HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 22, 19255-19264, May 31, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/22/19255    most recent M112377200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kageyama, K. Articles by Kondo, T. Search for Related Content PubMed PubMed Citation Articles by Kageyama, K. Articles by Kondo, T. Social Bookmarking                      What's this?

Overexpression of Calreticulin Modulates Protein Kinase B/Akt Signaling to Promote Apoptosis during Cardiac Differentiation of Cardiomyoblast H9c2 Cells^*

Kan Kageyama^§¶, Yoshito Ihara^¶, Shinji Goto, Yoshishige Urata, Genji Toda^§, Katsusuke Yano^§, and Takahito Kondo

From the  Department of Biochemistry and Molecular Biology in Disease, Atomic Bomb Disease Institute, and the ^§ Third Department of Internal Medicine, Nagasaki University School of Medicine, 1-12-4 Sakamoto, Nagasaki 852-8523, Japan

Received for publication, December 26, 2001, and in revised form, March 11, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Calreticulin is a Ca²⁺-binding molecular chaperone of the lumen of the endoplasmic reticulum. Calreticulin has been shown to be essential for cardiac and neural development in mice, but the mechanism by which it functions in cell differentiation is not fully understood. To examine the role of calreticulin in cardiac differentiation, the calreticulin gene was introduced into rat cardiomyoblast H9c2 cells, and the effect of calreticulin overexpression on cardiac differentiation was examined. Upon culture in a differentiation medium containing fetal calf serum (1%) and retinoic acid (10 nM), cells transfected with the calreticulin gene were highly susceptible to apoptosis compared with controls. In the gene-transfected cells, protein kinase B/Akt signaling was significantly suppressed during differentiation. Furthermore, protein phosphatase 2A, a Ser/Thr protein phosphatase, was significantly up-regulated, implying suppression of Akt signaling due to dephosphorylation of Akt by the up-regulated protein phosphatase 2A via regulation of Ca²⁺ homeostasis. Thus, overexpression of calreticulin promotes differentiation-dependent apoptosis in H9c2 cells by suppressing the Akt signaling pathway. These findings indicate a novel mechanism by which cytoplasmic Akt signaling is modulated to cause apoptosis by a resident protein of the endoplasmic reticulum, calreticulin.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Calreticulin (CRT)¹ is a Ca²⁺-binding molecular chaperone in the endoplasmic reticulum (ER) (1). It is a highly conserved protein with >90% amino acid identity in mammals, including human, rabbit, rat, and mouse (2). The gene has also been found in insects, nematodes, protozoa, and plants, but not in yeast or prokaryotes (1, 3), suggesting a general function in living cells. CRT is involved in many biological process, including regulation of Ca²⁺ homeostasis and intracellular signaling, cell adhesion, gene expression, and glycoprotein folding (3, 4) and nuclear transport (5).

CRT is well expressed in embryonic rat heart, but its expression is significantly suppressed after birth (6). Cardiac development is believed to be regulated cooperatively by a variety of proteins, including signaling molecules (e.g. fibroblast growth factor, transforming growth factor-, ErbB2/B4, neuregulin, etc.), cell adhesion molecules (e.g. vascular cell adhesion molecule, ₄ integrin, and versican), ion channels, and transcription factors (e.g. GATA, myocyte enhancer factor-2, HAND, chicken ovalbumin upstream promoter transcription factor II, Nkx2.5, TBX5, NF-ATc, Smad6, Pax3, retinoid X receptor/retinoic acid receptor, TEF-1, WT-1, etc.) (7). Interestingly, CRT gene expression is known to be regulated by a transcription factor (Nkx2.5) that is involved in the regulation of gene expression for cardiac development (8). Recently, it has been shown that CRT is essential for cardiac and neural development in mice (9, 10). CRT-deficient embryonic cells show impaired nuclear import of the transcription factor NF-AT3 (nuclear factor of activated T cells), indicating that CRT functions in cardiac development as a component of the Ca²⁺/calcineurin/NF-AT/GATA-4 transcription pathway (9). Very recently, it has also been reported that CRT transgenic mice suffer complete heart block and sudden death (11). In that study, it was described that CRT-dependent cardiac block involves impairment of both the L-type Ca²⁺ channel and gap junction connexin-40 and connexin-43. Also observed was a decrease in phosphorylated connexin-43 in CRT transgenic heart, suggesting that the functions of protein kinases are altered via the regulation of Ca²⁺ homeostasis. The study indicates that overexpression of CRT affects not the morphogenesis, but the physiological function of cardiomyoblasts. The overall mechanism of the dephosphorylation of connexin-43 in CRT transgenic heart cells is not known, but may involve the altered regulation of protein kinase pathways. These studies suggest that CRT plays a vital role in cardiac differentiation and function, although how has not been fully clarified.

In this study, we investigated the biological role of CRT using rat cardiomyoblast H9c2 cells transfected with the CRT gene. We show that overexpression of CRT promotes apoptosis during cardiac differentiation and that suppression of protein kinase B/Akt signaling for cell survival is involved in the apoptotic process. We also show that expression of protein phosphatase 2A (PP2A), a Ser/Thr protein phosphatase, is involved in altering the regulation of Akt signaling in H9c2 cells overexpressing CRT via the regulation of Ca²⁺ homeostasis.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Antibodies and Reagents-- Antibodies against CRT, calnexin, and Grp78/BiP were purchased from Stressgen Biotech Corp. (Victoria, British Columbia, Canada). The antibody against the protein phosphatase 1 (PP1) catalytic subunit (PP1c) was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-Akt and anti-phosphorylated Akt (Ser⁴⁷³) antibodies were purchased from Cell Signaling Technology (Beverly, MA). Antibodies against PP2B-A (calcineurin) and PP2C were from Upstate Biotechnology, Inc. (Lake Placid, NY). The anti-PP2A catalytic subunit  (PP2Ac) antibody was from Transduction Laboratories (Lexington, KY). The reagents used in the study were all high grade and were from Sigma or Wako Pure Chemicals (Osaka, Japan).

Cell Culture-- H9c2 cells, a clonal line derived from embryonic rat heart (12, 13), were obtained from American Type Culture Collection (CRL-1446). H9c2 cells and the CRT gene-transfected cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS) in a humidified atmosphere of 95% air and 5% CO₂ at 37 °C. Before reaching confluence, the cells were split, plated at low density in culture dishes containing 10% FCS culture medium, and cultured for 24 h. To induce cardiac differentiation, cells were then cultured in DMEM supplemented with 1% FCS and 10 nM all-trans-retinoic acid (RA) according to the method described by Ménard et al. (14). The culture medium was replaced every 2 days.

Construction of a CRT Gene Expression Vector-- A full-length mouse CRT cDNA was cloned from total RNA of mouse monocyte-derived leukemia RAW264.7 cells by reverse transcription-PCR using SuperScript II RNase H reverse transcriptase (Invitrogen) and Advantage-HF2 Taq polymerase (CLONTECH, Palo Alto, CA) with the following primer pair, which was designed on the basis of reported nucleotide sequences (15): Primer S, CCATGCTCCTTTCGGTGCCG; and Primer A, GTGGCCTCTACAGCTCATCC. The amplified DNA fragments were subcloned into a TA cloning vector (pCRII, Invitrogen), and the nucleotide sequences of the PCR product were confirmed by sequencing with an ALFexpress II system (Amersham Biosciences, Buckinghamshire, UK). The CRT cDNA was cloned into plasmid pcDNA3.1 (Invitrogen) under the control of the cytomegalovirus promoter for expression in mammalian cells.

Gene Transfection and Selection of Cells-- The mock and CRT gene expression vectors were transfected into H9c2 cells using LipofectAMINE Plus reagent (Invitrogen) according to the manufacturer's protocol. Stable transfectants were screened by culturing with 500 µg/ml G418. The cloned G418-resistant lines were then screened for expression of CRT. Two cell lines (CRT-S2 and CRT-S8) found to express high levels of CRT upon immunoblot analysis (see Fig. 1A) were selected and used for the experiments.

Fluorescence Microscopy-- Cells (5 × 10⁴/ml) were grown on Lab-Tek chamber slides for 24 h. They were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS; pH 7.2) and permeabilized for 10 min with PBS containing 0.1% Triton X-100. The cells were then blocked with 1% bovine serum albumin in PBS, incubated with anti-CRT or anti-calnexin antibody for 1 h, and washed with PBS containing 1% bovine serum albumin. The immunoreactive primary antibody was visualized with fluorescein isothiocyanate-conjugated anti-rabbit immunoglobulin (Cappel). After washing, the stained cells were mounted in Vectashield medium. A Zeiss Axioskop2 (Carl Zeiss, Jena, Germany) with epi-illumination for fluorescence was used for fluorescence microscopic analysis.

Cell Proliferation Assay-- The proliferation of cultured cells was evaluated by measuring attached live cells photometrically after staining with crystal violet. The cells (3000) were placed in 100 µl of medium/well in 96-well plates and cultured with or without the differentiation treatment. After a specific period, the cells were fixed with 4% paraformaldehyde in PBS, washed, and stained with 0.01% crystal violet at room temperature for 20 min. Each well was extensively washed with water and dried. The stained cells were lysed by adding 100 µl of lysis buffer (20% SDS and 50% N,N-dimethylformamide (pH 4.7)), and the cell number was then estimated by measuring the absorbance at 570 nm using a microplate reader.

Apoptosis Assay-- Apoptosis was detected by flow cytometry with the terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) method (16) using an ApopTag Plus fluorescein in situ apoptosis detection kit (Intergen Co., Purchase, NY). Briefly, cells were harvested and fixed in 70% ethanol, treated with terminal deoxynucleotidyltransferase for 1 h and then with fluorescein isothiocyanate-conjugated anti-digoxigenin antibody for 1 h at room temperature, and washed with PBS containing 0.1% Triton X-100. Fluorescence intensity was measured at 530 nm using a flow cytometer (BD PharMingen). Apoptosis was also measured by flow cytometry as described (17). Briefly, the cells were washed with PBS and resuspended in PBS with 0.1% Triton X-100 and 50 µg/ml propidium iodide. The DNA content was analyzed by flow cytometry. Hypodiploid cells containing a smaller amount of DNA and a side scatter higher than that of G₀/G₁ cells were considered to be apoptotic. Caspase-3 activity was assayed by spectrophotometric detection of the chromophore p-nitroanilide after cleavage from the substrate DEVD-p-nitroanilide using a CPP32/caspase-3 colorimetric protease assay kit (Medical & Biological Laboratories, Nagoya, Japan). The p-nitroanilide light emission was quantified by measuring the absorbance at 405 nm.

Immunoblot Analysis-- Cultured cells were harvested and lysed for 20 min at 4 °C in lysis buffer (20 mM Tris-HCl (pH 7.5), 130 mM NaCl, 1% Nonidet P-40, 10% glycerol, 0.4 mM sodium orthovanadate, 10 mM sodium pyrophosphate, and 10 mM sodium fluoride including protease inhibitors (20 µM amidinophenyl methanesulfonyl fluoride, 50 µM pepstatin, and 50 µM leupeptin)). The supernatants obtained on centrifugation at 8,000 × g for 10 min then were used in subsequent experiments. Protein samples were electrophoresed on 7.5, 10, or 12.5% SDS-polyacrylamide gels under reducing conditions and then transferred to nitrocellulose membrane as described (18). The membrane was blocked with 3% bovine serum albumin or 5% skim milk in Tris-buffered saline (10 mM Tris-HCl (pH 7.5) and 0.15 M NaCl) and incubated at room temperature for 2 h with the primary antibody in Tris-buffered saline containing 0.05% Tween 20. The blots were coupled with the peroxidase-conjugated secondary antibodies, washed, and then developed using the ECL chemiluminescence detection kit (Amersham Biosciences) according to the manufacturer's instructions.

Akt Activity Assay-- Akt activity was assayed using an Akt assay kit (Cell Signaling Technology) according to the manufacturer's protocol. Briefly, Akt was immunoprecipitated from cell lysates using anti-Akt antibody, and the immunoprecipitates were then incubated at 30 °C for 30 min in an assay mixture containing an Akt substrate, GSK-3/ fusion protein. Phosphorylated proteins were separated by 12.5% SDS-PAGE and then transferred to nitrocellulose membrane to detect phosphorylated GSK-3/ using anti-phosphorylated GSK-3/ (Ser^21/9) antibody.

Northern Blot Analysis-- The full-length rat PP1c and PP2Ac cDNAs were generously provided by Dr. Kunimi Kikuchi (Hokkaido University, Hokkaido, Japan) (19, 20). A PstI-SmaI fragment of 600 bp and an EcoRI-PvuII fragment of 680 bp were prepared from the cDNAs of PP1c and PP2Ac, respectively, and used as cDNA probes. The probes were radiolabeled with ³²P using a random primer labeling kit (Takara Biomedicals, Shiga, Japan). The isolation of cytoplasmic RNA and Northern blotting were essentially performed as described by Sambrook et al. (21). Isolated RNAs (10 µg) were electrophoresed on a 1% agarose gel containing 0.6 M formaldehyde, transferred to a nylon membrane, and then hybridized with ³²P-labeled probes. Autoradiographed membranes were analyzed using a BAS5000 bioimage analyzer (Fuji Photo Film).

Protein Phosphatase Assay-- Ser/Thr protein phosphatase activity was assayed photometrically using a Ser/Thr phosphatase assay kit (kit 1, Upstate Biotechnology, Inc.) according to the manufacturer's protocol. The phosphopeptide RKpTIRR and p-nitrophenyl phosphate were used as phosphatase substrates. Protein concentrations were determined using a BCA assay kit (Pierce).

Measurement of Intracellular Free Calcium-- The intracellular free calcium concentration was measured using fura-2 essentially as described previously (22). Briefly, cells cultured on glass coverslips were loaded with 5 µM fura-2/AM (Dojindo, Kumamoto, Japan) for 20 min in Earle's balanced salt solution in the presence of 0.01% pluronic F-127. After four washes with Earle's balanced salt solution, the coverslip was positioned in a quartz cuvette containing 3.5 ml of fresh Earle's balanced salt solution at a 45° angle to both the excitation and emission light paths. The fura-2 fluorescence was determined at 37 °C using a Shimadzu RF-5000 spectrofluorophotometer operating at an emission wavelength of 505 nm with excitation wavelengths of 340 and 380 nm. The maximal signal (R_max) was obtained by adding ionomycin at a final concentration of 4 µM. Then, the minimal signal (R_min) was obtained by adding EGTA at a final concentration of 7.5 mM, followed by Tris-free base at a final concentration of 30 mM, to increase the pH to 8.3. R is the ratio (F1/F2) of the fluorescence of Ex_340 nm/Em_505 nm (F1) to that of Ex_380 nm/Em_505 nm (F2). The actual calcium concentration was calculated as K_d × (R  R_min)/(R_max  R), with K_d equal to 224 nM (23).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Establishment of CRT Gene Overexpressers Using H9c2 Cells-- To investigate the functional roles of CRT during cardiac differentiation, a CRT gene expression vector was constructed and transfected into rat cardiomyoblast H9c2 cells. After the screening of G418-resistant transfectants, the expression level of CRT was characterized immunologically. Two high expression transfectants (CRT-S2 and CRT-S8) were used in subsequent experiments. Fig. 1A shows that expression of CRT increased in the overexpressers to ~2.7-fold the level in the parental and mock-transfected (control) H9c2 cells. Transfection had no apparent effect on expression of other ER chaperones such as calnexin and BiP. The intracellular localization of CRT was examined by indirect immunofluorescence. As shown in Fig. 1B, immunoreactive signals showed a perinuclear reticular pattern in all cases, including the control and gene-transfected cells, although the signal intensity was increased in the transfectants compared with the control cells. Under non-permeabilized conditions, no significant increase in CRT expression on the cell surface was observed in the gene-transfected cells (data not shown). In the case of calnexin, the transfectants were similar to controls in the localization and intensity of immunoreactive signals.

View larger version (49K): [in this window] [in a new window]   Fig. 1.   A, calreticulin expression in control and CRT gene-transfected H9c2 cells. The expression levels for CRT, calnexin (CNX), and BiP were estimated by immunoblot analysis using specific antibodies as described under "Materials and Methods." The data represent three independent experiments. B, intracellular localization of CRT and calnexin in control and transfected H9c2 cells. The intracellular localization of CRT and calnexin was evaluated by indirect immunofluorescence (IF) microscopy using specific antibodies. The data represent two independent experiments.

Effect of Overexpression of CRT on the Differentiation of H9c2 Cells-- The H9c2 cell acquires the cardiac phenotype under conditions of retinoic acid-induced differentiation (14). To test the effect of overexpressed CRT on cardiac differentiation, control and gene-transfected H9c2 cells were cultured with or without differentiation medium (1% FCS and 10 nM RA in DMEM), and cell proliferation and morphology were compared. As shown in Fig. 2A, after 5 days of culture in differentiation medium, cell proliferation was suppressed in control cells, but was only reduced in the transfectants. Cardiac differentiation was confirmed as described by Ménard et al. (14) by suppression of cell proliferation and increase in expression of specific differentiation markers such as L-type voltage-dependent calcium channel 1C and myosin heavy chain by immunoblot analysis (data not shown). Under normal culture conditions, cell proliferation in the gene transfectants was relatively reduced compared with the control cells. Fig. 2B shows that after 5 days of culture in differentiation medium, large and round differentiated cells were seen in the control cultures. The results are consistent with a previous report (14). In contrast, the transfectants were small and round and mostly detached from the plastic culture dish, suggesting they had been damaged by the treatment.

View larger version (75K): [in this window] [in a new window]   Fig. 2.   A, proliferation of control and gene-transfected H9c2 cells treated with differentiation medium for 5 days. Cell proliferation was evaluated by measuring attached live cells photometrically after staining with crystal violet as described under "Materials and Methods." Each value represents the mean of four independent experiments, and the S.D. was always within 10% of the mean. B, morphological change in control and gene-transfected H9c2 cells during differentiation. The cells were cultured in differentiation medium for 5 days, and cell morphology was characterized microscopically. The results were reproducible in five independent experiments.

Overexpression of CRT Causes Apoptosis during the Cardiac Differentiation of H9c2 Cells-- To examine whether apoptosis contributed to the cell damage seen in the transfectants after the differentiation treatment, a TUNEL assay and analysis of DNA content with propidium iodide staining were carried out using cells treated with or without differentiation medium for 3 days. In the TUNEL assay (Fig. 3A), an increase in fluorescence intensity derived from DNA strand breaks was detected in the transfectants, but not in the control cells cultured in differentiation medium. Upon staining with propidium iodide (Fig. 3B), apoptotic cells appeared as a hypodiploid DNA peak preceding the narrow peak of diploid DNA from viable cells. In the transfectants, a hypodiploid DNA peak was detected after differentiation treatment. No such peak was seen in control cells. Next, the activity of caspase-3 was examined in the cells cultured with or without differentiation medium for 3 days. Caspase-3 activity was markedly elevated after the differentiation treatment in the transfectants compared with the control cells (Fig. 3C). These results indicate that apoptosis was promoted by overexpression of CRT in H9c2 cells during the experimentally induced differentiation.

View larger version (26K): [in this window] [in a new window]   Fig. 3.   A, TUNEL assay for control and gene-transfected H9c2 cells upon differentiation treatment. DNA double-strand breaks were detected by the TUNEL method as described under "Materials and Methods." Cells were treated with (thick lines) or without (thin lines) differentiation medium for 3 days. The data represent three independent experiments. B, flow cytometric analysis of DNA content in control and gene-transfected H9c2 cells upon differentiation treatment. Cells were treated with (thick lines) or without (thin lines) differentiation medium for 3 days. The data represent four independent experiments. C, caspase-3 activity in control and gene-transfected H9c2 cells upon differentiation treatment for 3 days. Caspase-3 activity was assayed photometrically as described under "Materials and Methods" using DEVD-p-nitroanilide as a substrate. Each value represents the mean ± S.D. of four independent experiments.

Overexpression of CRT Suppresses Protein Kinase B/Akt Activity during the Cardiac Differentiation of H9c2 Cells-- Apoptosis is known to be regulated by several signal transduction pathways, including the stress-activated protein kinase (SAPK), mitogen-activated protein kinase (MAPK), and protein kinase B/Akt pathways (24). To reveal whether overexpression of CRT affected the cell survival signaling of Akt during differentiation-induced apoptosis, the phosphorylation of Akt Ser⁴⁷³ was examined and compared between control cells and cells transfected with the CRT gene during differentiation (Fig. 4A). In controls, the levels of Ser⁴⁷³-phosphorylated Akt were unchanged on day 1 of the differentiation treatment, but decreased to 37% of initial values on day 3. In contrast, in the transfectants, they decreased to 35% of the initial level on day 1 of treatment. Akt activity was also examined in the controls and transfectants after 24 h of treatment to induce differentiation. Fig. 4B shows that Akt activity was suppressed after 24 h of culture in differentiation medium in the transfectants, but not in the control cells. This is consistent with the finding that the level of phosphorylated Akt correlates well with the activity of Akt (25). The phosphorylation of BAD, a downstream signal of Akt, was examined. Despite the change in Akt activity, the level of phosphorylated BAD did not change significantly in either the control or transfected cells during differentiation (data not shown).

View larger version (29K): [in this window] [in a new window]   Fig. 4.   A, phosphorylation of Akt in control and gene-transfected H9c2 cells upon differentiation treatment for 3 days. Ser473-phosphorylated Akt and total Akt were detected by immunoblot (IB) analysis using specific antibodies as described under "Materials and Methods." The band intensity was estimated densitometrically, and the phosphorylation rate is expressed as the relative intensity of phosphorylated Akt (Akt-P)/Akt. Each value represents the mean ± S.D. of four independent experiments. B, Akt activity in control and gene-transfected H9c2 cells upon differentiation treatment for 24 h. Akt activity was assayed as described under "Materials and Methods." Akt was immunoprecipitated from cell lysates (500 µg) using anti-Akt antibody, and Akt activity was then measured using GSK-3/ as a substrate. Phosphorylated GSK-3/ was detected by immunoblot analysis using anti-phosphorylated GSK-3/ antibody (Anti-GSK3-/-P). The data represent three independent experiments.

Differentiation Treatment-induced Apoptosis Is Enhanced in the Presence of Wortmannin and LY294002 in Both Control and CRT Gene-transfected H9c2 Cells-- To clarify the significance of Akt signaling to anti-apoptotic functions, cells were treated with 1% FCS and RA for 24 h in the presence or absence of the phosphatidylinositol 3-kinase (PI3K) inhibitors wortmannin (300 nM) and LY294002 (10 µM), and apoptosis was then examined by TUNEL methods. Fig. 5A shows that the PI3K inhibitors enhanced apoptosis during treatment for 24 h in both control and transfected cells. Caspase-3 activity was also induced by the inhibitors (data not shown). Moreover, Fig. 5B shows that phosphorylation of Akt was suppressed by the PI3K inhibitors during treatment. Thus, suppression of Akt signaling by specific inhibitors enhanced the differentiation-induced apoptosis, suggesting that Akt signaling has a vital anti-apoptotic function in this differentiation model.

View larger version (27K): [in this window] [in a new window]   Fig. 5.   Effect of wortmannin and LY294002 on apoptosis and phosphorylation of Akt in control and gene-transfected H9c2 cells upon differentiation treatment. A, TUNEL assay for control and transfected H9c2 cells upon differentiation treatment with or without wortmannin (300 nM) or LY294002 (10 µM) for 24 h. The number of apoptotic cells is expressed as a shift of the mean intensity in TUNEL-positive cells. Each value represents the mean ± S.D. of three independent experiments. B, phosphorylation of Akt in control and gene-transfected H9c2 cells upon differentiation treatment with or without wortmannin or LY294002 as described for A. Ser473-phosphorylated Akt (Akt-P) and total Akt were detected by immunoblot (IB) analysis using specific antibodies as described under "Materials and Methods." The data represent three independent experiments.

Protein Phosphatase 2A Is Up-regulated in H9c2 Cells Transfected with the CRT Gene-- To establish whether overexpression of CRT affects the activity of PI3K, an upstream signaling molecule of Akt, we examined PI3K activity in control and gene-transfected cells treated with or without differentiation medium for 24 h. However, PI3K activity was not affected by overexpression of CRT during differentiation (data not shown). Next, to identify the molecules that suppressed Akt signaling in the transfectants upon the differentiation treatment, we focused on Ser/Thr phosphatases that could dephosphorylate Akt to suppress the signaling. Fig. 6A shows the protein levels for cytosolic Ser/Thr phosphatases (i.e. PP1c, PP2Ac, PP2B-A, and PP2C) determined by immunoblot analysis in control and gene-transfected cells with or without the differentiation treatment (1% FCS and RA for 24 h). In the case of both PP1c and PP2B-A (calcineurin), there was no significant difference in the level of expression between the control and transfected cells, although the level increased slightly after the differentiation treatment. In contrast, the protein levels of PP2Ac increased significantly in the transfectants compared with the controls and increased during differentiation in both cases. Interestingly, for PP2C, protein levels were relatively suppressed in the transfectants. Moreover, no differentiation-induced increase in expression was observed, unlike for PP2Ac. The mRNA expression levels for PP2Ac and PP1c were examined by Northern blot analysis (Fig. 6B). The mRNA for PP2Ac increased significantly in the transfectants compared with the controls and following differentiation treatment in both cases. No such elevation in the basal level of mRNA was seen in the case of PP1c. These results are consistent with the protein expression levels shown in Fig. 6A.

View larger version (17K): [in this window] [in a new window]   Fig. 6.   Protein phosphatase 2A is up-regulated in gene-transfected H9c2 cells. A, immunoblot analysis of Ser/Thr protein phosphatases in control and gene-transfected H9c2 cells upon differentiation treatment for 24 h. The protein expression levels for cytoplasmic Ser/Thr protein phosphatases, including PP1c, PP2Ac, PP2B-A (calcineurin), and PP2C, were estimated by immunoblot (IB) analysis using specific antibodies as described under "Materials and Methods." B, Northern blot analysis of PP2Ac and PP1c in control and gene-transfected H9c2 cells upon differentiation treatment for 24 h. Total RNA (10 µg) was separated by electrophoresis on 1% agarose gel containing formaldehyde. After blotting onto nylon membrane, the membrane filter was hybridized with 32P-labeled DNA probes for PP1c and PP2Ac. Autoradiographed membranes were analyzed using a Fuji BAS5000 bioimage analyzer. C, enzymatic activities of PP2A and total phosphatase in control and gene-transfected H9c2 cells upon differentiation treatment for 24 h. The activities of total phosphatase and PP2A were assayed photometrically as described under "Materials and Methods" using p-nitrophenyl phosphate and RKpTIRR, respectively. Each value represents the mean ± S.D. of three independent experiments.

Next, we examined the enzymatic activity of total phosphatase and PP2A. Fig. 6C shows that PP2A activity was strengthened in the transfectants compared with the controls with or without the differentiation treatment, but no such significant difference in total phosphatase activity was seen between control and transfected cells cultured with or without differentiation medium. Collectively, these results suggest that the elevation of PP2A was responsible for suppression of Akt phosphorylation in the gene-transfected cells, leading to a greater susceptibility to apoptosis during differentiation.

PP2A Activity Is Related to the Regulation of Akt Activity in Gene-transfected Cells-- To confirm that PP2A is involved in the dephosphorylation and inactivation of Akt, we examined the effect of a specific serine/threonine phosphatase inhibitor (calyculin A) on the phosphorylation and activity of Akt in the gene transfectants cultured in differentiation medium. The transfectants were cultured with 1% FCS and RA for 24 h and then treated with 5 nM calyculin A for 0, 10, or 30 min. Fig. 7A shows that the specific activity of PP2A was significantly reduced by the treatment with calyculin A. In contrast, the phosphorylation and specific activity of Akt were significantly increased by calyculin A in a time-dependent manner (Fig. 7, B and C). Taken together, these results suggest that the specific activity of PP2A is closely related to the regulation of Akt function in H9c2 cells.

View larger version (34K): [in this window] [in a new window]   Fig. 7.   Calyculin A suppresses PP2A activity, leading to an increase in Akt phosphorylation and activity in gene-transfected H9c2 cells upon differentiation treatment. A, effect of calyculin A on PP2A activity in gene-transfected H9c2 cells upon differentiation treatment. The transfectants were cultured with 1% FCS and RA for 24 h and then treated with 5 nM calyculin A for 0, 10, or 30 min. PP2A activity was assayed photometrically as described under "Materials and Methods" using RKpTIRR as a substrate. B, effect of calyculin A on Akt phosphorylation in gene-transfected H9c2 cells upon differentiation treatment. The transfectants were cultured with differentiation medium for 24 h and then treated with calyculin as described for A. Phosphorylated Akt and total Akt were detected by immunoblot analysis as described under "Materials and Methods" using specific antibodies. The phosphorylation rate of Akt is expressed as the relative intensity of phosphorylated Akt (Akt-P)/Akt. C, effect of calyculin A on Akt activity in gene-transfected H9c2 cells upon differentiation treatment. The transfectants were cultured with differentiation medium for 24 h and then treated with calyculin as described for A. The activity of immunoprecipitated Akt was measured as described under "Materials and Methods" using GSK-3/ as a substrate. Phosphorylated GSK-3/ was detected by immunoblot analysis, and the band intensity was quantified densitometrically. Each value represents the mean ± S.D. of three to four independent experiments.

Overexpression of CRT Increases the Intracellular Free Calcium Concentration in H9c2 Cells-- CRT is a Ca²⁺ storage protein in the ER that functions in intracellular calcium homeostasis (1). We examined and compared the intracellular free Ca²⁺ contents of control and gene-transfected cells with or without the differentiation treatment (Table I). In the cells overexpressing CRT, the intracellular free Ca²⁺ concentration increased ~1.3-fold relative to the control value. This increase seems to be different from previous reports (26, 27). After 24 h of treatment to induce differentiation, intracellular free Ca²⁺ concentrations were up-regulated in both control and gene-transfected cells compared with the initial levels; but the concentration was always higher in the transfectants than in the controls, indicating that it was continuously elevated in cells overexpressing CRT.

Effect of Ca²⁺ Modulators on PP2Ac Expression and Akt Signaling-- To examine whether intracellular Ca²⁺ levels could affect expression of the PP2Ac gene and change Akt signaling, the effect of Ca²⁺ modulators on PP2Ac expression and Akt signaling was investigated. To observe the effect of increased intracellular Ca²⁺ levels, control cells were treated with thapsigargin (5 µM) or ionomycin (1 µM) for specific periods, and the mRNA and protein expression levels of PP2Ac were then estimated by Northern blot analysis and immunoblot analysis, respectively (Fig. 8, A and B, left panels). Following the treatments, an increase in intracellular free Ca²⁺ was observed using a spectrofluorophotometer (data not shown). After 4 h of treatment with thapsigargin or ionomycin, both the mRNA and protein levels of PP2Ac significantly increased, suggesting that PP2Ac gene expression is regulated by intracellular Ca²⁺ levels. To confirm this, the CRT gene-transfected cells were treated with BAPTA/AM (10 µM), a cell-permeable Ca²⁺ chelator, to decrease intracellular Ca²⁺ levels, and the mRNA and protein expression levels of PP2Ac were then estimated as described above (Fig. 8, A and B, right panels). After 2 h of treatment with BAPTA/AM, both the mRNA and protein levels of PP2Ac had significantly decreased. In parental H9c2 cells, BAPTA/AM showed a similar effect on PP2Ac expression (data not shown). The protein levels of PP2B-A showed no significant change upon treatment with such Ca²⁺ modulators. Together, these results strongly suggest that PP2Ac gene expression is regulated via intracellular Ca²⁺ homeostasis. Next, to clarify whether the change in PP2Ac expression caused by Ca²⁺ modulators reflects an alteration of Akt signaling, the phosphorylation and activity of Akt were investigated. In control cells treated with thapsigargin and ionomycin for 4 h, the phosphorylation and activity of Akt were significantly suppressed (Fig. 8C, left panel). In contrast, the gene-transfected cells treated with BAPTA/AM for 2 h showed an increase in the phosphorylation and activity of Akt (Fig. 8C, right panel). In parental cells, BAPTA/AM had similar effects on Akt signaling (data not shown). The results for Akt signaling were compatible with the change in PP2Ac expression caused by Ca²⁺ modulators. Collectively, these results indicate that PP2Ac expression is regulated via intracellular Ca²⁺ homeostasis, leading to the alteration of Akt signaling, suggesting that the change in PP2Ac expression and Akt signaling in CRT-overexpressing cells is mainly due to the altered regulation of intracellular Ca²⁺ levels.

View larger version (15K): [in this window] [in a new window]   Fig. 8.   Effect of Ca2+ modulators on PP2Ac expression and Akt signaling. Control H9c2 cells were treated with thapsigargin (5 µM) or ionomycin (1 µM) for the periods indicated (left panels). The CRT gene-transfected cells were treated with BAPTA/AM (10 µM) for the periods specified (right panels). After each treatment, cells were harvested and subjected to the following assays. A, shown are the results from Northern blot analysis of PP2Ac. Total RNA (10 µg) was separated by electrophoresis and then blotted onto nylon membrane. The membrane filter was hybridized with 32P-labeled DNA probes for PP2Ac. Autoradiographed membranes were analyzed using a Fuji BAS5000 bioimage analyzer. B, shown are the results from immunoblot (IB) analysis of PP2Ac and PP2B-A. The protein expression levels for PP2Ac and PP2B-A were estimated by immunoblot analysis using specific antibodies. C, phosphorylated Akt (Akt-P) and total Akt were detected by immunoblot analysis using specific antibodies as described under "Materials and Methods." Akt activity was assayed as described under "Materials and Methods" using GSK-3/ as a substrate. The enzymatic product of Akt, phosphorylated GSK-3/ (GSK-3/-P), was detected by immunoblot analysis using anti-phosphorylated GSK-3/ antibody. The data represent three independent experiments.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In this study, we employed cardiomyoblast H9c2 cells to establish a cell line overexpressing CRT and then examined the effect of the overexpression on the cardiac differentiation of H9c2 cells. When cultured in a differentiation medium containing 1% FCS and 10 nM RA, the overexpressers showed a decrease in cell number and an increase in DNA double-strand breaks, indicating that they were highly susceptible to apoptosis compared with controls. We found that Akt signaling was significantly suppressed in the gene-transfected cells compared with the mock-transfected controls during differentiation. In control cells, the phosphorylation and activity of Akt showed a gradual decline during the culture. In contrast, the decline was significantly accelerated in the gene-transfected cells. Furthermore, in the transfectants, PP2A, a Ser/Thr protein phosphatase, was significantly up-regulated in response to the treatment, implying that suppression of Akt signaling was due to dephosphorylation of Akt caused by the up-regulated PP2A expression. Consequently, we conclude that overexpression of CRT promotes the differentiation-dependent apoptosis of H9c2 cells through suppression of the Akt signaling pathway via up-regulation of PP2A by altered Ca²⁺ homeostasis. This is the first report of the Akt-mediated cell survival signaling pathway being modulated by the introduction of the CRT gene.

Apoptosis is regulated by several signaling pathways, including the SAPK, MAPK, and protein kinase B/Akt pathways (24). The Akt signaling pathway is a well characterized anti-apoptotic signal for cell survival (28). Under conditions in which the PI3K/Akt pathway was suppressed by PI3K inhibitors, differentiation-induced apoptosis was significantly enhanced, and Akt phosphorylation was diminished in both control and CRT gene-transfected cells (Fig. 5). This indicates that Akt is an important cell survival and anti-apoptotic signal in differentiating H9c2 cells. To elucidate why Akt signaling was affected by overexpression of CRT, we compared the activity of PI3K, an upstream signal of Akt, between control and transfected cells. Surprisingly, there was no significant difference in the activity of PI3K between the cells, although differentiation-induced apoptosis was promoted in both cases by PI3K inhibitors (data not shown). In general, growth factor-induced activation of Akt is mediated by PI3K (28), but PI3K-independent activation of Akt was also reported to occur in response to specific stresses such as heat shock and hyperosmolarity (29). Therefore, in the case of H9c2 cells undergoing differentiation, Akt signaling might not be regulated solely by PI3K. Previously, PI3K and Akt signals were both reported to be involved in the skeletal differentiation of H9c2 cells (30). The authors described that PI3K regulated cell differentiation mainly through an Akt-independent pathway. However, to our knowledge, there is no report that Akt functions in the apoptosis of H9c2 cells.

To identify other regulators of Akt activity and signaling, we focused on protein phosphatases that could regulate the activity by dephosphorylating phosphoseryl or phosphothreonyl residues of Akt. We found that the expression and activity of PP2A were significantly increased in the gene transfectants compared with the controls throughout the differentiation (Fig. 6). Ser/Thr-specific PP2A is present in most eukaryotic cells and functions in a variety of processes, including cell cycle regulation, cell differentiation, and signal transduction (31-33). PP2A is known to modulate the activities of several kinases in vitro and in vivo such as phosphorylase kinase (34), MAPKs, the calmodulin-dependent kinase, protein kinase A, protein kinase B/Akt, protein kinase C, p70 S6 kinase, IB kinase, and cyclin-dependent kinases (35). Akt is inactivated in vitro by PP2A and is activated in cells upon treatment with okadaic acid (36-38) and calyculin A (37, 39), suggesting that Akt is a putative substrate for PP2A. We also observed that calyculin A inhibited PP2A activity to prevent the differentiation-induced dephosphorylation and inactivation of Akt in cells transfected with the CRT gene (Fig. 7). Collectively, these results strongly suggest that PP2A acted as a regulator for dephosphorylation and inactivation of Akt in the transfected H9c2 cells during their differentiation.

Recently, it was reported that CRT expression levels can modulate intracellular signaling, including the -catenin pathway, by altering protein-tyrosine kinase or phosphatases (40). It was observed that overexpression of CRT in mouse L fibroblasts decreased protein phosphorylation at tyrosine and also that the dephosphorylated protein was -catenin, although the mechanism of the CRT-dependent modulation of tyrosine dephosphorylation was not made clear. Similarly, in H9c2 cells overexpressing CRT, we too observed a decrease in protein phosphorylation at tyrosine compared with controls (data not shown). However, it is worth nothing that the phosphotyrosine levels and patterns for PI3K-associated proteins differed little between the control and gene-transfected cells (data not shown). PI3K is activated by binding through Src homology domain 2 to signaling proteins bearing phosphotyrosine (41). These findings suggest that the decrease in protein phosphorylation at tyrosine occurs selectively in cells overexpressing CRT, although the molecular mechanism involved is not known.

Recently, Nakamura et al. (42) reported that cells deficient in CRT are resistant to apoptosis compared with cells expressing CRT. Pinton et al. (43) have also shown that overexpression of CRT promotes ceramide-induced apoptosis in HeLa cells. These results seem to support our finding that CRT expression positively regulates the apoptotic process under specific cellular conditions such as during cell differentiation. However, Oyadomari et al. (44) reported that overexpression of CRT actually protects pancreatic -cells from nitric oxide-induced apoptosis, whereas Zhu and Wang (45) found that CRT antisense oligonucleotides down-regulate CRT protein production and significantly increase the sensitivity to calcium ionophore-induced apoptosis. This discrepancy may be due to the different cell types, stress stimuli, and experimental models used, but further investigation is needed into the molecular mechanism of the apoptotic process in each of these experimental models.

Retinoids are potent regulators of cell proliferation and differentiation (46). CRT was reported to interfere with retinoid signals both in vitro and in vivo (47-50). Very recently, Holaska et al. (5) demonstrated that some CRT exists in the cytosol, where it functions as a nuclear export receptor for the glucocorticoid receptor by binding its DNA-binding domain, including the sequence KGFFKR. They suggested that retinoid receptors are also regulated by this nuclear export pathway because they contain an amino acid sequence highly similar to that of the glucocorticoid receptor. In the present study, RA was used to induce the cardiac differentiation of H9c2 cells. However, H9c2 cells are known to differentiate into skeletal myotubes in culture medium containing 1% FCS and no RA (14, 30). Similarly, in the CRT gene transfectants, differentiation-induced apoptosis was observed only when 1% FCS was present in the culture medium (data not shown). Moreover, Akt signaling was suppressed accompanying the up-regulation of PP2A in the transfectants only with 1% FCS (data not shown). Thus, these findings suggest that the differentiation-induced apoptosis promoted in the cells overexpressing CRT is not solely due to the alteration of retinoic acid signaling. In a previous report, the selective down-regulation of the catalytic -subunit (but not -subunit) of PP2A was observed during RA-induced differentiation of HL-60 cells (51), but the biological significance and molecular mechanism of this event are still not known.

A previous study indicates that enhanced expression of CRT increases the Ca²⁺ storage capacity of the ER (1). CRT also appears to modulate store-operated Ca²⁺ influx (26, 27, 52, 53) and to alter Ca²⁺ transport by the sarcoplasmic/endoplasmic reticulum Ca²⁺-ATPase SERCA2b (54). In the present study, the intracellular free concentration Ca²⁺ was higher in the CRT gene transfectants than in the controls throughout differentiation. To elucidate whether altered Ca²⁺ homeostasis could affect PP2Ac expression and Akt signaling, the effect of Ca²⁺ modulators on PP2Ac expression and Akt signaling was tested (Fig. 8). The results showed that PP2Ac expression increased to suppress Akt signaling upon treatment with thapsigargin and ionomycin, which increased the level of intracellular Ca²⁺. Furthermore, upon treatment with BAPTA/AM, which decreases intracellular Ca²⁺ levels, PP2Ac expression decreased to enhance Akt signaling. These results strongly suggest that PP2Ac gene expression is controlled by intracellular Ca²⁺ levels and homeostasis. The gene structure and regulation of PP2A have been elucidated in human and rat. In both PP2Ac genes, the promoter region is GC-rich and lacks TATA and CCAAT sequences, consistent with a housekeeping gene (55, 56). The PP2Ac gene contains several Sp1-binding sites and a potential cAMP-responsive element (CRE). CRE may be regulated by a calcium-regulated transcription factor (CRE-binding protein) through Ca²⁺/calmodulin-dependent kinases (57), but the DNA-binding activity for CRE was suppressed in the CRT gene-transfected cells compared with control cells in the electrophoretic mobility shift assay (data not shown). Rather, the DNA-binding activity for Sp1 increased in the CRT gene-transfected cells compared with control cells (data not shown). Although the precise mechanism linking CRE, Sp1, and overexpression of CRT in H9c2 cells is still not clear, further investigation based on Ca²⁺ homeostasis will be required to understand the gene regulation by overexpression of CRT. Although elevations in Ca²⁺ act as a signal, a prolonged increase in the concentration of Ca²⁺ can be lethal (58). Moreover, transcription factors are activated differentially by the amplitude and duration of the response to Ca²⁺ (59). Therefore, overexpression of CRT may affect the transcriptional regulation of PP2Ac mainly via the regulation of Ca²⁺ homeostasis in H9c2 cells.

CRT functions as a molecular chaperone in the ER (60). It is widely believed that CRT and its membrane-bound homolog calnexin act as molecular chaperones for N-linked glycoproteins because they are associated predominantly with folding intermediates rather than fully folded glycoproteins in vivo (60, 61). It has also been confirmed that CRT and calnexin function as chaperones for both glycosylated and non-glycosylated proteins in vitro (62, 63) and in vivo (64). This chaperone function of CRT may also contribute to the differentiation-induced apoptosis of H9c2 cells overexpressing CRT by affecting the ER stress signaling pathway. When the ER is under stress, resident kinases such as IRE1 and PKR-like ER kinase are activated to produce stress signals through a change in the luminal environment, e.g. by accumulation of unfolded proteins in the ER (65). Another ER chaperone, BiP, has been reported to be involved in the regulation of IRE1 activation in the ER under stress conditions (66). Moreover, Urano et al. (67) demonstrated that IRE1 activates c-Jun N-terminal kinase in response to ER stress. This strongly suggests that endogenous signals initiated in the ER modulate cytoplasmic signal transduction cascades. Recently, Nakagawa et al. (68) reported that caspase-12 is activated in the ER specifically in response to ER stress. Therefore, it is also possible that a pathway containing caspase-12 is involved in the differentiation-induced apoptosis of H9c2 cells overexpressing CRT.

In conclusion, we have demonstrated that, when overexpressed, CRT modulates Akt signaling to promote differentiation-induced apoptosis in H9c2 cells. CRT is essential for cardiac development, and its expression is strictly down-regulated in mature cardiomyocytes. As CRT functions to promote apoptosis, it may have some important physiological function in the process of cardiogenesis. Although further investigation of the correlation between CRT expression and apoptotic signals is required, this study has revealed a novel pathway of cellular signaling for apoptosis and its regulation via a change in the ER luminal environment and Ca²⁺ homeostasis.

	ACKNOWLEDGEMENTS

We thank Drs. Kunimi Kikuchi and Hiroshi Shima for generously providing the rat PP1c and PP2Ac cDNAs. We also thank Noriko Sadakata, Satoko Mori, and Hiromi Setoguchi for technical assistance.

	FOOTNOTES

^* This work was supported in part by grants-in-aid from the Ministry of Education, Science, Sports, and Culture of Japan and by the Japan Foundation of Cardiovascular Research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ Both authors contributed equally to this work.

To whom correspondence should be addressed. Tel.: 81-95-849-7099; Fax: 81-95-849-7100; E-mail: y-ihara@net.nagasaki-u.ac.jp.

Published, JBC Papers in Press, March 20, 2002, DOI 10.1074/jbc.M112377200

	ABBREVIATIONS

The abbreviations used are: CRT, calreticulin; ER, endoplasmic reticulum; PP, protein phosphatase; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; RA, all-trans-retinoic acid; PBS, phosphate-buffered saline; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling; GSK, glycogen synthase kinase; SAPK, stress-activated protein kinase; MAPK, mitogen-activated protein kinase; PI3K, phosphatidylinositol 3-kinase; BAPTA/AM, 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetra(acetoxymethyl) ester; CRE, cAMP-responsive element.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES