|
Originally published In Press as doi:10.1074/jbc.M201837200 on March 23, 2002
J. Biol. Chem., Vol. 277, Issue 22, 19727-19734, May 31, 2002
Quaternary Structure of Coronavirus Spikes in Complex with
Carcinoembryonic Antigen-related Cell Adhesion Molecule Cellular
Receptors*
Daniel N.
Lewicki and
Thomas M.
Gallagher
From the Department of Microbiology and Immunology, Loyola
University Medical Center, Maywood, Illinois 60153
Received for publication, February 25, 2002
 |
ABSTRACT |
Oligomeric spike (S) glycoproteins extend from
coronavirus membranes. These integral membrane proteins assemble within
the endoplasmic reticulum of infected cells and are subsequently
endoproteolyzed in the Golgi, generating noncovalently associated S1
and S2 fragments. Once on the surface of infected cells and virions,
peripheral S1 fragments bind carcinoembryonic antigen-related cell
adhesion molecule (CEACAM) receptors, and this triggers membrane fusion reactions mediated by integral membrane S2 fragments. We focused on the
quaternary structure of S and its interaction with CEACAMs. We
discovered that soluble S1 fragments were dimers and that CEACAM binding was entirely dependent on this quaternary structure. However, two differentially tagged CEACAMs could not co-precipitate with the S
dimers, suggesting that binding sites were closely juxtaposed in the
dimer (steric hindrance) or that a single CEACAM generated global
conformational changes that precluded additional interactions (negative
cooperativity). CEACAM binding did indeed alter S1 conformations, generating alternative disulfide linkages that were revealed on SDS gels. CEACAM binding also induced separation of S1 and S2. Differentially tagged S2 fragments that were free of S1 dimers were not
co-precipitated, suggesting that S1 harbored the primary oligomerization determinants. We discuss the distinctions between the
S·CEACAM interaction and other virus-receptor complexes involved in
receptor-triggered entry.
 |
INTRODUCTION |
For enveloped viruses, efficient infection requires a regulated
coalescence of virion and cellular membranes. Temporal and spatial
regulation of this membrane fusion event must occur for viral genomes
to enter into a milieu suitable for subsequent replicative processes.
Protruding virion glycoproteins, each poised to induce membrane
coalescence, have therefore evolved sensitivities to the environmental
conditions found at entry sites. These conditions trigger coordinated
and irreversible changes in virion glycoprotein conformations that can
culminate in membrane fusion. Well known triggers for conformational
change include cellular receptor binding (1-4) and/or the low pH
exposures that occur following engulfment of virus particles into
endosomes (5-7).
Our studies have focused on murine hepatitis
coronavirus
(MHV)1 as a model for
understanding receptor-triggered entry processes. This virus is a well
studied prototype member of the Coronaviridae, plus-strand RNA viruses
that cause a wide range of diseases in humans and animals (8). Because
the distinct species specificity and tissue tropism of coronavirus
strains largely correlate with changes in the spike (S) protein
(9-11), details about S interactions with receptors can enhance our
understanding of pathogenesis.
S proteins are classical type I membrane proteins, with ~1300 residue
ectodomains, 18-residue transmembrane spans, and a 38-residue cytoplasmic tail (12). Oligomerization occurs rapidly after synthesis
(13) and is followed by transport through the exocytic pathway. Within
the trans-Golgi network, a furin-like protease cleaves the full-length
spike into two similar-sized fragments, a peripheral S1, and a
membrane-anchored S2 (14, 15). S1, which associates with S2 through
noncovalent interactions, is responsible for binding to cellular
receptors. S2 contains the core machinery necessary for membrane fusion
(16).
Receptors for the MHV S proteins include numerous members of the
carcinoembryogenic antigen-related
cell adhesion molecule (CEACAM)
family, immunoglobulin-like glycoproteins that serve as entry portals
for a relatively wide variety of pathogens (17-21). The prototype
receptor for MHV, murine CEACAM isoform 1a, is a type I
transmembrane glycoprotein with four Ig-like ectodomains designated as
N (amino-terminal)-A1a-Ba-A2a (22).
The N-domain binds to S proteins (17). After binding to a soluble
N-CEACAM fragment, spikes undergo a conformational change that can, in
some cases, be revealed as S1 shedding from S2 (23). This structural
change may be relevant to MHV entry, as S1 separation from S2
correlates with increased membrane fusion activity (23). A conservative
view is that the CEACAM binding to S releases free energy that drives
the conformational changes required to promote coalescence of the virus
and cell membranes. Indeed, soluble forms of CEACAM can, through
binding S proteins, increase the propensity of S to fuse membranes
(24).
Understanding the connections between CEACAM binding and membrane
fusion depends in part on a view of the actual CEACAM-binding site(s)
on the S protein. Kubo et al. (25) mapped the CEACAM-binding sites to the amino-terminal 330 residues of S1, but high resolution protein structures are currently unknown. Questions also remain concerning quaternary structures, both S dimers and trimers have been
proposed (13, 26). Thus, we embarked on studies assessing the
oligomeric organization of S and S·CEACAM complexes.
Here we report that S1, when shed from S2 or when produced
independently from cDNAs, exists stably as a dimer. We discovered that S1 dimers, but not monomers, will bind to CEACAM receptors. In
fact, we found that the region conferring dimerization resides at or
near the CEACAM1a-binding site, an unexpected finding
because oligomerization determinants in functionally analogous spike
proteins of other viruses reside within the integral membrane fragments
(27-35). Remarkably, only one CEACAM bound each S1 dimer, and we
identified a novel disulfide-linked S1 conformation in S1·CEACAM
complexes. Our findings refine the current understanding of CEACAM
receptors as mediators of conformational change, and they form the
basis for a preliminary model of receptor-triggered entry with both
parallels and deviations from established paradigms for enveloped virus
entry (36-41).
 |
EXPERIMENTAL PROCEDURES |
Cells--
HeLa-tTA and rabbit kidney clone 13 (RK13) cells were
grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat-inactivated fetal calf serum (FCS). 293 EBNA cells
secreting N-CEACAMFc (formerly known as sMHVR-Ig) (42) were
grown in DMEM, 10% FCS containing the antibiotics G418 (100 µg/ml)
and hygromycin B (200 µg/ml).
Mutagenesis of CEACAM and Spike cDNAs--
We used murine
CEACAM1a cDNA (22, 42) as template for PCR amplification of
N-CEACAM6×His, using the primer 5'
GTCGAGTCAGTGGTGGTGGTGGTGGTGTACATGAAATCG 3', which encodes a
hexahistidine tag. We used cDNA of S (strain JHM) (43) as a template
for PCR amplification of S gene and truncated S fragments. To create
ST212S/Y214S/Y216S, mutagenic oligonucleotides 5'
GGTGGTTCTTTTTCTGCGTCCTATGCGGAT 3' and its complement were used in
PCRs. To generate enhanced green fluorescent protein (EGFP)-tagged
spikes, we engineered pTM1-S (42) with a unique NotI
restriction site using the following oligonucleotide: 5'
GGGCTCGAGTCAGCGGCCGCTCACAGGGATCCAGTGCATCCTCATGGGC 3'. EGFP DNA
was PCR-amplified from pEGFP (Clontech), and 741-nucleotide Not-I/BamHI restriction fragment was cloned into
the aforementioned pTM1-S(NotI).
Mutations in the CEACAM and S genes were confirmed by DNA sequencing.
Restriction fragment exchanges with the vaccinia virus insertion-expression vector pTM1-S and pTM3-S1 were all performed as
described previously (42). All recombinant plasmids were cloned and
amplified in E. coli DH5 (for pTM1 vector) or HB101 (for
pTM3 vector). Plasmids pTM1-S DPR2 (23) and
pTM1-SEGFP were used directly, without recombination into
vaccinia vectors. The SEGFP protein includes the entire
S DPR2 followed by an eight-residue linker (ALDPPVAT) and
a C-terminal 238-residue EGFP.
Generation of Recombinant Vaccinia Viruses--
Plasmids were
recombined into the thymidine kinase (TK) gene of vaccinia virus
(strain WR) by standard methods (44), and TK-negative virus isolates
were amplified in RK13 cells. TK-negative virus stocks were screened
for S or CEACAM cDNA expression by co-infection with vTF7.3 (45)
and immunoblot detection of the respective proteins in cell lysates, as
described previously (23). We used the following vaccinia recombinants:
vTM3-S1 (encodes 769-residue S1 of JHM strain); vTM3-S1330
(encodes 330-residue amino-terminal S1 fragment);
vTM3-S1 DPR1 (encodes S1 with internal deletion of
residues 446-598); vTM3-S1 DPR2 (encodes S1 with
internal deletion of residues 429-586); vTM1-SECTO
(encodes 1320 residue S1/S2 lacking transmembrane span and cytoplasmic
tail); vTM1-ST212S/Y214S/Y216S (encodes full-length S of
JHM strain with the indicated substitutions); vTM3-CEACAMECTO (encodes N-A1-B-A2 Ig-like domains of
CEACAM); vTM3-N-CEACAM6×His (encodes N-domain of CEACAM
with 6 carboxyl-terminal histidines).
Preparation of Soluble CEACAM and Spike Proteins--
To obtain
N-CEACAMFc, 293 EBNA:N-CEACAMFc cells (42) were
incubated overnight in serum-free DMEM. Culture supernatant was collected, filtered through a 0.22-µm membrane, dialyzed against PBS-P (PBS (pH 7.4) containing 0.01% protease inhibitor mixture (Sigma)), and concentrated 100-fold by ultrafiltration. In some cases,
N-CEACAMFc was further purified by affinity chromatography on Sepharose-protein G (Amersham Biosciences). Supernatants typically yielded ~2 µg of N-CEACAMFc per ml.
To obtain 35S-labeled recombinant S proteins and
CEACAMECTO, monolayers of HeLa-tTA cells were inoculated at
2 plaque-forming units/cell for 1 h at 37 °C with vTF7.3 and
the respective recombinant vaccinia viruses. At 6 h
post-infection, the medium was replaced with labeling media (DMEM, 1%
dialyzed FCS lacking cysteine and methionine). After 1 h, the
labeling media was replaced with serum-free labeling media supplemented
with 25 µCi/ml Tran35S-label (ICN). After a 5-h
incubation, the harvested media were clarified by centrifugation,
dialyzed, and concentrated ~100-fold by ultrafiltration as described above.
Immunoprecipitations--
S proteins were collected from media
or from cytoplasmic extracts. Extracts were obtained by lysing infected
cell monolayers with PBS-P containing 0.5% Nonidet P-40, followed by
removal of nuclei by centrifugation at 3000 × g for 15 min. S proteins were immunoprecipitated with N-CEACAMFc,
with polyclonal anti-JHM serum (R33 serum, a gift from Dr. Stanley
Perlman, University of Iowa), or with monoclonal anti-S antibody J.2.6
(J.2.6 hybridoma (46), a gift from Dr. John Fleming, University of
Wisconsin, Madison) or with monoclonal anti-S antibody number 2 (a gift
from Dr. Fumihiro Taguchi, National Institute of Neuroscience, Tokyo,
Japan). Briefly, these Igs were bound for 4 h at 4 °C to Gamma
Bind G-Sepharose beads (Amersham Biosciences). The beads were then
rinsed three times with PBS-P by centrifugation and resuspension. After
overnight incubation at 4 °C with media or cytoplasmic extracts,
beads were rinsed by five cycles of centrifugation and resuspension
with PBS-P containing 0.5% Nonidet P-40. The final bead pellets were mixed with SDS solubilizer (2% SDS, 5% -mercaptoethanol ( -ME), 2.5% Ficoll, 0.005% bromphenol blue) for 5 min at 100 °C.
Dissolved proteins were then visualized after SDS-PAGE by fluorography
or immunoblotting, as described previously (23).
Velocity Gradient Ultracentrifugation--
Samples containing
35S-labeled S1 or S1·CEACAM complexes were
overlaid onto linear 5 ml of 5-20% w/w sucrose gradients in PBS-P containing 0.01% BSA. A parallel gradient was overlaid with an extract
containing the sedimentation markers horseradish peroxidase (HRPO
4 S), human immunoglobulin G1 (IgG 7 S), and E. coli
-galactosidase (16 S). After sedimentation at 55,000 rpm at
5 °C for 5.95 h in a Beckman Spinco SW55 rotor, fractions (20 per gradient) were collected. The S proteins in gradient fractions were
then immunoprecipitated and visualized by fluorography after SDS-PAGE.
Sedimentation standards were identified in the fractions by enzymatic
assays (HRPO by turnover of
2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid substrate; IgG by
immunoblotting with goat anti-human IgG:alkaline phosphatase;
-galactosidase by turnover of chlorophenol
red- -D-galactopyranoside substrate).
Cross-linking of Oligomeric
Spikes--
Dithiobis(succinimidylproprionate) (DSP) (25 mM in dimethyl sulfoxide) was added at various dilutions to
35S-labeled S1 in PBS (pH 7.4). After 30 min at 22 °C,
reactions were quenched with 50 mM Tris-HCl (pH 7.0). The
35S-labeled S1 proteins were then immunoprecipitated with
N-CEACAMFc, eluted with SDS solubilizer lacking -ME,
electrophoresed on a 4-20% polyacrylamide gradient gel under reducing
and non-reducing conditions, and then visualized via fluorography.
Co-production and Immunoprecipitation of S2 and
S2EGFP--
vTF7.3-infected HeLa-tTA cells were lipofected
with pTM1-S and with pTM1-SEFGP, alone or together, using
LipofectAMINE PLUS according to manufacturer's instructions
(Invitrogen). At 4 h post-lipofection, media were removed and
replaced for 1 h with labeling media and then 5 h with
labeling media containing 25 µCi/ml Tran35S-label. Cell
monolayers were lysed with PBS-P (pH 8.5) containing 0.5% Nonidet
P-40, and nuclei were pelleted by centrifugation (3000 × g for 10 min at 4 °C).
To separate 35S-labeled S1 from S2, leaving S1 associated
with Sepharose beads,35S-labeled S proteins in clarified
cytoplasmic extracts were captured by incubation for 4 h at
4 °C with Sepharose G:N-CEACAMFc beads, and suspensions
were incubated for an additional 4 h at 37 °C before pelleting
beads (3000 × g for 10 min at 4 °C). Supernatants enriched in S2 were further depleted of residual S1 by two additional cycles of incubation with fresh Sepharose G:N-CEACAMFc
beads. The final supernatants were then incubated overnight at 4 °C
with Sepharose G:anti-GFP antiserum to capture S2EGFP
fragments. Beads were rinsed extensively with PBS-P containing 0.5%
Nonidet P-40, suspended in SDS solubilizer, and heated to 100 °C for
5 min. Dissolved proteins were visualized by immunoblot with anti-S2 mAb 10G (a gift from Drs. Stuart Siddell and Fumihiro Taguchi) (47)
after SDS-PAGE. Fluorograms of immunoblots were obtained using a
Molecular Dynamics Typhoon 8600 PhosphorImager.
 |
RESULTS |
Peripheral S1 Fragments Are Dimers--
It is still unclear
whether coronavirus peplomers are dimers or trimers. Vennema
et al. (13) reported that MHV spikes are dimers, and Delmas
and Laude (26) provided evidence for cross-linking of transmissible
gastroenteritis coronavirus spikes into trimers. Noting the importance
of quaternary structure in viral glycoprotein function, we decided to
return to the question of S protein oligomerization in the MHV system.
We initially used velocity gradient ultracentrifugation and chemical
cross-linking to determine the quaternary structure of peripheral S1
fragments. We found that S1 produced independently from cDNA
sedimented to an ~9 S position on sucrose gradients (Fig.
1A). Identical results were
obtained for S1 fragments that had separated from S2 (data not shown).
Formulas based on isokinetic sedimentation of globular proteins
indicated that the ~9 S material would have a molecular mass
of ~200 kDa, consistent with S1 homodimers (48). However, elongated
molecules like the coronavirus spike peplomer (49) might exhibit
unusual sedimentation behavior in sucrose gradients; therefore, we
further addressed quaternary structure by cross-linking
35S-labeled S1 with DSP, a thiol-cleavable chemical
cross-linker. Cross-linked spikes were then immunoprecipitated and
electrophoresed under non-reducing and reducing conditions (Fig.
1B). S1 dimers appeared with increasing concentrations of
DSP, and -ME reduced these dimers into monomers. Extraordinarily
high DSP concentrations (25 mM) did not complex
35S-labeled S1 into higher order oligomers (data not
shown).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Biochemical analysis of S1 quaternary
structure. A, recombinant 35S-labeled
S1 (strain JHM) was sedimented on a linear 5-20% sucrose gradient,
and the 35S-labeled S1 in gradient fractions was visualized
after immunoprecipitation onto Sepharose G:N-CEACAMFc
beads, SDS-PAGE, and fluorography. The positions of standards
horseradish peroxidase (HRPO 4S), human IgG1 (IgG
7S), and -galactosidase ( -Gal 16 S) are
indicated above the electropherogram. B,
recombinant 35S-labeled S1 was incubated at room
temperature for 30 min with 0 (lane 1), 0.08 mM
(lane 2), or 0.25 mM DSP (lane 3) and
then immunoprecipitated onto Sepharose G:N-CEACAMFc beads
and visualized via fluorography following SDS-PAGE on a 4-20%
acrylamide gradient gel under non-reducing (NR) and reducing
(R) conditions.
|
|
CEACAM Receptor-binding Sites Are Only Present in S
Oligomers--
In previous experiments, we found that polyclonal
anti-spike antibodies captured newly synthesized
35S-labeled S proteins, whereas N-CEACAMFc, an
immunoadhesion consisting of the N-domain of murine
CEACAM1a linked to a carboxyl-terminal IgG1 Fc, did not.
The 35S-labeled spikes bound N-CEACAMFc only
after ~30 min of maturation (23). One possible explanation for this
finding was that S proteins oligomerized during the 30-min maturation
process and that soluble receptors only recognized oligomers. This
contention was consistent with numerous reports that glycoprotein
oligomerization is required to maintain native tertiary structures (50,
51). Therefore, we separated newly synthesized spikes by rate-zonal
sedimentation through sucrose gradients prior to immunoprecipitation
and detection on SDS-polyacrylamide gels. Polyclonal anti-spike serum
captured a range of spike forms from ~6 S to ~14 S (Fig.
2, 0 hour anti-S). In
contrast, N-CEACAMFc specifically immunoprecipitated
~14 S macromolecules (Fig. 2, 0 hour N-CEACAMFc).
When a 2-h chase period occurred prior to cell lysis and sedimentation,
N-CEACAMFc and anti-S antiserum captured only the ~14 S
forms (Fig. 2, 2 hour panels). The two endoproteolytic
cleavage products S1 (lower band) and S2 (upper band) indicated that
most of the spikes had encountered a trans-Golgi-localized furin-like
protease (14). These findings indicate that newly synthesized S
proteins form CEACAM-binding sites concomitant with their
oligomerization.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 2.
Specific capture of assembled S oligomers by
N-CEACAMFc. HeLa cells synthesizing S proteins were
pulse-labeled with Tran35S-label for 30 min and either
lysed immediately (0 hour) or chased for 2 h at
37 °C before lysis (2 hour). Lysates were sedimented on
sucrose gradients, and S proteins in each fraction were
immunoprecipitated with polyclonal antiserum (anti-S) or
with N-CEACAMFc (N-CEACAMFc) before
SDS-PAGE and visualization by fluorography. The sedimentation markers
horseradish peroxidase (HRPO 4S), immunoglobulin G
(IgG 7S), and -galactosidase (B-Gal 16S) were
identified in fractions from a parallel gradient by enzyme or
immunodetection assays, and their positions are indicated
above the electropherograms.
|
|
We next considered whether CEACAM-binding sites disappeared when S
proteins dissociated into monomers. We could address this question
because our S1 preparations moderately break down when incubated for 2 h at 37 °C. On sucrose gradient sedimentation, the 37 °C-treated
S1 occupied two positions, ~9 S and ~6 S, with ~6 S being
consistent with 110-kilodalton monomers (48) (Fig. 3, top panel).
N-CEACAMFc only precipitated the ~9 S material (Fig. 3,
bottom panel), suggesting that monomers do not contain a
CEACAM-binding site. Interestingly, soluble ectodomain fragments of S2
co-sedimented with the ~6 S S1 monomers in these gradients.

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3.
Influence of S1 quaternary structure on its
ability to bind CEACAM. 35S-Labeled SECTO
in sucrose gradient fractions was precipitated with trichloroacetic
acid (top panel) or with N-CEACAMFc
(bottom panel) and then detected by fluorography following
SDS-PAGE. The sedimentation marker immunoglobulin G (IgG 7S)
was identified in fractions from a parallel gradient by immunodetection
assays, and its position is indicated above the
electropherogram. The positions of S1 and S2ECTO are also
indicated.
|
|
The Extreme Amino-terminal Portion of the Spike Participates in
Oligomerization--
Although many viral glycoproteins oligomerize
through associations between integral membrane fragments (27-35), the
MHV S proteins formed dimers of peripheral S1 fragments. To delineate
further the sites on S1 responsible for oligomer formation, we took
advantage of the discoveries of Kubo et al. (25), who
determined that the amino-terminal 330 residues of S1
(S1330) can independently form a receptor-binding site. If
the receptor-binding site requires oligomerization (Fig. 2, 0 hour N-CEACAMFc panel), then S1330
might be a homodimer. If so, S1330 fragments would form hetero-oligomeric complexes with larger, complete S1 fragments (S1769) in cells concomitantly synthesizing both polypeptides.
We synthesized recombinant S1769 and S1330 in
HeLa cells, alone or together, using vaccinia vectors. After 2-h
radiolabeling periods with Tran35S-label, we lysed the cell
monolayers and immunoprecipitated the S1769 with an
anti-spike mAb (J.2.6) (46). The mAb J.2.6, whose epitope we roughly
mapped to residues 510-540,2
should only directly precipitate the S1769 fragment. In
contrast, N-CEACAMFc would precipitate both
S1769 and S1330 proteins.
Indeed, N-CEACAMFc recognized and precipitated both the
independently produced S1769 and S1330
fragments from the media and cytoplasmic extracts (Fig.
4). As expected, mAb J.2.6 recognized the
S1769 fragment but did not precipitate the independently
produced S1330 fragment. However, mAb J.2.6 precipitated
both fragments when they were co-synthesized, indicating
hetero-oligomers (Fig. 4, lane 8, lower panel,
arrow). Unlike the homo-oligomers, cells did not secrete
S1769·S1330 hetero-oligomers (Fig. 4,
lane 8, upper panel), which we interpret as a
failure to adopt native glycoprotein structure in the endoplasmic
reticulum (50, 52).

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 4.
Co-immunoprecipitation of amino-terminal
fragments S1330 and S1769. Recombinant S1
fragments of 330 or 769 residues were synthesized alone or together in
HeLa cells in the presence of Tran35S-label. S fragments in
the media (top panel) and cell lysates (bottom
panel) were immunoprecipitated with N-CEACAMFc or with
anti-spike mAb J.2.6. The J.2.6 epitope is between S1 residues 510 and
540. 35S-Labeled proteins were visualized by fluorography
following SDS-PAGE.
|
|
Each S Dimer Binds One CEACAM Molecule--
Because receptors can
perform an essential role in reorganizing viral spikes into structures
that can mediate membrane fusion (2-4,53), we sought further details
on S·CEACAM interactions. Our data indicated that relatively small S
fragments bound CEACAM receptors only when combined into dimers.
However, it remained uncertain whether multiple receptors could
coordinately bind a single S1 dimer. We addressed this question
initially by sedimenting S1·N-CEACAMFc complexes on
sucrose gradients. If each S1 monomer contained a separate
CEACAM-binding site, then two dimers might link to the bivalent
N-CEACAMFc to form an estimated 16 S complex (48). Higher
order complexes also may form at equivalent S1:N-CEACAMFc ratios. However, we observed only ~16 S complexes and no evidence of
higher order aggregates (Fig. 5).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 5.
Sucrose gradient sedimentation analysis of
unbound S1 and S1·N-CEACAMFc complexes.
A, two possibilities for the CEACAM-binding site architecture
on a S1 dimer are illustrated. If only one CEACAM binds each S1 dimer,
then divalent N-CEACAMFc would bind one or two S1 dimers.
Alternatively, two CEACAM-binding sites could complex S1 and
N-CEACAMFc into higher order oligomers. B,
unbound 35S-labeled S1 and 35S-labeled
S1·N-CEACAMFc complexes were sedimented on linear sucrose
gradients and detected in gradient fractions after immunoprecipitation,
SDS-PAGE, and fluorography. The sedimentation markers immunoglobulin G
(IgG 7S) and -galactosidase (B-gal 16S) were
identified in fractions from a parallel gradient by enzyme or
immunodetection assays, and their positions are indicated
above the electropherograms. An ~16 S
S1·N-CEACAMFc complex was identified. There was no
evidence of larger complexes in pellet fractions (not shown).
|
|
We obtained additional insight into the stoichiometry of
S1·N-CEACAMFc complexes by co-producing both ligands in
293 cells in the presence of Tran35S-label, ensuring that
the synthesis of S1 exceeded that of N-CEACAMFc. From
the radioactive media, we then precipitated 35S-labeled
N-CEACAMFc in complex with 35S-labeled S1
using Sepharose-protein G beads. After electrophoretic separation of
the precipitated proteins, we determined 35S-labeled
S1:35S-labeled N-CEACAMFc ratios of 3.40 ± 0.05 (n = 3). Complexes in which one S1 dimer is
tethered to each arm of the bivalent N-CEACAMFc (Fig.
5A) would be expected to have an 35S-labeled
S1:35S-labeled N-CEACAMFc ratio of 3.428 (42,
43).
We next used a series of co-immunoprecipitation tests to further
address whether more than one CEACAM could simultaneously bind an S
oligomer. A soluble CEACAM bound to S1 may or may not prevent the
subsequent binding of another alternatively tagged (and thus
distinguishable) soluble receptor. We bound recombinant S1 dimers to
35S-labeled CEACAMECTO, which contains the four
ectodomain fragments (N-A1-B-A2) of murine CEACAM1a (17,
22). We then immunoprecipitated these complexes with N-CEACAMFc, which possesses the unique, easily
captured, Fc tag. Immunoprecipitation of the 35S-labeled
CEACAMECTO would indicate that both receptors bound simultaneously to S1 dimers. This receptor-binding state would be
consistent with an S oligomer whose structure parallels those of
influenza hemagglutinin and HIV gp120, in which each monomer (of the
trimer) can bind a single cell-surface ligand (27, 54).
In these assays, N-CEACAMFc did not precipitate
35S-labeled CEACAMECTO fragments over a range
of S1:35S-labeled CEACAM ratios (Fig.
6, Upper, B).
Anti-S1 (mAb J.2.6) precipitations showed that 35S-labeled
CEACAMs indeed complexed with S1 at subsaturating levels (Fig. 6,
Upper, C). We also observed diminished
immunoprecipitation of S proteins by N-CEACAMFc as
CEACAMECTO concentrations increased, again supporting the
contention that the two different receptors could not concomitantly
bind S1 dimers (Fig. 6, Upper, A).

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 6.
Immunoprecipitation of S1·CEACAM
complexes. Upper, constant amounts of recombinant S1
were incubated with increasing quantities of 35S-labeled
CEACAMECTO for 12 h at 4 °C, and proteins in each
aliquot were then immunoprecipitated with immobilized
N-CEACAMFc (A and B) or immobilized
anti-spike mAb J.2.6 (C). (Lower). Constant
amounts of recombinant S1 (35S-labeled as indicated) were
incubated with increasing amounts of CEACAMECTO
(35S-labeled as indicated) for 12 h at 4 °C, and
proteins were then affinity-purified with N-CEACAM6×His
(A and B) or immunoprecipitated with mAb J.2.6
(C). The dots on the right of each
panel represent the positions of the 113- and 75-kDa molecular mass
markers.
|
|
We considered the possibility that the large carboxyl-terminal Fc
"tags" might cause an "artificial" steric hindrance in these tests. Thus, in parallel co-precipitation tests, we replaced
N-CEACAMFc with N-CEACAM6×His, whose 6-residue
appendage is roughly 100 times smaller than IgG Fc.
N-CEACAM6×His also could not precipitate
S1·35S-labeled CEACAMECTO complexes (Fig.
6, Lower, B), but it could readily bind and
precipitate free S1 dimers (Fig. 6, Lower, A). Thus, for steric hindrance to account for this interference by CEACAMECTO, separate binding sites on each S1 monomer would
have to be very closely juxtaposed in the dimer.
We also considered the unconventional possibility that an S1 dimer
contains only a single asymmetric binding site for CEACAM that is
formed by different residues contributed by each S1 monomer. We
synthesized S1 proteins with the changes T212S, Y214S and Y216S, which
Suzuki and Taguchi (55) had shown to decrease CEACAM binding. We found
that N-CEACAMFc inefficiently precipitated this mutant, but
its capture increased 2-fold when hetero-oligomerized with wild-type
S330 (Fig. 7 boxed
bands). These results argue for a traditional view, in which each
S1 monomer (in the context of a dimer) contains a complete
CEACAM-binding site.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7.
Increased capture of mutant S proteins with
low affinity CEACAM-binding sites by heteromerization with
S1330 fragments. Recombinant mutant S proteins with
three point mutations within the CEACAM-binding site were synthesized
alone or with increasing amounts of "wild-type" S1330.
S1330 synthesis was adjusted by the input multiplicity of
infection (MOI) of the vTM3-S1330 vector.
35S-labeled spikes were immunoprecipitated with
N-CEACAMFc and visualized by fluorography following
SDS-PAGE. The amount of 35S associated with the
boxed bands was quantitated with a Molecular Dynamics
Typhoon 8600 PhosphorImager. The left box contained 2141 cpm
and the right box contained 4329 cpm.
|
|
A CEACAM-induced Conformational Change of S1--
Our data
suggested that each monomer of the S1 dimer contained an independent
CEACAM-binding site. Although sterically hindered sites might explain
how only one CEACAM binds S1 oligomers, another possibility was
negative cooperativity. For negative cooperativity to be a viable
possibility, CEACAM would have to bind one S1 monomer (of the dimer)
and induce structural rearrangements such that the adjacent monomer
would have substantially reduced CEACAM affinity. Thus, we evaluated
whether CEACAM binding induces structural rearrangements in S1.
On considering possible assays for structural rearrangements, we noted
that reduction strongly affects the electrophoretic mobility of some
variant S1 fragments, ~70 and 90 kDa before and after -ME
treatment, respectively. Thus we entertained the possibility that
CEACAM binding might induce conformational changes that rearrange complex disulfide architectures, thereby creating electrophoretic mobility shifts. It is important to note that we felt any positive results might even have some biological relevance, as we had shown earlier (56) that chemicals preventing disulfide rearrangements block
MHV infection by arresting S-induced membrane fusion.
We exposed 35S-labeled S1 dimers to the sulfhydryl
alkylating agent N-ethylmaleimide (NEM) either before or
after being complexed with N-CEACAMFc at 37 °C. In
parallel, a monoclonal anti-S1330 antibody (number 2) (25)
was used in place of N-CEACAMFc, with the expectation that
its binding would not induce conformational changes. Electropherograms
of the immunoprecipitated 35S-labeled proteins revealed
that a small proportion of CEACAM-bound S1 had complexed into an
~220-kDa disulfide-linked protein (Fig. 8A, lane 4). Thiols
apparently had to be available to generate the ~220-kDa protein, as
S1 that had been pretreated with NEM bound N-CEACAMFc but
did not couple into disulfide-linked oligomers (Fig. 8A,
lane 3). Formation of the ~220-kDa protein required N-CEACAMFc, because mAb number 2 bound S1 but did not
generate any electrophoretic mobility changes (Fig. 8B,
lanes 3 and 4). Collectively, these data indicate
that CEACAM binding can induce structural rearrangements in the S1
dimer, revealed in this experiment by alternative disulfide
linkages.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
CEACAM-induced conformational changes in
S1. 35S-Labeled S1 DPR1 was either
incubated with (+) or without ( ) 10 mM NEM prior to
incubation for 4 h at 4 °C and then for 1 h at 37 °C
with 10 µg of N-CEACAMFc (A) or
anti-S1330 mAb number 2 (B) (25). Samples not
previously treated with NEM were then incubated with 10 mM
NEM (+). 35S-Labeled proteins were detected by fluorography
using a Molecular Dynamics Typhoon 8600 PhosphorImager following
SDS-PAGE under reducing (+ B-ME) and non-reducing ( B-ME) conditions. N-CEACAMFc-induced disulfide-linked
high molecular weight spikes are indicated by the *.
|
|
Quaternary Structure of S2 Fragments after Separation from
S1--
High resolution structural data are available for portions of
many different viral spike proteins, and the images reveal strong intersubunit interactions within integral membrane (fusion-inducing) post-translational fragments (6, 30-34, 36, 57). Less structural data
are available for the peripheral (receptor binding) fragments, but
collected information often leads to models in which these peripheral
subunits separate from each other during membrane fusion reactions (36,
38). This "opening" of spike oligomers may expose hydrophobicity
within the integral membrane fragments, a prerequisite for membrane
fusion. Our discovery of stable intersubunit connections in coronavirus
S1 led us to doubt whether these peripheral subunits separate during
fusion, and also led us to speculate about additional oligomerization
determinants in integral membrane S2 fragments.
We engineered S proteins with a relatively large 238-residue EGFP
appended to their cytoplasmic tails. We found that the
carboxyl-terminal additions had no effect on S protein transport
through the exocytic pathway, indicating that oligomerization motifs in
the S ectodomains remained. Moreover, SEGFP proteins
induced membrane fusion (data not shown). Therefore, these tagged S
proteins allowed us to identify intersubunit associations through
co-immunoprecipitation experiments. In one set of tests, we synthesized
S and SEGFP, either separately or together, in the presence
of Tran35S-label. We then immunoprecipitated all
EGFP-tagged spikes from total cytoplasmic extracts using GFP-specific
rabbit antiserum (a gift from Dr. Katherine L. Knight, Loyola
University Medical Center), and we visualized S2 proteins by
immunoblotting (Fig. 9A).
Uncleaved SEGFP and S2EGFP were detected
(lane 2), and when co-produced with S, the untagged S2 was
also detected (lane 3). This association of
S2EGFP with untagged S2 was not due to a generalized aggregation of S2 chains after cell lysis, because there was no capture
of S2 from mixtures of S and SEGFP lysates (lane
4). The abundance of 35S-labeled S1 in the
immunoprecipitated material suggested that S1 dimers might be
responsible for holding S2 and S2EGFP together (Fig.
9B).

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 9.
Analysis of the oligomeric organization of S2
after separation from S1. A, cDNAs encoding S
or EGFP-tagged S (SEGFP) were transfected alone or
together into vTF7.3-infected HeLa cells. Following metabolic labeling
with Tran35S-label, cytoplasmic extracts were prepared, and
EGFP-associated proteins were immunoprecipitated with polyclonal
anti-GFP serum. Immunoprecipitates were then electrophoresed and
immunoblotted for S2 fragments. Co indicates co-synthesis of
S and SEGFP. Mix indicates that equal volumes of
independently produced S and SEGFP lysates were mixed
before immunoprecipitation. B, autoradiographic image
of the immunoblot in A. C, cell lysates were depleted
of S1 by sequential immunoprecipitations with N-CEACAMFc at
pH 8.5 and 37 °C. Supernatants from the final depletions were
collected, and EGFP-associated proteins were immunoprecipitated with
anti-GFP serum. Immunoprecipitates were electrophoresed and
immunoblotted for S2 fragments. D, autoradiographic
image of the immunoblot in C. Arrows indicate the
positions of uncleaved SEGFP
(Sunc-EGFP), S2EGFP, untagged S2, and
S1.
|
|
We next separated S1 dimers from S2 by tethering the spikes onto
Sepharose:N-CEACAMFc and then incubating at pH 8.5 and
37 °C. This condition separates S1 from S2 (58), leaving "free" S2 chains in supernatants. Sequential incubations with
Sepharose:N-CEACAMFc generated S1-depleted supernatants
from which anti-GFP serum immunoprecipitated free S2 chains.
Here there was capture of S2EGFP (Fig. 9C,
lanes 2 and 4), but there was no evidence of
co-immunoprecipitating untagged S2 (lane 3). We correlated
this co-immunoprecipitation failure with the absence of S1 in the
samples (Fig. 9D). Collectively, these findings suggested
that S2, when free of S1, does not exist as an oligomer.
 |
DISCUSSION |
The oligomeric spike glycoproteins of many enveloped viruses are
endoproteolytically cleaved into two fragments that act in concert to
mediate virion binding to receptors and subsequent uncoating through
virion:cell membrane fusion. Crystal structures of the influenza
hemagglutinin reveal an exterior composed of peripheral residues and
their receptor-binding sites, and a core which harbors much of the
integral membrane fragments, thereby sequestering the hydrophobic
residues involved in membrane fusion. The dramatic conformational
changes of integral membrane fragments that link opposing membranes can
only be accomplished in concert with some displacement of the
peripheral fragments. How this displacement process takes place remains
unclear, i.e. whether the peripheral fragments symmetrically
dissociate into monomers to reveal the membrane fusion apparatus, as
depicted in some models (36, 38), or whether they displace
asymmetrically as oligomers. We require additional insights into this
process to understand the mechanisms by which antibodies neutralize
virus infections and to develop chemicals that interfere with virus entry.
This issue of spike protein quaternary structures both before and after
fusion activation has been studied in some detail with primate
lentiviruses, and some interesting findings have emerged. The
peripheral (gp120) fragments that shed from spike complexes during
membrane fusion can be monomers, indeed they were crystallized in this
form (54), but can also exist as stable dimers (59-61) or trimers
(62-64). By contrast, it is generally accepted that the integral
membrane (gp41) fragments exist as trimers, at least in postfusion low
energy conformations (29, 30, 32, 34, 65). Recent findings also
indicate that different gp160 subunits, one with a lethal defect in
receptor binding and the other unable to induce membrane fusion, can
assemble together into functional heteromeric trimers (66). These
findings naturally lead to the hypothesis that asymmetries can exist
within gp120-41 complexes, at least in some of the conformations
existent during fusion activation.
Similarly, it is conceivable that asymmetries exist in murine
coronavirus spikes. We found that the peripheral (S1) fragments of MHV
exist as stable, homogenous dimers (Fig. 1). Although we view our data
as convincing, we understand its apparent inconsistency with previous
reports of trimeric associations within MHV integral membrane (S2)
fragments (67). Collective findings therefore raise the possibility
that asymmetric dimer-to-trimer transitions occur as part of the
pathway to membrane fusion activation. In this view, closely spaced S1
fragments would dissociate as stable dimers, leaving S2 fragments to
rearrange during membrane fusion into trimeric structures. Such
dimer-trimer transitions are not unprecedented in virus entry, although
they take place in the context of icosahedrally ordered glycoprotein
lattice (68, 69). No evidence exists for ordered arrangements of spikes
on the pleiomorphic coronavirus envelopes.
Another interesting and potentially relevant asymmetry likely exists in
S·CEACAM complexes. Only a single CEACAM binds to an S1 dimer. This
was most convincingly demonstrated in our co-immunoprecipitation tests,
where differentially tagged N-CEACAM fragments never captured S1·CEACAM complexes (Fig 6). Further support for a one S1 dimer:one CEACAM ratio came from our stoichiometric analyses of
S1·N-CEACAMFc complexes (Fig. 5). As we consider it
unlikely that only a single asymmetric binding site exists on each S1
dimer (Fig. 7), we propose two alternative possibilities. Either the
two CEACAM binding sites on an S1 dimer juxtapose very closely (steric
hindrance) or the binding of a single CEACAM rapidly induces global
structural changes in S1 that destroy the adjacent binding site
(negative cooperativity). This latter possibility has received
consideration in the SIV gp140·CD4 interaction, whose stoichiometry
has recently been identified as an asymmetric complex of one gp140
trimer bound to a single monomeric CD4 (63). Our data, although not yet
able to distinguish between the two possibilities, nonetheless provides
evidence of structural flexibility in the S proteins and thus points
toward negative cooperativity as a likely scenario. We and others know that CEACAM binding induces separation of S1 from S2, a readily observed "global" conformational change (23, 58). The
CEACAM-binding site is itself dependent on a more global conformation,
being formed with assembly of S into oligomers (Fig. 2), and eliminated on S1 dissociation into monomers (Fig. 3). This relationship between S
oligomerization and CEACAM binding may provide the structural contexts
for conformational changes across S1 monomers once a CEACAM molecule
binds. In support of this view, we demonstrated that
N-CEACAMFc binding induced the formation of high molecular weight disulfide-linked S1 structures whose formation was blocked by
pre-incubation with the sulfhydryl-alkylating agent
N-ethylmaleimide (Fig. 8A). The inability of
S1330-specific mAb number 2 to induce comparable disulfide
rearrangements (Fig. 8B) further supports the contention
that entry-specific conformational changes in S1 are unique to CEACAM
binding. Although these findings are interesting, perhaps even
suggesting a role for disulfide exchanges during coronavirus entry
(56), we acknowledge that additional CEACAM-induced changes in S1
structure must be investigated to fully address how S conformations
bring about virus:cell membrane fusion.
We were surprised to find oligomerization control in peripheral S1
fragments, because analogous viral glycoproteins oligomerize into
trimers through interactions in their integral membrane fragments. Our
attempts to determine whether the S1-interacting sites represent the
only oligomerization motif prompted us to construct epitope-appended S
proteins, and we discovered that tags as large as the 238-residue EGFP
could be added to the carboxyl (cytoplasmic) termini of S2 without
interrupting oligomeric assembly, intracellular transport, and
function. With these epitope-tagged S proteins, it became relatively
straightforward to determine whether S2 fragments retained an
oligomeric structure even after separation from S1. Thus we bound
soluble CEACAMs and shifted to 37 °C, a condition known to
dissociate S1 from S2 (23). We expected that this would leave free S2
chains in an oligomeric state, as primary S2 sequences predict
oligomeric coiled-coils (70) similar to those found in many other viral
spike proteins that carry out membrane fusion reactions (29-34, 65).
However, we did not co-immunoprecipitate S2·S2EGFP
complexes when free of S1, suggesting S2 monomers (Fig. 9). This
interesting finding raises questions about the ways that MHV S2 might
fuse membranes. The generally accepted view is that the integral
membrane fragments of enveloped viruses collapse into -helical
coiled-coils on bringing opposing membranes together (36-41). It
remains to be determined whether MHV S2 monomers independently adopt an
anti-parallel -helical coiled-coil arrangement that is similar to
that observed for other viruses.
A preliminary model of S proteins during virus entry is shown in Fig.
10. In this figure, we depict a single
CEACAM that is bound to peripheral S1 (25, 55). This bound CEACAM may
preclude additional binding by steric hindrance (Fig. 10A)
or alternatively may induce conformational changes in S1 oligomers that
precludes additional CEACAM binding (Fig. 10B). Additional
conformational changes are thought to occur at S1-S2 connections,
resulting in the displacement of the two fragments from each other
(23). These events are considered prerequisites for the insertion of a
hydrophobic portion of S2 into cellular membranes (71). As little is
yet known regarding the later stages of the membrane fusion process,
subsequent depictions of S2 structures are not illustrated. Coronavirus
S2 fragments do contain putative M-helix and C-helix regions (Fig. 10),
which are predicted to form coiled-coils (70). A collapse into
coiled-coil structures may bring about membrane fusion in a fashion
similar to that hypothesized for the enveloped myxoviruses (39),
retroviruses (29, 30, 72), and filoviruses (33, 73). We intend to use
this model to generate and refine hypotheses on coronavirus entry into
cells.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 10.
Models depicting the quaternary
structure of the MHV spike and its interaction with CEACAM during virus
entry. To explain a single CEACAM-binding site on S1 dimers, two
models are illustrated. Model A appeals to steric hindrance,
and model B suggests that a single CEACAM induces global
structural rearrangements (illustrated as the change of S1 from an
oval to a rectangle). These conformational
changes preclude additional CEACAM binding. In both cases, CEACAM
binding is hypothesized to displace S1 from S2 (23) and to permit the
insertion of an internal fusion peptide (green triangle)
into the target cell membrane (71).
|
|
 |
ACKNOWLEDGEMENTS |
We thank Sean Kelly for expert technical
assistance and Edward Thorp, Dr. Alan J. Wolfe, and Dr. Joseph Brewer
for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant R01 NS 31616 (to T. M. G.) and NIAID Grant 5 T32
AI07508-05 from the National Institutes of Health (to K. L. Knight).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Microbiology
and Immunology, Loyola University Medical Center, 2160 South First
Ave., Maywood, IL 60153. Tel.: 708-216-4850; Fax: 708-216-9574; E-mail:
tgallag@lumc.edu.
Published, JBC Papers in Press, March 23, 2002, DOI 10.1074/jbc.M201837200
2
T. M. Gallagher, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
MHV, murine
hepatitis virus;
CEACAM, carcinoembryonic antigen-related cell adhesion
molecule;
DMEM, Dulbecco's modified Eagle's medium;
FCS, fetal calf
serum;
TK, thymidine kinase;
DPR, deletion prone region;
PBS, phosphate-buffed saline;
mAb, monoclonal antibody;
-ME, -mercaptoethanol;
EGFP, enhanced green fluorescent protein;
HRPO, horseradish peroxidase;
DSP, dithiobis(succinimidylproprionate);
NEM, N-ethylmaleimide;
gp, glycoprotein.
 |
REFERENCES |
| 1.
|
Hernandez, L. D.,
Hoffman, L. R.,
Wolfsberg, T. G.,
and White, J. M.
(1986)
Annu. Rev. Cell Dev. Biol.
12,
627-661
|
| 2.
|
Doranz, B. J.,
Baik, S. S. W.,
and Doms, R. W.
(1999)
J. Virol.
73,
10346-10358[Abstract/Free Full Text]
|
| 3.
|
Sattentau, Q. J.,
and Moore, J. P.
(1991)
J. Exp. Med.
174,
407-415[Abstract/Free Full Text]
|
| 4.
|
Wu, L.,
Gerard, N. P.,
Wyatt, R.,
Choe, H.,
Parolin, C.,
Ruffing, N.,
Borsetti, A.,
Cardoso, A. A.,
Desjardin, E.,
Newman, W.,
Gerard, C.,
and Sodroski, J.
(1996)
Nature
384,
179-183[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Mothes, W.,
Boerger, A. L.,
Narayan, S.,
Cunningham, J. M.,
and Young, J. A.
(2000)
Cell
103,
679-689[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Bullough, P. A.,
Hughson, F. M.,
Skehel, J. J.,
and Wiley, D. C.
(1994)
Nature
371,
37-43[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Stegmann, T.,
White, J. M.,
and Helenius, A.
(1990)
EMBO J.
13,
4231-4241
|
| 8.
|
Perlman, S.,
Lane, T. E.,
and Buchmeier, M. J.
(2000)
in
Effects of Microbes on the Immune System
(Cunningham, M.
, and Fujinami, R. S., eds)
, pp. 331-348, Lippincott-Raven, New York
|
| 9.
|
Sanchez, C. M.,
Izeta, A.,
Sanchez-Morgado, J. M.,
Alonso, S.,
Sola, I.,
Balasch, M.,
Plana-Duran, J.,
and Enjuanes, L.
(1999)
J. Virol.
73,
7607-7618[Abstract/Free Full Text]
|
| 10.
|
Phillips, J. J.,
Chua, M. M.,
Lavi, E.,
and Weiss, S. R.
(1999)
J. Virol.
73,
7752-7760[Abstract/Free Full Text]
|
| 11.
|
Kuo, L.,
Godeke, G. J.,
Raamsman, M. J.,
Masters, P. S.,
and Rottier, P. J.
(2000)
J. Virol.
74,
1393-1406[Abstract/Free Full Text]
|
| 12.
|
Schmidt, I.,
Skinner, M.,
and Siddell, S. G.
(1987)
J. Gen. Virol.
68,
47-56[Abstract/Free Full Text]
|
| 13.
|
Vennema, H.,
Rottier, P. J. M.,
Heijnen, L.,
Godeke, G. J.,
Horzinek, M. C.,
and Spaan, W. J. M.
(1990)
in
Coronavirus and Their Diseases
(Cananaugh, D.
, and Brown, T. D. K., eds)
, pp. 9-19, Plenum Publishing Corp., New York
|
| 14.
|
Sturman, L. S.,
Ricard, C. S.,
and Holmes, K. V.
(1985)
J. Virol.
56,
904-911[Abstract/Free Full Text]
|
| 15.
|
Frana, M. F.,
Behnke, J. N.,
Sturman, L. S.,
and Holmes, K. V.
(1985)
J. Virol.
56,
912-920[Abstract/Free Full Text]
|
| 16.
|
Yoo, D. W.,
Parker, M. D.,
and Babiuk, L. A.
(1991)
Virology
180,
395-399[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Dveksler, G. S.,
Pensiero, M. N.,
Dieffenbach, C. W.,
Cardellichio, C. B.,
Basile, A. A.,
Elia, P. E.,
and Holmes, K. V.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
1716-1720[Abstract/Free Full Text]
|
| 18.
|
Dveksler, G. S.,
Pensiero, M. N.,
Cardellichio, C. B.,
Williams, R. K.,
Jiang, G.-S.,
Holmes, K. V.,
and Dieffenbach, C. W.
(1991)
J. Virol.
65,
6881-6891[Abstract/Free Full Text]
|
| 19.
|
Holmes, K. V.,
and Dveksler, G. S.
(1994)
in
Cellular Receptors for Animal Viruses
(Wimmer, E., ed)
, pp. 403-443, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 20.
|
Billker, O.,
Popp, A.,
Brinkmann, V.,
Wenig, G.,
Schneider, J.,
Caron, E.,
and Meyer, T. F.
(2002)
EMBO J.
21,
560-571[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Leusch, H. G.,
Drzeniek, Z.,
Markos-Prustai, Z.,
and Wagener, C.
(1991)
Infect. Immun.
59,
2051-2057[Abstract/Free Full Text]
|
| 22.
|
Beauchemin, N.,
Draber, P.,
Dveksler, G.,
Gold, P.,
Gray-Owen, S.,
Hammarstrom, S.,
Holmes, K. V.,
Karlsson, A.,
Kuorki, M.,
Lin, S.-H.,
Lucka, L.,
Najjar, S. M.,
Neumaier, M.,
Obrink, B.,
Shively, J. E.,
Skubitz, K. M.,
Stanners, C. P.,
Thomas, P.,
Thompson, J. A.,
and Virji, M. A.
(1999)
Exp. Cell Res.
252,
243-249[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Krueger, D. K.,
Kelly, S. M.,
Lewicki, D. N.,
Ruffolo, R.,
and Gallagher, T. M.
(2001)
J. Virol.
75,
2792-2802[Abstract/Free Full Text]
|
| 24.
|
Taguchi, F.,
and Matsuyama, S.
(2002)
J. Virol.
76,
950-958[Abstract/Free Full Text]
|
| 25.
|
Kubo, H.,
Yamada, Y. K.,
and Taguchi, F.
(1994)
J. Virol.
68,
5403-5410[Abstract/Free Full Text]
|
| 26.
|
Delmas, B.,
and Laude, H.
(1990)
J. Virol.
64,
5367-5375[Abstract/Free Full Text]
|
| 27.
|
Wilson, I. A.,
Skehel, J. J.,
and Wiley, D. C.
(1981)
Nature
289,
366-373[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Wiley, D. C.,
and Skehel, J. J.
(1987)
Annu. Rev. Biochem.
56,
365-394[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Weissenhorn, W.,
Wharton, S. A.,
Calder, L. J.,
Earl, P. L.,
Moss, B.,
Aliprandis, E.,
Skehel, J. J.,
and Wiley, D. C.
(1996)
EMBO J.
15,
1507-1514[Medline]
[Order article via Infotrieve]
|
| 30.
|
Weissenhorn, W.,
Dessen, A.,
Harrison, S. C.,
Skehel, J. J.,
and Wiley, D. C.
(1997)
Nature
387,
426-430[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Lu, M.,
Blacklow, S. C.,
and Kim, P. S.
(1995)
Nat. Struct. Biol.
2,
1075-1082[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Bernstein, H. B.,
Tucker, S. P.,
Kar, S. R.,
McPherson, S. A.,
McPherson, D. T.,
Dubay, J. W.,
Lebowitz, J.,
Compans, R. W.,
and Hunter, E.
(1995)
J. Virol.
69,
2745-2750[Abstract]
|
| 33.
|
Weissenhorn, W.,
Calder, L. J.,
Wharton, S. A.,
Skehel, J. J.,
and Wiley, D. C.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
6032-6036[Abstract/Free Full Text]
|
| 34.
|
Chan, D. C.,
Fass, D.,
Berger, J. M.,
and Kim, P. S.
(1997)
Cell
89,
263-273[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Dutch, R. E.,
Leser, G. P.,
and Lamb, R. A.
(1999)
Virology
254,
147-159[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Weissenhorn, W.,
Dessen, A.,
Calder, L. J.,
Harrison, S. C.,
Skehel, J. J.,
and Wiley, D. C.
(1999)
Mol. Membr. Biol.
16,
3-9[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Skehel, J. J.,
and Wiley, D. C.
(1998)
Cell
95,
871-874[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Eckert, D. M.,
and Kim, P. S.
(2001)
Annu. Rev. Biochem.
70,
777-810[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Joshi, S. B.,
Dutch, R. E.,
and Lamb, R. A.
(1998)
Virology
248,
20-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Melikyan, G. B.,
Markosyan, R. M.,
Hemmati, H.,
Delmedico, M. K.,
Lambert, D. M.,
and Cohen, F. S.
(2000)
J. Cell Biol.
151,
413-423[Abstract/Free Full Text]
|
| 41.
|
Russell, C. J.,
Jardetzky, T. S.,
and Lamb, R. A.
(2001)
EMBO J.
20,
4024-4034[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Gallagher, T. M.
(1997)
J. Virol.
71,
3129-3137[Abstract]
|
| 43.
|
Parker, S. E.,
Gallagher, T. M.,
and Buchmeier, M. J.
(1989)
Virology
173,
664-673[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Mackett, M.,
Smith, G. L.,
and Moss, B.
(1984)
J. Virol.
49,
857-864[Abstract/Free Full Text]
|
| 45.
|
Fuerst, T. R.,
Earl, P. L.,
and Moss, B.
(1987)
Mol. Cell. Biol.
7,
2538-2544[Abstract/Free Full Text]
|
| 46.
|
Fleming, J. O.,
Stohlman, S. A.,
Harmon, R. C.,
Lai, M. M. C.,
Frelinger, J. A.,
and Werner, L. P.
(1983)
Virology
131,
296-307[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Routledge, E.,
Stauber, R.,
Pfleiderer, M.,
and Siddell, S. G.
(1991)
J. Virol.
65,
254-262[Abstract/Free Full Text]
|
| 48.
|
Young, B. D.
(1984)
in
Centrifugation: A Practical Approach
(Rickwood, D., ed), 2nd Ed.
, pp. 127-140, IRL Press, Washington D. C.
|
| 49.
|
Cavanagh, D.
(1995)
in
The Coronaviridae
(Siddell, S. G., ed)
, pp. 73-103, Plenum Publishing Corp., New York
|
| 50.
|
Doms, R. W.,
Lamb, R. A.,
Rose, J. K.,
and Helenius, A.
(1993)
Virology
19,
545-562
|
| 51.
|
Tatu, U.,
Hammond, C.,
and Helenius, A.
(1995)
EMBO J.
14,
1340-1348[Medline]
[Order article via Infotrieve]
|
| 52.
|
Feldmann, H.,
Will, C.,
Schikore, M.,
Slenczka, W.,
and Klenk, H. D.
(1991)
Virology
182,
353-356[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Sattentau, Q. J.,
Moore, J. P.,
Vignaux, F.,
Traincard, F.,
and Poignard, P.
(1993)
J. Virol.
67,
7383-7393[Abstract/Free Full Text]
|
| 54.
|
Kwong, P. D.,
Wyatt, R.,
Robinson, J.,
Sweet, R. W.,
Sodroski, J.,
and Hendrickson, W. A.
(1998)
Nature
393,
648-659[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Suzuki, H.,
and Taguchi, F.
(1996)
J. Virol.
70,
2632-2636[Abstract]
|
| 56.
|
Gallagher, T. M.
(1996)
J. Virol.
70,
4683-4690[Abstract]
|
| 57.
|
Chen, J.,
Wharton, S. A.,
Weissenhorn, W.,
Calder, L. J.,
Hughson, F. M.,
Skehel, J. J.,
and Wiley, D. C.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
12205-12209[Abstract/Free Full Text]
|
| 58.
|
Sturman, L. S.,
Ricard, C. S.,
and Holmes, K. V.
(1990)
J. Virol.
64,
3042-3050[Abstract/Free Full Text]
|
| 59.
|
Doms, R. W.,
Earl, P. L.,
and Moss, B.
(1991)
Adv. Exp. Med. Biol.
300,
203-219[Medline]
[Order article via Infotrieve]
|
| 60.
|
Earl, P. L.,
Doms, R. W.,
and Moss, B.
(1992)
J. Virol.
66,
5610-5614[Abstract/Free Full Text]
|
| 61.
|
Center, R. J.,
Earl, P. L.,
Lebowitz, J.,
Schuck, P.,
and Moss, B.
(2000)
J. Virol.
74,
4448-4455[Abstract/Free Full Text]
|
| 62.
|
Earl, P. L.,
Doms, R. W.,
and Moss, B.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
648-652[Abstract/Free Full Text]
|
| 63.
|
Kim, M.,
Chen, B.,
Hussey, R. E.,
Chishti, Y.,
Montefiori, D.,
Hoxie, J. A.,
Byron, O.,
Campbell, G.,
Harrison, S. C.,
and Reinherz, E. L.
(2001)
J. Biol. Chem.
276,
42667-42676[Abstract/Free Full Text]
|
| 64.
|
Center, R. J.,
Schuck, P.,
Leapman, R. D.,
Arthur, L. O.,
Earl, P. L.,
Moss, B.,
and Lebowitz, J.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
14877-14882[Abstract/Free Full Text]
|
| 65.
|
Weissenhorn, W.,
Calder, L. J.,
Dessen, A.,
Laue, T.,
Skehel, J. J.,
and Wiley, D. C.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6065-6069[Abstract/Free Full Text]
|
| 66.
|
Salzwedel, K.,
and Berger, E. A.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
12794-12799[Abstract/Free Full Text]
|
| 67.
|
Gallagher, T. M.,
Parker, S. E.,
and Buchmeier, M. J.
(1990)
J. Virol.
64,
731-741[Abstract/Free Full Text]
|
| 68.
|
Lescar, J.,
Roussel, A.,
Wien, M. W.,
Navaza, J.,
Fuller, S. D.,
Wengler, G.,
Wengler, G.,
and Rey, F. A.
(2001)
Cell
105,
137-148[CrossRef][Medline]
[Order article via Infotrieve]
|
| 69.
|
Pletnev, S. V.,
Zhang, W.,
Mukhopadhyay, S.,
Fisher, B. R.,
Hernandez, R.,
Brown, D. T.,
Baker, T. S.,
Rossmann, M. G.,
and Kuhn, R. J.
(2001)
Cell
105,
127-136[CrossRef][Medline]
[Order article via Infotrieve]
|
| 70.
|
Singh, M.,
Berger, B.,
and Kim, P. S.
(1999)
J. Mol. Biol.
290,
1031-1041[CrossRef][Medline]
[Order article via Infotrieve]
|
| 71.
|
Luo, Z.,
and Weiss, S. R.
(1998)
Virology
244,
483-494[CrossRef][Medline]
[Order article via Infotrieve]
|
| 72.
|
Fass, D.,
Davey, R. A.,
Hamson, C. A.,
Kim, P. S.,
Cunningham, J. M.,
and Berger, J. M.
(1997)
Science
277,
1662-1666[Abstract/Free Full Text]
|
| 73.
|
Gallaher, W. R.
(1996)
Cell
85,
477-478[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. W. Howard, E. A. Travanty, S. A. Jeffers, M. K. Smith, S. T. Wennier, L. B. Thackray, and K. V. Holmes
Aromatic Amino Acids in the Juxtamembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Glycoprotein Are Important for Receptor-Dependent Virus Entry and Cell-Cell Fusion
J. Virol.,
March 15, 2008;
82(6):
2883 - 2894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. A. Versteeg, P. S. van de Nes, P. J. Bredenbeek, and W. J. M. Spaan
The Coronavirus Spike Protein Induces Endoplasmic Reticulum Stress and Upregulation of Intracellular Chemokine mRNA Concentrations
J. Virol.,
October 15, 2007;
81(20):
10981 - 10990.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Tangudu, H. Olivares, J. Netland, S. Perlman, and T. Gallagher
Severe Acute Respiratory Syndrome Coronavirus Protein 6 Accelerates Murine Coronavirus Infections
J. Virol.,
February 1, 2007;
81(3):
1220 - 1229.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. M. de Haan, E. te Lintelo, Z. Li, M. Raaben, T. Wurdinger, B. J. Bosch, and P. J. M. Rottier
Cooperative Involvement of the S1 and S2 Subunits of the Murine Coronavirus Spike Protein in Receptor Binding and Extended Host Range
J. Virol.,
November 15, 2006;
80(22):
10909 - 10918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. C. Hwang, Y. Lin, E. Santelli, J. Sui, L. Jaroszewski, B. Stec, M. Farzan, W. A. Marasco, and R. C. Liddington
Structural Basis of Neutralization by a Human Anti-severe Acute Respiratory Syndrome Spike Protein Antibody, 80R
J. Biol. Chem.,
November 10, 2006;
281(45):
34610 - 34616.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. W. Neuman, B. D. Adair, C. Yoshioka, J. D. Quispe, G. Orca, P. Kuhn, R. A. Milligan, M. Yeager, and M. J. Buchmeier
Supramolecular architecture of severe acute respiratory syndrome coronavirus revealed by electron cryomicroscopy.
J. Virol.,
August 1, 2006;
80(16):
7918 - 7928.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. C. Chu, L. J. McElroy, V. Chu, B. E. Bauman, and G. R. Whittaker
The Avian Coronavirus Infectious Bronchitis Virus Undergoes Direct Low-pH-Dependent Fusion Activation during Entry into Host Cells.
J. Virol.,
April 1, 2006;
80(7):
3180 - 3188.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. M. de Haan, Z. Li, E. te Lintelo, B. J. Bosch, B. J. Haijema, and P. J. M. Rottier
Murine Coronavirus with an Extended Host Range Uses Heparan Sulfate as an Entry Receptor
J. Virol.,
November 15, 2005;
79(22):
14451 - 14456.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. H. Schickli, L. B. Thackray, S. G. Sawicki, and K. V. Holmes
The N-Terminal Region of the Murine Coronavirus Spike Glycoprotein Is Associated with the Extended Host Range of Viruses from Persistently Infected Murine Cells
J. Virol.,
September 1, 2004;
78(17):
9073 - 9083.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Bosch, C. A. M. de Haan, and P. J. M. Rottier
Coronavirus Spike Glycoprotein, Extended at the Carboxy Terminus with Green Fluorescent Protein, Is Assembly Competent
J. Virol.,
July 15, 2004;
78(14):
7369 - 7378.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Bosch, B. E. E. Martina, R. van der Zee, J. Lepault, B. J. Haijema, C. Versluis, A. J. R. Heck, R. de Groot, A. D. M. E. Osterhaus, and P. J. M. Rottier
Severe acute respiratory syndrome coronavirus (SARS-CoV) infection inhibition using spike protein heptad repeat-derived peptides
PNAS,
June 1, 2004;
101(22):
8455 - 8460.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. B. Thorp and T. M. Gallagher
Requirements for CEACAMs and Cholesterol during Murine Coronavirus Cell Entry
J. Virol.,
March 15, 2004;
78(6):
2682 - 2692.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. S. Miura, K. Nakagaki, and F. Taguchi
N-Terminal Domain of the Murine Coronavirus Receptor CEACAM1 Is Responsible for Fusogenic Activation and Conformational Changes of the Spike Protein
J. Virol.,
January 1, 2004;
78(1):
216 - 223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Bosch, R. van der Zee, C. A. M. de Haan, and P. J. M. Rottier
The Coronavirus Spike Protein Is a Class I Virus Fusion Protein: Structural and Functional Characterization of the Fusion Core Complex
J. Virol.,
August 15, 2003;
77(16):
8801 - 8811.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. Breslin, I. Mork, M. K. Smith, L. K. Vogel, E. M. Hemmila, A. Bonavia, P. J. Talbot, H. Sjostrom, O. Noren, and K. V. Holmes
Human Coronavirus 229E: Receptor Binding Domain and Neutralization by Soluble Receptor at 37{degrees}C
J. Virol.,
April 1, 2003;
77(7):
4435 - 4438.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Zelus, J. H. Schickli, D. M. Blau, S. R. Weiss, and K. V. Holmes
Conformational Changes in the Spike Glycoprotein of Murine Coronavirus Are Induced at 37{degrees}C either by Soluble Murine CEACAM1 Receptors or by pH 8
J. Virol.,
December 20, 2002;
77(2):
830 - 840.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Matsuyama and F. Taguchi
Receptor-Induced Conformational Changes of Murine Coronavirus Spike Protein
J. Virol.,
October 25, 2002;
76(23):
11819 - 11826.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|