 |
INTRODUCTION |
Phosphatidylinositol-specific phospholipase C
(PI-PLC)1 catalyzes the
hydrolysis of PI in two steps: (i) an intramolecular phosphotransferase
reaction to form inositol 1,2-cyclic-phosphate (cIP), followed by (ii)
a cyclic phosphodiesterase activity that converts cIP to inositol
1-phosphate (I1P). Although the enzymes in eukaryotes play key
roles in generating membrane-associated second messengers and in some
case water-soluble second messengers (1, 2), PI-PLC enzymes in bacteria
are secreted and play critical roles in cell infectivity (3, 4). The
PI-PLC from Bacillus thuringiensis exhibits several types of
kinetic interfacial activation by interfaces. Micellar PI is a better
substrate than monomeric PI (5, 6), and interfaces of
phosphatidylcholine, a nonsubstrate that does not bind at the active
site, activate the enzyme for both PI cleavage (7) and cIP hydrolysis
(8). In the available crystal structure (9) of the closely related Bacillus cereus PI-PLC, bound myo-inositol
localized the active site inside the 
barrel. However, the
orientation of PI substrate side chains and any other sites for
interfacial PC were not defined.
The rim of the active site of bacterial PI-PLC (9) has a short helix B
and one particular loop (residues 237-243) that show an unusual
clustering of hydrophobic amino acids that are fully exposed to solvent
(Fig. 1). This structural characteristic could contribute to the
binding of substrate fatty acyl chains (for PI) but also to the binding
of the PC activator. Tryptophan residues are often elements inserted
into bilayers when a peripheral protein binds (e.g. annexin
V (10) or phospholipase A2 (11)). Two of the seven
tryptophans (Trp-47 and Trp-242) in PI-PLC are among the exposed
hydrophobic amino acids. Their structural orientation is consistent
with previous spectroscopic data (12, 13), which showed enzyme
intrinsic fluorescence increases significantly upon binding to micelles
or vesicles. However, the details of any conformational changes in the
proteins induced by activating surfaces have not yet been investigated.
A definition for where activator molecules versus substrate
acyl chains bind is needed to understand how the kinetic activation occurs.
If helix B and loop 237-243 at the opening of active site are involved
in lipid activation of the protein, mutations of the tryptophans in
each element should affect PI-PLC intrinsic fluorescence and may alter
the kinetic activation by PC surfaces. To test this hypothesis, we
prepared the following mutant PI-PLCs: W47A, W242A, the double mutant
W47A/W242A, W47F, W47I, W242F, and W242I. These were characterized for
kinetic activation of PI and cIP hydrolysis by diC7PC and
organic solvent, ability to bind to PC interfaces (comparing both
intrinsic fluorescence and a filtration assays), and any changes in
secondary structure (analyzed by CD spectroscopy). As controls, two
other tryptophans were mutated: W178A and W280A. Trp-178 fulfills a
dual function in PI-PLC by separating the bottom of the active site
from the core of the protein and by forming a hydrogen bond with the
side chain of Asp-198, a residue shown to be critical for substrate
binding. The conservative replacement of Trp-178 by tyrosine eliminates
the hydrogen bonding potential between position Trp-178 and Asp-198 and
has been shown to decrease the rate of PI hydrolysis (14). W178A was
prepared to see how this change affects enzyme fluorescence as well as
kinetic activation by interfaces. Trp-280 is located in the C-terminal
loop that connects with the eighth strand and helix of the
-barrel; it is far away from the hypothesized activator binding
and the active sites. Modification of this residue should play little
role in substrate and activator binding.
Analyses of these mutant PI-PLCs show that the two tryptophan residues
Trp-47 and Trp-242 are critical for the enzyme to bind to zwitterionic
activating interfaces. Trp-242 is also the major fluorophore responding
to micelle binding.
| |
MATERIALS AND METHODS |
Chemicals--
POPC, diC6PC, diC7PC, and
PI were purchased from Avanti; crude PI for preparing cIP was purchased
from Sigma Chemical Co. diC6PA was prepared from the
corresponding short-chain PCs using Streptomyces
chromofuscus phospholipase D (13). cIP was prepared from PI
as described previously (8). myo-Inositol was purchased from Sigma.
Overexpression of Bacterial PI-PLC and Construction of
Mutants--
A plasmid containing the B. thuringiensis
PI-PLC gene obtained from Dr. Ming-Daw Tsai (Ohio State University) was
transformed into Escherichia coli BL21 cells
(BL21-Codonplus(DE3)-RIL from Stratagene). Overexpression of the
recombinant protein was induced by addition of
isopropyl-1-thio--D-galactopyranoside (0.8 mM) to the E. coli grown at 37 °C to
an A600 ~ 0.7 in LB medium, pH 7.0, containing ampicillin and chloramphenicol. Continued incubation until
A600 reached 1.2 (2-3 h) yielded a reasonable
amount of PI-PLC protein in the cytoplasm. After centrifugation, the
cell pellet was lysed by sonication, and the solution was centrifuged again. The supernatant was subjected to two chromatographic steps, a
Q-Sepharose fast flow column followed by a phenyl-Sepharose column, to
purify the PI-PLC. Millipore Centraplus 10 filters were used to
concentrate the protein.
All of the mutations of the PI-PLC gene were carried out by QuikChange
methodology (15, 16) using a site-directed mutagenesis kit from
Stratagene. Two complimentary mutagenic primers (all purchased from
Operon) containing the desired mutation (codon indicated in bold) were
annealed to the same sequence on opposite strands of the
plasmid. The 33 base mutagenic primers
CCGATTAAGCAAGTGGCGGGAATGACGCAAG, CCGATTAAGCAAGTGATCGGAATGACGCAAG, and
CCGATTAAGCAAGTGTTCGGAATGACGCAAG were used for W47A, W47I,
and W47F; for W242A, W242I, and W242F, the mutagenic primers were
CTTCTGGTGGTACAGCAGCGAATAGTCCATATTAC, CTTCTGGTGGTACAGCAATCAATAGTCCATATTAC, and
CTTCTGGTGGTACAGCATTCAATAGTCCATATTAC. Construction of the
double mutant W47A/W242A introduced a second mutation (W242A) into the
W47A gene using the appropriate primer. The primers
GGATATAATAATTTTTATGCGCCAGATAATGAGACG and
CTACATAAATGAAAAGGCGTCACCATTAT TGTATC were used for the
preparation of W178A and W280A, respectively. All primers were purified
by high performance liquid chromatography before mutagenesis.
CD Spectroscopy--
WT and mutant secondary structure and
thermal stability as monitored by the thermal denaturation transition
(Tm) were measured by CD spectroscopy using an
AVIV 202 spectrophotometer. Proteins were dialyzed in 10 mM
borate buffer, pH 8.0. For Tm measurements, protein (0.03~0.04 mg/ml) was incubated in a 1-cm cell, and the wavelength at 222 nm was monitored as the temperature was increased from 25 to 75 °C in 1o steps with an equilibration time
of 1 or 2 min. For comparing secondary structure, wavelength scans
(180-300 nm) were carried out at 25 °C with protein (0.2-0.3
mg/ml) in a 0.1-cm cell. Estimation of secondary structure content was
done with CDNN using ellipticity in the 195- to 300-nm range
(17-19).
Fluorescence Spectroscopy--
PI-PLC intrinsic fluorescence
spectra were obtained with a Shimadzu RF5000U spectrofluorometer.
All fluorescence measurements were carried out at 25 °C with ~2
µM protein in 50 mM HEPES, pH 7.5, with 1 mM EDTA. The excitation wavelength was 290 nm, with both
excitation and emission slit widths set at 5 nm. The wavelength for the
maximum in PI-PLC fluorescence was the same, 337 nm, for WT and all the
tryptophan mutants. Changes in the fluorescence intensity were
expressed as (I 
I0)/I0, where
I0 is the intensity of protein alone, and
I is the intensity in the presence of an additive.
Kinetic Analysis of PI-PLC Mutants--
PI-PLC activity was
assayed by two methods. (i) For long-chain PI as substrate, 200-µl
aliquots were removed from the reaction mixture at defined intervals
and extracted with 300 µl of CHCl3 (this also stops the
reaction). The content of cIP and I1P in the water-soluble phase was
determined by 31P NMR (202.3 MHz) spectroscopy as described
previously (8, 13) using a Varian INOVA spectrometer. (ii) For cIP,
hydrolysis was monitored by 31P NMR spectroscopy by
measuring the decrease of substrate and increase in product (I1P)
resonance intensities as a function of incubation time with the enzyme.
The amount of protein added was adjusted so that no more than 20%
substrate hydrolysis occurred within 2 h. Assays to check for
activation by PC typically used 5 mM cIP in the absence or
presence of 5 mM diC7PC to probe for PC activation.
PC Vesicle Binding Studies--
SDS-PAGE (12% polyacrylamide)
was used to quantify free PI-PLC separated (via
centrifugation/filtration) from PI-PLC bound to POPC vesicles. A
similar method was used to quantify S. chromofuscus phospholipase D partitioning to phospholipid vesicles (20). A stock of
small unilamellar POPC vesicles (5 mM) with an average diameter ~300 Å was prepared by sonication in 10 mM
Tris, pH 7.5. Large unilamellar vesicles were prepared by multiple
passages of an aqueous POPC solution through polycarbonate membranes
(100-nm pore diameter). Samples for binding assays with SUVs were
prepared with 0.03 mg/ml protein in 10 mM Tris, pH 7.5; the
bulk POPC concentration was 0, 0.01, 0.02, 0.05, 0.1, and 0.2 mM for WT PI-PLC, W47I, W242I, W47F and 0, 0.02, 0.04, 0.08, 0.15, and 0.3 mM for W47A and W242A. In the POPC
binding assay with W47A/W242A (and binding of PI-PLC to LUVs), the bulk
POPC concentration was increased to 2 mM. After incubation
for 15 min, the samples were applied to 2-ml Amicon Centricon YM10
filters (100-kDa molecular mass cutoff) and centrifuged at 4000 rpm in a DYNAC centrifuge for ~2 h until all the solution passed
through the filter. The protein bound to vesicles was left on the
membrane of the filter, while free protein passed through the membrane.
The eluant was collected and lyophilized overnight. As a control,
enzyme in the absence of vesicles was centrifuged through the filter,
and less than 5% of the total protein was lost on the filter. Samples
for SDS-PAGE were made by adding 20 µl of water and 15 µl of SDS
loading buffer to the dry solid. Gels were stained with Coomassie Blue.
After destaining, the gels were imaged using EAGLE EYE from Stratagene, and the PI-PLC intensities were monitored. Comparison of band intensities to a sample incubated without POPC vesicles was used to
measure the fraction of free enzyme
(Ef/ET, where
ET is the total amount of enzyme). The
fraction of enzyme bound,
Eb/ET, was then evaluated
as (1 Ef/ET). The
apparent dissociation constant (KD) was calculated
with equation Eb/ET = [POPC]/(KD + [POPC]). With this analysis,
1/KD is the molar partition coefficient for the
protein interacting with POPC surfaces.
| |
RESULTS |
Secondary Structure and Thermal Stability of Wild Type and Mutant
PI-PLCs--
The crystal structure of bacterial PI-PLC enzyme shows a
single distorted ()6-barrel domain with the active
site located at the C-terminal side (as determined by strand
orientation) of the -barrel (Fig. 1).
Replacement of tryptophan residues at the mouth of the barrel is
unlikely to have a dramatic effect on secondary structure as long as
the mutant proteins fold correctly. To check this, CD spectra of WT and
mutant PI-PLC proteins were acquired and used to check for overall
structural elements. WT and mutant thermostabilities were also measured
by monitoring the loss of secondary structure with temperature. As
shown in Table I, estimates of WT
secondary structure calculated from the CD wavelength spectra by
CDNN (17-19) agreed moderately well with the secondary
structure elements in the crystal structure (9). All the tryptophan
mutants except W178A had essentially the same proportion of secondary structure elements. They also had very similar thermal denaturation temperatures (Table I). Thus, any changes in PC binding and kinetics are unlikely to be due to protein that has a significantly altered structure from WT.
View larger version (51K):
[in this window]
[in a new window]
|
Fig. 1.
Model of PI-PLC showing the location of the
seven tryptophan residues in PI-PLC. For reference, Trp-47
and Trp-242 are about 10 Å apart.
|
|
W178A was the least stable mutant (Tm decreased
from 54 °C for the WT to 41.5 °C), and it also showed a
significant drop in -sheet and increase in random coil. The side
chain of Trp-178, at the bottom of active site, is critical for
hydrogen bonding and hydrophobic interactions that stabilize the barrel
and active site. Loss of these interactions would be expected to modify
secondary structure, destabilize PI-PLC, and possibly reduce the mutant enzyme activity. The only other mutant with a significantly reduced stability was W280A. Trp-280 is positioned at a relatively unstructured region near the C terminus of the protein. Given its position, replacement of the aromatic side chain might not be expected to alter
secondary structure elements as reflected in Table I. However, the
stability of this mutant is decreased compared with WT, perhaps suggesting that packing of this tryptophan residue does contribute to
stabilization of the structure.
Replacement of either tryptophan at the barrel rim had minor effects on
the protein stability. The Tm of W47A was within
the error of the Tm for WT PI-PLC. A large
change might not be expected, because Trp-47 is at the middle of helix
B. However, the Tm of W242A was increased to
56.2 °C. Replacement of the bulky side chain of the tryptophan in
the loop at the opening of the barrel slightly stabilized the protein.
This might correlate with a small increase in -helix (at the expense
of random loop structure). It might also reflect a reduced
hydrophobicity of the loop that affects its tertiary structure and
dynamics; it is this change that leads to a small stabilization of the protein.
Effect of diC6PC and diC7PC on the
Intrinsic Fluorescence of Mutant PI-PLC Enzymes--
PI-PLC has seven
tryptophan residues that contribute to its fluorescence emission
spectrum. Previous studies have shown that the binding of PC activator
micelles (12, 21) or vesicles (6, 12) causes an increase in PI-PLC
intrinsic fluorescence intensity, whereas molecules that bind to the
active site (PA, PME, PG) cause a decrease in fluorescence (12,
13). Mutants where a specific tryptophan has been replaced by alanine
should lose some or all of this sensitivity if, indeed, that particular tryptophan were responsible for much of the spectral change upon interfacial binding. W47A, W242A, W178A, W280A, and W47A/W280A were
examined as a function of added diC6PC and
diC7PC and compared with WT PI-PLC. The emission maximum,
337 nm, was the same for all unliganded proteins and unshifted by the
addition of PC micelles (up to 35 mM diC6PC or
4.0 mM diC7PC). As shown in Fig.
2A, the change in fluorescence
intensity of WT at 337 nm showed a small increase below the
diC6PC CMC (14 mM), then increased dramatically once micelles were formed and bound to the WT protein. Three of the
tryptophan mutants, W47A, W178A, and W280A, exhibited similar behavior
(Fig. 2). However, W242A showed significantly reduced sensitivity to
diC6PC micelle binding. The fluorescence intensity still
increased slightly with micelle formation but the enhancement of
fluorescence was roughly one-third that of WT. The double mutant, missing the tryptophan in helix B and the 237-243 loop, showed no
change in intrinsic fluorescence upon micelle binding (Fig. 2B).
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
Fluorescence intensities of B. thuringiensis PI-PLC proteins at 337 nm as a function of
added diC6PC. A, WT ( ), W47A ( ), and
W242A  ); B, W47A/W242A ( ), W178A ( ), and W280A
( ). The arrow indicates the CMC of pure
diC6PC.
|
|
The effect of diC7PC micelles on PI-PLC intrinsic
fluorescence was similar to that for diC6PC (increase in
fluorescence around the diC7PC CMC of 1.5 mM)
with the exception that now W47A as well as W242A also showed a
significantly lower fractional increase in fluorescence (Fig.
3). However, the fractional increase in fluorescence upon micelle binding was still the least for W242A. Again,
the double mutant displayed no sensitivity to PC micelle binding.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
Fluorescence intensities of B. thuringiensis PI-PLC proteins at 337 nm as a function of
added diC7PC. A, WT (), W47A (), and
W242A (); B, W47A/W242A (), W178A (), and W280A (). The
arrow indicates the CMC of pure diC7PC.
|
|
Effect of diC6PA and myo-Inositol on the Intrinsic
Fluorescence of Mutant PI-PLC Enzymes--
Micellar diC6PA
inhibits PI-PLC hydrolysis of cIP whereas monomeric diC6PA
can partially activate the enzyme (13). Binding of monomeric
diC6PA caused a decrease in WT PI-PLC fluorescence that
correlates with binding of this molecule to the active site; as PA
micelles formed, the intrinsic fluorescence increased. As shown in Fig.
4, low concentrations of
diC6PA decreased PI-PLC fluorescence for all the PI-PLC
mutants indicating active site binding of this molecule is not
abolished by the tryptophan substitutions. The decrease in fluorescence
was the least for W242A and the double mutant. Upon micelle formation
of diC6PA (the CMC depends on the ionic strength and pH of
the medium and is likely to be 5-7 mM under these buffer
conditions (22)), all proteins except W242A and the double mutant
showed large increases in fluorescence consistent with micelle binding
as well as active site binding of the PA molecule. This could suggest
that Trp-242 not only senses micelle binding but contributes to the
decrease in fluorescence as lipids bind to the active site.
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Fluorescence intensities of B. thuringiensis PI-PLC proteins at 337 nm as a function of
added diC6PA. WT (), W47A (), W242A (),
W47A/W242A (), W178A (), and W280A ().
|
|
myo-Inositol is a poor competitive inhibitor of PI-PLC (23).
Because it is not amphiphilic it has no tendency to form interfaces. Like other molecules that bind to the PI-PLC active site,
myo-inositol caused a decrease in the fluorescence intensity
of WT PI-PLC (Fig. 5). Tryptophan mutants
that required more myo-inositol added to exhibit a decreased
fluorescence also exhibited a reduced sensitivity to short-chain PC
micelles. That the fractional decrease in fluorescence for W47A, W242A,
and the double mutant was less than that observed with WT PI-PLC, might
suggest that the interfacial site is coupled to substrate binding.
Interestingly, the double mutant showed a more pronounced decrease in
fluorescence with increasing myo-inositol than both W47A and
W242A. If the decreased fluorescence is correlated with binding, this
would indicate that removal of both tryptophan residues may actually
enhance the binding of small water-soluble inositol compounds at the
active site. However, the altered changes in fluorescence with
myo-inositol could also reflect changes in the disposition
of the fluorophores or removal of ones that are the major reporters of
this small molecule binding to the active site.
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
Fluorescence intensities of B. thuringiensis PI-PLC proteins at 337 nm as a function of
added myo-inositol. WT (), W47A (), W242A
(), W47A/W242A (), W178A (), and W280A ().
|
|
Catalytic Properties of Alanine-substituted PI-PLCs: Effect of PC
on cIP and PI Cleavage--
To investigate the role, if any, of the
different tryptophans in the interfacial activation of PI-PLC, cIP
hydrolysis (phosphodiesterase) and PI cleavage (phosphotransferase)
were examined for WT and mutant proteins with and without PC activator
(diC7PC). As summarized in Table
II, removing either Trp-47 or Trp-242,
which reside at the rim of the barrel, reduced the PI-PLC specific
activity toward cIP to 60 and 82% of WT, respectively. Both single
mutants exhibited kinetic activation by micellar diC7PC (5 mM), but not to the same extent as WT (Table II). That the
reduction in the extent of PC activation is real was provided by
measuring diC7PC activation of W280A, which was essentially
the same as WT. Trp-280 is near the C-terminal end of the protein and
far away from the active site and interfacial activation site (if it is
near the mouth of the barrel). In the absence of an interface, the
specific activity of the double mutant, where both Trp-47 and Trp-242
have been removed, toward cIP was 53% that of the WT. However, instead
of the 6- to 9-fold increase observed with diC7PC added,
this mutant showed only a 1.5-fold increase. The lack of kinetic
activation of W47A/W242A by PC micelles suggests that the two
tryptophan residues are key players in the interfacial binding site of
the enzyme. Interaction of these bulky side chains with the
phospholipid surface may be key to anchoring the protein to a surface.
Furthermore, the lack of significant PC activation for W47A/W242A
explains the lack of change in the intrinsic fluorescence when
diC7PC was titrated into the double mutant. There was no
fluorescence change, because the micelle binding site was
perturbed.
Of all the tryptophan mutants, the one with the most altered specific
activity toward cIP was W178A. Trp-178 is at the bottom of the active
site where its side chain forms a hydrogen bond with the side chain of
Asp-198, a residue shown to be critical for substrate binding.
Replacement of Trp-178 with alanine would significantly alter the
disposition of Asp-198, and this in turn could reduce the ability of
the mutant to bind substrates. The specific activity of W178A toward
cIP is 6% of WT; with PI solubilized in Triton X-100, the activity is
9.5% that of WT. A previous mutation of this residue to tyrosine
showed a similarly reduced activity toward substrates. Although it is a
less efficient enzyme, W178A can still be activated by
diC7PC (Table II). The ratio of specific activity of W178A
with and without activator is essentially the same as WT PI-PLC for
both cIP hydrolysis and PI cleavage. Thus, of the four tryptophans
examined, only Trp-47 and Trp-242 appear to have roles in activator binding.
Although myo-inositol is a poor competitive inhibitor of
PI-PLC, the effectiveness of it as an inhibitor can be used to monitor how mutants bind this portion of the substrate. With 5 mM
cIP as substrate and no activating diC7PC, 75 mM myo-inositol reduced the WT PI-PLC specific
activity 25-fold. As shown in Table II, myo-inositol
inhibited all the mutant proteins to about the same extent. The
observation that the effect of myo-inositol on W47A and
W242A specific activity toward cIP was similar indicated that the
removal of Trp-47 or Trp-242 just changed the interfacial binding
character, not the active site inositol binding region.
An alternate means of activating PI-PLC is to have moderate percentages
of water-miscible organic solvents present (24). It has been proposed
that a co-solvent (e.g. 30% iPrOH) activates PI-PLC
by changing the local polarity of the active site. 30% iPrOH
activated WT and all the mutants examined (W47A, W242A, and W47A/W242A)
for hydrolysis of cIP. The extent of iPrOH activation (comparing
the specific activity with 30% iPrOH to cIP hydrolysis by that
mutant in its absence) was ~4.5 for the single mutants versus 5.5 for WT. However, removal of both Trp-47 and
Trp-242 generated PI-PLC that could only be activated 2.6-fold by that organic solvent (Table II).
Similar phenomena were observed comparing cleavage of 8 mM
PI in 16 mM TX-100 or 32 mM diC7PC
matrices. PI dispersed in diC7PC micelles is a better
substrate than in TX-100 micelles (7). Interpretation of the kinetics
is more complex, because both the activating phospholipid and the
substrate have acyl chains. However, one gets a sense of whether
tryptophan removal affects PI cleavage as well as PC activation of the
first step of PI-PLC action. As shown in Fig.
6, removal of either rim
tryptophan led to a 3-fold decrease in PI-PLC specific activity toward
PI in both detergent matrices. Even though these mutants could be
activated for cIP hydrolysis, cleavage of PI to cIP was reduced to the
extent that activated rates for cIP hydrolysis and PI cleavage were
closer. Removal of both tryptophans led to enzyme that had further
reduced activity toward PI and was not activated by 30% iPrOH.
In fact, the activity for PI dispersed in 30% iPrOH was
considerably lower than PI in TX-100 suggesting that iPrOH was
inhibitory for the double mutant. Therefore, the two rim tryptophan
residues are critical for optimal PI cleavage as well as cIP
hydrolysis. This is consistent with the following scenario. The
inositol headgroup of PI binds at the active site, while the acyl
chains are oriented with hydrophobic side chains of the rim to enhance
the PI binding with protein.
View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
Specific activities of WT, W47A, W242A,
W47A/W242A, and W178A toward cIP (5 mM) in the absence
() and presence () of 5 mM diC7PC, and
toward PI (8 mM) dispersed in 16 mM TX-100
(diagonal lines), 32 mM diC7PC
(gray), or 30% iPrOH (vertical
lines).
|
|
Phenylalanine and Isoleucine Substitutions at Trp-47 and
Trp-242--
Replacement of the bulky tryptophan side chain with a
methyl group is a rather drastic change. It is possible that the roles of these residues in interfacial activation and amphiphilic substrate binding are not specific for tryptophan but just require a hydrophobic side chain. Isoleucine and phenylalanine residues are hydrophobic and
much bigger than alanine. When compared with tryptophan using the
Wimley-White hydrophobicity scale (25), phenylalanine is closer to
tryptophan in partitioning whereas isoleucine is significantly less
hydrophobic. Construction of W47I, W47F, W242I, and W242F was carried
out, and fluorescence and kinetic analyses were done to address this
point. The specific activities of W47I, W47F, W242I, and W242F toward
PI dispersed in diC7PC were comparable to WT enzyme (Table
III), although W57I was about 25% lower
and the two Trp-242 mutants were 25% higher. With the alanine
substitutions, PI specific activity was decreased substantially when
the rim tryptophans were removed. Comparable PI cleavage is consistent with intact structural features for interfacial activation. That both
isoleucine and phenylalanine mutants behave like WT is consistent with
relatively nonspecific hydrophobic interactions contributing to
interfacial activation.
Because these mutants exhibit PI specific activity comparable to WT,
they can be used as a better assessment of the role of each tryptophan
in contributing to the intrinsic fluorescence response to micelle
binding. As shown in Fig. 7A,
W47I and W47F intrinsic fluorescence show a dependence on
diC6PC concentration similar in shape to WT but with about
half the fluorescence increase; W242F and, in particular, W242I have
greatly reduced changes upon diC6PC micelle binding. The
same trends are observed when the enzymes were titrated with
diC7PC micelles. With the larger diC7PC micelles, there were essentially no significant increases in the intrinsic fluorescence of W242I and W242F.
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7.
Fluorescence intensities of W47I (), W47F
(), W242I (), W242F (), and WT (×) as a function of added
(A) diC6PC and (B)
diC7PC.
|
|
Binding of Mutant PI-PLC to PC Vesicles--
The loss of
diC7PC activation by the W47A/W242A double mutant strongly
suggests that removal of both tryptophan residues altered the affinity
of this mutant for activating surfaces. This possibility was
investigated by measuring the partitioning of WT and mutant PI-PLC
enzymes to PC SUVs using a centrifugation/filtration assay. SUVs were
initially used because WT PI-PLC showed much higher activity toward
small versus large vesicles (7, 21). A typical gel showing
the loss of free W47F PI-PLC as the bulk concentration of PC increased
is shown in Fig. 8A. The
variation in the amount of PI-PLC partitioned to PC SUVs was fit with a
hyperbolic curve to generate an apparent dissociation constant,
KD (Table IV). This is
not a true dissociation constant but an apparent KD
that provides a way of comparing affinities of the different PI-PLCs
for PC surfaces.
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
Dependence of W47F PI-PLC partitioning on
POPC SUVs as a function of bulk PC concentration. A,
SDS-PAGE of free W47F as a function of added POPC vesicles (bulk PC
concentration is indicated beneath each lane); B,
dependence of the fraction of W47F bound
(Eb/ET) to vesicles on
total POPC concentration. The line indicates a hyperbolic
with an apparent KD = 84 ± 11 µM.
|
|
The apparent KD of WT PI-PLC for PC SUVs was 88 µM. For comparison, binding of PI-PLC to PC LUVs was
considerably weaker (apparent KD > 1 mM). Therefore, the effect of removing individual
tryptophan residues on binding to PC vesicles was measured with SUVs.
Apparent KD values extrapolated for W47A (3.2 mM) and W242A (8.6 mM) were much higher than
for WT protein. The apparent KD values of W47I and
W242I for PC SUVs were higher than WT, but both were lower than the alanine mutants. W47F (binding data shown in Fig. 7B) had an
apparent KD comparable to the WT protein (86 µM). No significant binding of W47A/W242A to POPC SUVs
could be detected with this assay even when the concentration of PC was
increased to 2 mM. This puts a lower limit on the apparent
KD of the double mutant of >20 mM for
PC surfaces. Both Trp-242 and Trp-47 have a huge role in interfacial
binding of protein. Conversion of these two residues to alanine removes
the interfacial binding of PI-PLC. Replacement of tryptophan with the
aromatic phenylalanine side chain preserved the affinity of the enzyme
for PC surfaces. The binding studies are consistent with the kinetic
results: Hydrophobic interactions of residues Trp-47 and Trp-242
are critical for interfacial activation.
| |
DISCUSSION |
Tryptophan as an Interfacial Residue--
Tryptophan residues
occur in low abundance in soluble proteins, whereas in many integral
membrane proteins they account for a considerably higher fraction of
the amino acids (26). This large hydrophobic side chains have the
largest free energy for partitioning into PC membranes as measured by
the hydrophobicity scale of Wimley and White (25). Examinations of
crystal structures for a number of membrane proteins show that these
bulky side chains tend to cluster between the polar head group region
and the hydrophobic acyl chain region of lipid bilayers (26). It has
been suggested that they may play a role in inserting segments into the
bilayer as well as in stabilizing transmembrane helices (26). For many peripheral proteins, tryptophan residues are also critical for interactions of the protein with the bilayer. In the case of
lipoprotein lipase, a tryptophan cluster in a C-terminal loop
contributes to binding of the lipase to lipid/water interfaces (27).
Similarly, Naja naja atra phospholipase A2 has
two tryptophans (Trp-19 and Trp-61) located in the membrane-water
interface that are important for this phospholipase binding to
phospholipid interfaces (11). These residues appear to penetrate into
the membrane during the interfacial catalysis of PLA2.
However, for PLA2 enzymes, electrostatic interactions as
well as tryptophan insertion are critical for membrane binding and
interfacial activation (28).
Considerably less is known about what drives the interfacial activation
of PI-PLC enzymes. B. thuringiensis PI-PLC has seven tryptophan residues, two of them at the hydrophobic rim of the active
site in helix B and a loop (residues 237-242), another at the bottom
of the active site (Trp-178), two near the C-terminal end of the
protein (Trp-270 and Trp-280) and two close to the N-terminal portion
of the protein (Trp-10 and Trp-13). The two near the mouth of the
-barrel are of particular interest, because they would be near
the path for substrates to enter the active site (Fig. 1). Replacement
of either or both of these tryptophans with alanine (Trp-47, Trp-242,
and W47A/W242A) or both (W47A/W242A) had only modest effects on
activity (at most a 2-fold decrease in specific activity) of PI-PLC
toward its monomeric substrate cIP. However, there was a much more
significant reduction in PC activation for two of these mutations, W47A
and W242A, that was accentuated with the W47A/W242A double mutant. The
loss of PC activation by the double mutant did not correlate with
altered secondary structure of the protein. A plausible explanation is that both aromatic side chains are directly involved in binding to a
phospholipid interface.
Binding studies of the mutants to PC vesicles showed that replacement
of either tryptophan with alanine decreased the affinity of the enzyme
for an activating PC bilayer 37- and 98-fold (W47A and W242A,
respectively). The Wimley-White hydrophobicity scale (25) can be used
to predict changes in membrane partitioning of a series of related
peptides. For a mutant where a single membrane interacting tryptophan
is replaced by alanine (
G = 2.02 kcal/mol), the
ratio of the mutant KD to that of WT would be about 30. Removal of both tryptophans would increase KD
~900-fold. The relative experimental KD values for
Trp-47 and Trp-242 mutants compared with WT show the same trends as
these predictions (Table IV). Interestingly, substitutions at Trp-47
had smaller effects than at Trp-242. There could be several
explanations for this. Trp-47 is in a short helix and has a defined
structure, whereas Trp-242 is in a more flexible loop. The Wimley-White
scale is based on short peptides that have no structure either free in
solution or partitioned to a PC membrane. Differences in mutants at the
two positions could reflect differences for a residue in a helix
versus a less structured loop partitioning into the surface. Alternatively, Trp-47 may not completely partition into the PC surface
while Trp-242 is completely imbedded. The observation that Trp-242
contributes the most to the increase in fluorescence upon PI-PLC
binding to PC surfaces is consistent with this explanation. Yet a third
possibility is that the rim loop with Trp-242 undergoes a
conformational or dynamical change upon insertion into the PC surface
whose extent depends on the identity of the hydrophobic side chain.
Regardless of the detailed explanation, both helix B and loop
tryptophans play critical roles in B. thuringiensis PI-PLC
binding to PC interfaces.
Differences in binding affinity of the WT and mutant PI-PLC are
reflected in catalytic activity of PI-PLC toward cIP. Under normal
assay conditions micellar diC7PC is used as the activator, and the partitioning of the enzyme for this interface may be
characterized by slightly different apparent KD
values. However, PC micelle binding trends should be similar to those
exhibited with PC SUVs. With 5 mM diC7PC there
should still be sufficient PC binding for a good deal of the kinetic
activation but not as much as WT, which is indeed what is observed. The
double mutant showed no partitioning to PC vesicles and only a very
small increase in specific activity toward cIP when an activating
interface was present. Thus, the binding of PI-PLC to an activating PC
interface is mainly controlled by both Trp-47 and Trp-242 residues.
However, the specificity for tryptophan at those positions is not
absolute. Other hydrophobic groups (Ile or Phe) can substitute
for tryptophan at these positions with the aromatic side chain
generating protein whose activity is essentially equivalent to WT.
Tryptophans and Interfacial Binding in cIP and PI
Cleavage--
Both Trp-47 and Trp-242 clearly have roles in PC
activation of PI-PLC hydrolysis of water-soluble cIP. Because they also
affect PI cleavage to cIP, they are important for orienting the enzyme at any interface, either activating interfaces such as PC or a substrate interface (PI). Removal of both rim tryptophans produces an
enzyme that is less sensitive to both activating and substrate interfaces. Curiously, the double mutant cleavage of PI was inhibited by 30% iPrOH. Under conditions where all the single mutants
showed substantial activity toward PI in this cosolvent, the double
mutant was inhibited by iPrOH. This is different from what was
observed for cIP, where iPrOH enhanced hydrolysis by W47A/W242A
2.5-fold compared with the 4.5-fold for the single mutants (Table II). The observed inhibition could reflect dramatically altered
thermostability in the presence of iPrOH, although the
Tm for the double mutant was the same as that of
WT. Reduced sensitivity to iPrOH paralleling reduced PC
activation might suggest that, when the cosolvent changes the local
polarity of the active site and rim, there is a change in the
orientation of one or both tryptophans that is critical for optimal
substrate binding and processing.
Intrinsic Fluorescence of PI-PLC: Do Trp-47 or Trp-242 Penetrate
Interfaces?--
The insertion of tryptophan residues into interfacial
regions of membranes can often be detected by changes in the
fluorescence. For example, E. coli -hemolysin reversibly
adsorbs to bilayers then inserts into the bilayer to form a tightly
associated complex. Insertion not the reversible adsorption is
accompanied by an increase in protein intrinsic fluorescence (29).
Furthermore, chemical modification of any of the solvent-exposed
tryptophans abolishes lytic activity of the -hemolysin (29). A
number of other toxins show tryptophan insertion into membranes as key
steps in their action (e.g. diphtheria toxin (30) and
perfringolysin O (31)).
PI-PLC has seven tryptophan residues that dominate its fluorescence
emission at 337 nm. Removal of Trp-242 generated PI-PLC that was the
least sensitive to the presence of PC micelles, both diC6PC
and diC7PC, suggesting that in WT this residue is
responsible for most of the increase in fluorescence upon micelle
binding. Removal of Trp-47 also generated enzyme that had a somewhat
reduced sensitivity to binding to diC6PC interfaces (small
changes for W47A and more substantial for W47F and W47I). All of these
tryptophan single mutants exhibited further reduced fluorescence upon
binding to diC7PC compared with diC6PC
micelles. diC6PC micelles are small and nearly spherical
(32), whereas diC7PC forms much larger rod-like micelles
(33). The different sensitivity of Trp-242 and Trp-47 to PC interfaces
may arise from different orientation of the residues on the membrane
surface. It is possible that the side chain of Trp-47 is disposed in a
more water-accessible region of the bilayer, while Trp-242 penetrates
further into the lipid layer (possibly because of the flexibility of
loop region). Such a difference in orientation could be envisioned with
a small highly curved micelle oriented in a somewhat asymmetrical
fashion at the barrel rim. The larger diC7PC micelles would
then provide a slightly altered environment for Trp-47 that contributes
along with Trp-242 to the increase in fluorescence upon micelle
binding. In either case, binding of W242A to a PC bilayer was
considerably weaker than W47A consistent with a stronger interaction of
Trp-242 with PC surfaces.
Trp-242 also contributes to the protein intrinsic fluorescence changes
when myo-inositol or monomeric PA bind to the protein, because its removal leaves a protein that is much less sensitive to
active site binding as well as activator micelle binding. However, W178A and W47A also exhibited a reduced change in fluorescence upon
inositol binding at the active site. Thus, the fluorescence response to
a molecule binding at the active site has contributions from at least
three of the tryptophans.
Comparison of Tryptophans in B. thuringiensis PI-PLC to Other
PI-PLC Enzymes--
The crystal structure of PI-PLC from
Listeria monocytogenes shows a close topological similarity
to PI-PLC from B. thuringiensis, despite a low level of
sequence homology (~24% sequence identity) (34). The catalytic site
and hydrophobic rim are very similar in both crystal structures. There
is one tryptophan residue near the N terminus of helix B in L. monocytogenes PI-PLC (Trp-47 is located at the C terminus of helix
B in B. thuringiensis PI-PLC) and a phenylalanine residue in
a rim loop that appears to correspond to Trp-242 in B. thuringiensis. Because the B. thuringiensis W242F mutant is active, one might expect the same mode of PC interfacial activation for this bacterial enzyme.
The crystal structures of PI-PLC
1 (35-37) show the active site to
be in a -barrel similar to B. thuringiensis PI-PLC.
The rim of this barrel, like the bacterial enzyme, has a number of hydrophobic residues (Trp, Leu, and Phe). This hydrophobic ridge surrounds one end of the active site opening and is thought to penetrate the membrane during catalysis. With this protein, the PH
domain contributes substantially to membrane binding energy and is
linked with substrate processivity. Nonetheless, replacement of the
hydrophobic moieties in the ridge do affect enzyme activity. For
example, mutagenesis of Trp-555 to alanine decreased the activity from
1080 µmol min
1 mg1 to ~300 µmol
min1 mg1. Perhaps, the simpler bacterial
PI-PLC may provide a model to quantify how changes in membrane binding
(via helix B and the rim loop residues) are linked to catalytic
activity: both phosphotransferase and cyclic phosphodiesterase steps.
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed: Merkert Chemistry
Center, Boston College, 2609 Beacon St., Chestnut Hill, MA 02167. Tel.:
617-552-3616; Fax: 617-552-2705; E-mail: mary.roberts@bc.edu.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
