemsen MDMX: from bench to bedside J. Cell Sci., February 1, 2007; 120(3): 371 - 378. [Abstract] [Full Text] [PDF]

				B. Hu, D. M. Gilkes, B. Farooqi, S. M. Sebti, and J. Chen MDMX Overexpression Prevents p53 Activation by the MDM2 Inhibitor Nutlin J. Biol. Chem., November 3, 2006; 281(44): 33030 - 33035. [Abstract] [Full Text] [PDF]

				M. Wade, E. T. Wong, M. Tang, J. M. Stommel, and G. M. Wahl Hdmx Modulates the Outcome of P53 Activation in Human Tumor Cells J. Biol. Chem., November 3, 2006; 281(44): 33036 - 33044. [Abstract] [Full Text] [PDF]

				J. T. Patton, L. D. Mayo, A. D. Singhi, A. V. Gudkov, G. R. Stark, and M. W. Jackson Levels of HdmX Expression Dictate the Sensitivity of Normal and Transformed Cells to Nutlin-3. Cancer Res., March 15, 2006; 66(6): 3169 - 3176. [Abstract] [Full Text] [PDF]

				Y. Ding, J.-F. Lee, H. Lu, M.-H. Lee, and D.-H. Yan Interferon-Inducible Protein IFIX{alpha}1 Functions as a Negative Regulator of HDM2. Mol. Cell. Biol., March 1, 2006; 26(5): 1979 - 1996. [Abstract] [Full Text] [PDF]

				J. D. Grier, S. Xiong, A. C. Elizondo-Fraire, J. M. Parant, and G. Lozano Tissue-Specific Differences of p53 Inhibition by Mdm2 and Mdm4 Mol. Cell. Biol., January 1, 2006; 26(1): 192 - 198. [Abstract] [Full Text] [PDF]

				K. Okamoto, K. Kashima, Y. Pereg, M. Ishida, S. Yamazaki, A. Nota, A. Teunisse, D. Migliorini, I. Kitabayashi, J.-C. Marine, et al. DNA Damage-Induced Phosphorylation of MdmX at Serine 367 Activates p53 by Targeting MdmX for Mdm2-Dependent Degradation Mol. Cell. Biol., November 1, 2005; 25(21): 9608 - 9620. [Abstract] [Full Text] [PDF]

				S. Giglio, F. Mancini, F. Gentiletti, G. Sparaco, L. Felicioni, F. Barassi, C. Martella, A. Prodosmo, S. Iacovelli, F. Buttitta, et al. Identification of an Aberrantly Spliced Form of HDMX in Human Tumors: A New Mechanism for HDM2 Stabilization Cancer Res., November 1, 2005; 65(21): 9687 - 9694. [Abstract] [Full Text] [PDF]

				L. Chen, C. Li, Y. Pan, and J. Chen Regulation of p53-MDMX Interaction by Casein Kinase 1 Alpha Mol. Cell. Biol., August 1, 2005; 25(15): 6509 - 6520. [Abstract] [Full Text] [PDF]

				Y. Pereg, D. Shkedy, P. de Graaf, E. Meulmeester, M. Edelson-Averbukh, M. Salek, S. Biton, A. F. A. S. Teunisse, W. D. Lehmann, A. G. Jochemsen, et al. Phosphorylation of Hdmx mediates its Hdm2- and ATM-dependent degradation in response to DNA damage PNAS, April 5, 2005; 102(14): 5056 - 5061. [Abstract] [Full Text] [PDF]

				M.-S. Dai, S. X. Zeng, Y. Jin, X.-X. Sun, L. David, and H. Lu Ribosomal Protein L23 Activates p53 by Inhibiting MDM2 Function in Response to Ribosomal Perturbation but Not to Translation Inhibition Mol. Cell. Biol., September 1, 2004; 24(17): 7654 - 7668. [Abstract] [Full Text] [PDF]

				D. Danovi, E. Meulmeester, D. Pasini, D. Migliorini, M. Capra, R. Frenk, P. de Graaf, S. Francoz, P. Gasparini, A. Gobbi, et al. Amplification of Mdmx (or Mdm4) Directly Contributes to Tumor Formation by Inhibiting p53 Tumor Suppressor Activity Mol. Cell. Biol., July 1, 2004; 24(13): 5835 - 5843. [Abstract] [Full Text] [PDF]

				T. Iwakuma and G. Lozano MDM2, An Introduction Mol. Cancer Res., December 1, 2003; 1(14): 993 - 1000. [Abstract] [Full Text] [PDF]

				U. M. Moll and O. Petrenko The MDM2-p53 Interaction Mol. Cancer Res., December 1, 2003; 1(14): 1001 - 1008. [Abstract] [Full Text] [PDF]

				H. Kawai, D. Wiederschain, H. Kitao, J. Stuart, K. K. C. Tsai, and Z.-M. Yuan DNA Damage-induced MDMX Degradation Is Mediated by MDM2 J. Biol. Chem., November 14, 2003; 278(46): 45946 - 45953. [Abstract] [Full Text] [PDF]

				L. K. Linares, A. Hengstermann, A. Ciechanover, S. Muller, and M. Scheffner HdmX stimulates Hdm2-mediated ubiquitination and degradation of p53 PNAS, October 14, 2003; 100(21): 12009 - 12014. [Abstract] [Full Text] [PDF]

				P. de Graaf, N. A. Little, Y. F. M. Ramos, E. Meulmeester, S. J. F. Letteboer, and A. G. Jochemsen Hdmx Protein Stability Is Regulated by the Ubiquitin Ligase Activity of Mdm2 J. Biol. Chem., October 3, 2003; 278(40): 38315 - 38324. [Abstract] [Full Text] [PDF]

				Y. Pan and J. Chen MDM2 Promotes Ubiquitination and Degradation of MDMX Mol. Cell. Biol., August 1, 2003; 23(15): 5113 - 5121. [Abstract] [Full Text] [PDF]

				E. Meulmeester, R. Frenk, R. Stad, P. de Graaf, J.-C. Marine, K. H. Vousden, and A. G. Jochemsen Critical Role for a Central Part of Mdm2 in the Ubiquitylation of p53 Mol. Cell. Biol., July 15, 2003; 23(14): 4929 - 4938. [Abstract] [Full Text] [PDF]

				H. Kawai, D. Wiederschain, and Z.-M. Yuan Critical Contribution of the MDM2 Acidic Domain to p53 Ubiquitination Mol. Cell. Biol., July 15, 2003; 23(14): 4939 - 4947. [Abstract] [Full Text] [PDF]

				Y. YANG and X. YU Regulation of apoptosis: the ubiquitous way FASEB J, May 1, 2003; 17(8): 790 - 799. [Abstract] [Full Text] [PDF]

				S. X. Zeng, Y. Jin, D. T. Kuninger, P. Rotwein, and H. Lu The Acetylase Activity of p300 Is Dispensable for MDM2 Stabilization J. Biol. Chem., February 21, 2003; 278(9): 7453 - 7458. [Abstract] [Full Text] [PDF]

				C. Li, L. Chen, and J. Chen DNA Damage Induces MDMX Nuclear Translocation by p53-Dependent and -Independent Mechanisms Mol. Cell. Biol., November 1, 2002; 22(21): 7562 - 7571. [Abstract] [Full Text] [PDF]

This Article Abstract