 |
INTRODUCTION |
Many studies have demonstrated roles for protein kinase A
(PKA)1 in the regulation of
postnatal physiology, but limited knowledge has been gained on the
function of PKA in mammalian development. Earlier studies have
suggested potential requirements for PKA activity in regulating oocyte
maturation in vertebrates (1, 2) and in activating the zygotic genome
in preimplantation mouse embryos (3).
Probably the most striking role of PKA in embryonic development is its
negative regulation of the Hedgehog (Hh) signaling pathway. Lack of PKA
activity leads to ectopic expression of Hh target genes in
Drosophila imaginal discs (4). Manipulation of PKA activity
in vertebrates has also suggested that the negative regulation of the
Sonic hedgehog (Shh) signaling pathway is conserved (5-8). Shh
signaling has been implicated in diverse processes in vertebrate
development including cartilage differentiation, myotome and sclerotome
specification, limb morphogenesis, and the specification of different
neuronal cell types along the dorsoventral axis of the neural tube (9,
10). Whether PKA is involved in all of these processes and how PKA
functions as a negative regulator (directly in the Hedgehog pathway or
in a parallel pathway) are unclear.
There are two catalytic (C
and C
) and four regulatory (RI,
RI, RII, and RII) subunit genes of PKA identified in mice (11). These regulatory and catalytic subunits assemble into a
heterotetramer composed of two C and two R subunits, and this PKA
holoenzyme dissociates to release active C subunit when cAMP binds to
the R subunits. Although each of the regulatory subunit genes encodes a
single protein isoform, the catalytic subunit genes encode multiple
variants. The C gene encodes two variants, C1 and C2, from two
distinct promoters. In adult mice, C1 is expressed ubiquitously,
whereas C2 is testis-specific (12). The C gene produces three
splice variants, C1, C2, and C3. Although C1 is found in
all tissues examined, C2 and C3 are brain-specific (13). The
expression pattern of PKA isoforms have also been examined by in
situ hybridization in mouse embryos at late organogenesis stage,
showing an expression pattern similar to that in adult mice (14).
All studies on the roles of PKA in vertebrate development have utilized
transgenic or pharmacological manipulations, which have limitations in
their ability to mimic the spatial and temporal patterns of endogenous
activity of PKA. One way to solve this problem is to use PKA knockout
mice, and we have created null mutations in each of the four regulatory
and two catalytic subunits of PKA expressed in the mouse. The only
single knockout to show developmental abnormalities is the RI
regulatory subunit null mutation. The RI knockout mouse dies during
embryonic development because of a severe defect in mesoderm formation
resulting from an increase in basal PKA
activity.2
The present study reports developmental consequences of decreased PKA
activity in mice. A PKA-deficient mouse was generated with only one
functional catalytic subunit allele, either C or C, of PKA. The
mutant mice with reduced PKA activity developed localized neural tube
defects (NTDs). The spinal neural tube defect occurred at the thoracic
to sacral regions of the neural tube, was 100% penetrant, and could
lead to spina bifida in newborn mice, whereas exencephaly (open cranial
neural tube) was partially penetrant and only present in mice with a
single C allele remaining. Histological examination of the abnormal
spinal neural tube revealed a closed neural tube with an enlarged lumen
and abnormal neuroepithelium. Marker analysis showed dorsal expansion
of Shh-dependent cell types, resulting in a ventralized
neuronal identity in the affected neural tube. Decreasing PKA activity
also resulted in an increase in apoptotic cell death in the abnormal
neuroepithelium and dorsal root ganglia, suggesting that PKA activity
plays an anti-apoptotic role in the developing neural tube. All of the
defects were observed in the posterior neural tube from the thoracic to
sacral regions, whereas the cervical neural tube appeared normal,
suggesting differential dependence on PKA activity along the
anterior-posterior axis.
| |
MATERIALS AND METHODS |
Animals--
The C and C1 knockout mice were generated as
previously described (15, 16).
C+/
C1+/ heterozygous mice were
maintained on a 129/C57BL6 mixed background. Genotyping of both C
and C alleles was performed on tail DNA by PCR analysis. The wild
type C allele was detected by a pair of primers
(CTGACCTTTGAGTATCTGCAC and GTCCCACACAAGGTCCAAGTA), which amplify a
250-nucleotide fragment of the intron between exons 6 and 7. The C
knockout allele was detected by another pair of primers
(GTGGTTTGTCCAAACTCATCAATGT and AGACTACTGCTCTATCACTGA), which amplify a
270-nucleotide fragment of the region between the 3' end of the
neomycin resistance gene and a portion of the intron just 3' to exon 8. Genotyping of the C wild type allele was performed using the primers
C PCR-1B (CCGTCATCCCTGCTTGCGGA) and C PCR 2 (CTCCACTTCGCTGCCTTTCT), which amplify a 69-nucleotide fragment in the
first exon. The knockout C1 allele was detected using the primers
C PCR-1B and C neo-2 (ATCCTCATCCTGTCTCTTGA), which amplify a
480-nucleotide fragment including the 5' portion of exon 1 and the 5'
end of the neomycin resistance gene. PKA-deficient mice with different
mutant combinations of C and C1 alleles were generated by
intercrossing C+/C1+/ heterozygous
mice. When the vaginal plug was detected in the morning, noon of the
same day was considered as E0.5 for the timing of embryos. All
dissection was performed in M2 medium (Sigma). Genotyping of embryos
was performed by PCR analysis using yolk sac DNA.
Skeleton Preparation from Newborn Pups--
After removing skin
and viscera, carcasses were fixed overnight in 95% ethanol and stained
overnight using 0.015% alcian blue in a solution of 4 parts of 95%
ethanol and 1 part of acetic acid. Samples were put back in 95%
ethanol for 2-5 h and then incubated in 0.5% KOH for 4-5 days.
Skeletons were stained in 0.015% alizarin red, 0.5% KOH and cleared
in 0.5% KOH, 20% glycerol for about 2 days. Skeletons were stored and
photographed in a 1:1 mixture of glycerol and 95% ethanol.
Histology--
Embryos were fixed overnight in Methacarns (6 parts of methanol, 3 parts of chloroform, and 1 part of acetic acid) at
room temperature and embedded in paraffin. Samples were sectioned at 8 µm and stained with hematoxylin and eosin. Sections were viewed under
a Nikon microscope and photographed.
Immunohistochemistry and Whole-mount in Situ
Hybridization--
Embryos were fixed in 4% paraformaldehyde at
4 °C for 2-4 h, washed in phosphate-buffered saline (PBS), and
submerged in 30% sucrose plus PBS overnight at 4 °C. Samples were
embedded in O.C.T. compound (Sakura Finetek) and cryosectioned at 20 µm. Sections were washed with PBS and blocked using 10% goat serum
(Zymed Laboratories Inc., San Francisco, CA) in PBS
with 0.1% Triton X-100. Incubation of primary antibodies was performed
at 4 °C in 1% goat serum plus PBS with 0.1% Triton X-100
overnight. Secondary antibody was fluorescein-conjugated goat IgG
fraction to mouse IgG (ICN, Aurora, OH). Sections were visualized using
a Bio-Rad MRC 600 confocal laser scanning microscope, and images were
captured using COSMOS software. The antibodies used in this study are
described and referenced in the Developmental Studies Hybridoma Bank
data base at the University of Iowa.
Immunohistochemistry for cleaved caspase-3 was performed according to
manufacturer's protocol (Cell Signaling Technology, Beverly, MA). The
secondary antibody was biotinylated anti-rabbit IgG followed by
fluorescein avidin D (Vector Laboratories, Inc., Burlingame, CA). The
sections were visualized using a Leica spectral confocal microscope.
RNA in situ hybridization was carried out as described (17)
using digoxigenin-labeled probe. Immunological detection was performed
using preabsorbed anti-digoxigenin-AP Fab fragments (Roche Molecular
Biochemicals) and colored with BM Purple AP substrate (Roche Molecular Biochemicals).
Western Blots and Protein Kinase Activity Assay--
Wild type
C57/BL6 embryos at E9.5 were used for dissection of the following three
portions of the neural tube: posterior neural tube (thoracic to
sacral), anterior neural tube (cervical/brachial), and cranial neural
tube. The dissection was performed in PBS, and tissues including the
body wall, limb buds, heart, and the brachial arches were removed.
Samples from a total of 65 embryos were pooled together and then
homogenized in buffer (250 mM sucrose, 20 mM
Tris, pH 7.6, 5 mM MgAc, 0.1 mM EDTA, 0.5 mM EGTA, 10 mM dithiothreitol, 1.0% Triton
X-100, 10% deoxycholate sodium salt, 2 µg/ml leupeptin, 3 µg/ml
aprotinin, 0.2 mg/ml soybean trypsin inhibitor, 1 mM
4-(2-aminoethyl) benzenesulfonyl fluoride), sonicated, and centrifuged
for 10 min at 12,000 × g at 4 °C. Supernatants were
collected, and the protein concentration was measured by Bradford
method (Bio-Rad). Forty micrograms of protein were loaded onto
individual lanes of a 10% SDS-PAGE and transferred to a nitrocellulose membrane. The blots were stained with 0.2% Ponceau S before blocking overnight in blocking buffer (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 5% bovine serum albumin, 0.05% Tween 20) and
probed with anti-C or anti-C polyclonal antibodies. The blots
were then incubated with horseradish peroxidase secondary antibody and
visualized using the Amersham ECL system.
Protein homogenates from the dissected neural tubes were assayed for
kinase activity in the presence and absence of cAMP using Kemptide
(Sigma) as a substrate as described (18).
| |
RESULTS |
Reduced PKA Activity Causes Neural Tube Defects Leading to Spina
Bifida--
To investigate PKA function during embryonic development,
we generated a PKA-deficient mouse with only one functional catalytic subunit allele by crossing the C and C1 knockout mice. C and C, the two catalytic subunit genes of PKA, had been previously disrupted using gene targeting in ES cells in mice. The C knockout disrupts exons 6-8 and eliminates expression of both C1 and C2 (15). In these animals, PKA activity was greatly reduced in all tissues
except brain, where there was only a 50% decrease of PKA activity
because of a compensatory increase of C proteins. The C1 knockout
used in these studies is disrupted in exon1 preventing expression of
C1 but allowing synthesis of C2 and C3 in brain (13, 16).
There was no significant change of PKA activity or apparent
compensation of C levels in all tissues examined. Mice with one or
two mutant C subunit alleles, either C or C1, were born with no
apparent embryonic defects (Table I).
However, PKA-deficient mice with three mutant C subunit alleles were
found to have malformations in their spinal columns (Fig.
1A). The spinal column defects
in newborn PKA-deficient pups were located in their thoracic and lumbar
regions. The malformed area was not covered by the vertebral arches,
but only by skin. Skeleton preparation from the mutant newborn pups
revealed that the vertebral arches failed to fuse at the dorsal midline
between forelimbs and hindlimbs, whereas all other components of the
vertebrae were present with regular ossification (Fig. 1, B
and C). The malformation of vertebral arches defines the
mutation in PKA-deficient mice as spina bifida. The spine also showed a
ventral curvature at the defective region. The defective phenotype was
100% penetrant. The mutant pups, when kept with their parents, were
rejected and left out of the litter, and later died probably from
starvation. Moreover, all 22 mutant pups obtained were
C+/C1/ with a single functional
C allele. None of them were found to have two mutant C alleles
and a single functional C allele. Analysis of embryos from timed
mating revealed that the mutant embryos with a single functional C
allele died by embryonic day 14 (E14), indicating a more severe
phenotype.
View larger version (68K):
[in this window]
[in a new window]
|
Fig. 1.
Neural tube defects leading to spina bifida
in PKA-deficient mice. A, newborn PKA-deficient mouse
with spina bifida. The malformation in the spinal column in the
PKA-deficient pup (right) is located at the thoracic and
lumbar regions (arrow). The mouse at left is a
normal littermate control. B and C, dorsal view
of skeleton preparation from newborn mice. Bone is stained
purple, and cartilage is stained blue.
PKA-deficient mouse (C) showing the opening of vertebral
arches between forelimbs and hindlimbs (arrow) compared with wild type
(B). D and E, neural tube defect
(yellow arrows) at the region posterior to the
forelimb buds of PKA-deficient embryos at E10.5 (left in
both D and E). Approximately 25% of embryos with
a single C allele develop both spinal neural tube defects
(yellow arrow) together with exencephaly
(red arrow) (left in E).
Exencephaly is partially penetrant and only seen in embryos with a
single functional C allele. Wild type embryos are on the
right (D and E).
|
|
Embryos were examined from E8.5 to E12.5 to ascertain when the spinal
column defect in PKA-deficient mice occurred during embryogenesis. The
genotypes of embryos were determined by PCR analysis of DNA isolated
from visceral yolk sac. Mutant embryos can be first distinguished from
their wild type littermates at E9.5 by an expansion of the dorsal
neural canal (data not shown). The defect was only observed in the
neural tube posterior to the forelimb buds. The anterior spinal cord
appeared normal. At E10.5, the neural tube defect became more obvious
with varying severity in individual embryos, probably because of embryo
to embryo variations in developmental stage. The most severe phenotype
was observed as a blister-like bulging of the neural tube along the
dorsal midline covering the region of thoracic, lumbar and sacral
neural tube (Fig. 1D). The bulging neural tube appeared to
be covered by epithelial tissue, which was consistent with the
observation of the affected spinal column in the newborn pups. In
addition, some of the C/C1+/
mutants also exhibited exencephaly (open cranial neural tube) (Fig.
1E). As summarized in Table I, all
C+/C1/ embryos had only spinal
neural tube defect, whereas approximately one fourth of
C/C1+/ embryos developed
exencephaly in addition to the spinal neural tube defect. Exencephaly
alone was not observed. As described below, the morphology and the
neuronal patterning in the defective spinal neural tube were
indistinguishable in embryos of either the
C+/C1/ or
C/C1+/ genotype.
Neural Tube Expansion and Dorsal Root Ganglion Regression in
PKA-deficient Embryos--
Histological examination of the developing
neural tube was performed in embryos from E9.5 to E12.5. Transverse
sections through the thoracic to sacral neural tube of mutant embryos
at E9.5 and also some embryos at E10.5 showed a closed neural tube with
an expanded alar plate and enlarged lumen (Fig.
2, A and B). The neural tube at the cervical region appeared normal (data not shown). In
the longitudinal sections through the dorsal half of the neural tube,
the neuroepithelium appeared expanded (Fig. 2, C and
D), indicating a possible overproliferation within the
dorsal neural tube at this developmental stage. A similar phenotype in
the neural tube has been observed in transgenic embryos expressing a
dominant negative form of PKA in dorsal aspects of the mouse central
nervous system (6).
View larger version (133K):
[in this window]
[in a new window]
|
Fig. 2.
Histological examination of neural tube
sections. A and B, transverse sections at
the hindlimb level show the expansion of the neural tube in a
PKA-deficient embryo (B) compared with the wild type
(A) at E10.5. C and D, longitudinal
sections through the dorsal half of the neural tube reveal the apparent
hyperplasia in the PKA-deficient neuroepithelium (D)
compared with the wild type (C) at E10.5. Note the
appearance of DRG (arrows) along the PKA-deficient neural
tube (D). E and F, transverse sections
at the lumbar region of wild type (E) and PKA-deficient
embryos (F) at E12.5. Note the dramatic expansion and the
abnormal neuroepithelium in the PKA-deficient neural tube and the
regression of DRG (F). DRG in wild type is shown in
E (arrow).
|
|
We examined bromodeoxyuridine incorporation in the spinal cord of
mutant embryos to identify cells that have divided. The average number
of labeled cells in sections of the affected neural tube of E9.5 and
E10.5 embryos at hindlimb level was compared with that in corresponding
sections of wild type controls. The result revealed no difference
between the mutants and their controls in the number of proliferating
cells in the whole transverse sections of neural tube (data not shown),
suggesting that the aberrant morphology is not caused by overproliferation.
In embryos older than E10.5, the expansion of the neural canal
increased dramatically. Transverse sections showed that the lumen was
significantly enlarged and the neuroepithelium contained a higher cell
density compared with wild type control (Fig. 2, E and
F). In addition to the change in neural tube morphology, dorsal root ganglia (DRG) were also affected. DRG were formed in the
mutant E10.5 embryos, even though they appeared disorganized (Fig.
2D), but they regressed at E12.5, suggesting that PKA
activity might be required for DRG maintenance. The loss of DRG cells
could indicate a possible abnormal cell death in neural crest cell
derivatives, which might also occur in the neural tube.
To test the possibility of increasing apoptosis in the affected
neuroepithelium and neural crest, immunohistochemistry was performed to
detect activated caspase-3 in the developing neural tube of E10.5
embryos. Caspase-3 is one of the key executioner caspases of cell death
and the activated form of caspase-3 is usually only found in cells
undergoing apoptosis. In the neural tube of PKA-deficient embryos,
apoptotic cells were frequently observed compared with the rare
occurrence of apoptotic cells in wild type embryos (Fig.
3). Most of the apoptotic cells in the mutant were located in dorsal and/or lateral regions of the neural
tube. In addition to the neural tube, a more significant increase in
cell death was also detected in DRG adjacent to the affected neural
tube, but not in DRG at other axial levels of PKA-deficient embryos
(Fig. 3C). Despite the observed increase in apoptosis, the
total number of apoptotic cells observed in the defective
neuroepithelium was still very small and could easily be overcome by
the large number of dividing cells in the neural tube. Therefore, the
increased cell death is unlikely to be a major determinant of the
neuroepithelial abnormality. The more significant increase in DRG cell
death may account for the regression of these structures observed in
mutant embryos.
View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Apoptotic cell death in the neural tube and
DRG of E10.5 embryos. A-C, clusters of apoptotic cells
were frequently observed in the neural tube (yellow
arrow) and DRG (red arrow) in
PKA-deficient embryos. D, in wild type sections, apoptotic
cells were rare, but they could be detected occasionally in the neural
tube (yellow arrow) and in DRG (not in the
section shown here).
|
|
Differential Levels of the Catalytic Subunits of PKA in Axial
Structures--
One interesting phenomenon in our study is that the
neural tube defects were only detected posterior to the forelimb buds of PKA-deficient embryos. What makes the posterior part of the spinal
neural tube more sensitive to the decrease in PKA activity compared
with other regions? One possible reason could be that the expression of
the catalytic subunits of PKA are differentially distributed along the
anterior-posterior regions of the neural tube, causing PKA activity in
some region to be closer to the cellular threshold below which
mutations become apparent. The observed mutant phenotype might suggest
a lower PKA activity at thoracic to sacral regions. To test this, we
dissected the axial structures including the neural tube, paraxial
mesoderm, and the attached ectoderm from E9.5 wild type C57/BL6
embryos. The axial structure was collected in three parts: cranial
neural tube, anterior (cervical/brachial) neural tube, and posterior
(thoracic to sacral) neural tube. Western blots using protein extracts
were analyzed to quantitate the expression of C subunits. The analysis
demonstrated that there was slightly less C subunit expression in the
posterior neural tube compared with the anterior neural tube (Fig.
4A), and this correlated with
a 20% decrease in PKA activity in the posterior compared with anterior
regions (Fig. 4B). Both the results from Western blot and
kinase assay indicate a modest difference in overall expression of
catalytic subunits of PKA, but we believe that this is unlikely to
explain the dramatic differences we see in morphology and gene
expression (see below) in the affected posterior region.
View larger version (33K):
[in this window]
[in a new window]
|
Fig. 4.
Differential levels of catalytic subunits of
PKA along the anterior-posterior neural tube. A,
Western blots showing levels of catalytic subunits in cranial,
anterior, and posterior neural tube of E9.5 wild type embryos.
Anti-C antibody detects both isoforms of C and C. C1and
C1 have similar molecular weights. Anti-C antibody detects C
isoforms only. B, PKA activity in the dissected neural tube.
The basal ( cAMP) and the total activable
(+cAMP) PKA activity are shown after subtracting nonspecific
background.
|
|
The Western analysis also demonstrated that both C and C genes
were expressed as a single protein isoform, C1 and C1, respectively, in the axial tissues of mouse embryos at E9.5. C2, the
testis-specific isoform in adult mice, was not detectable at this
developmental stage, and the brain-specific isoforms, C2 and C3,
were also absent.
Ectopic Expression of Shh Signaling and Altered Neuronal Identity
in the Neural Tube of PKA-deficient Embryos--
The PKA pathway has
been implicated as a negative regulator of Sonic hedgehog signaling in
development, and Shh signaling is a major organizer for dorsal/ventral
patterning in the neural tube. Therefore, we examined the
manifestations of Shh signaling and the specification of neuronal
identity in the neural tube of PKA-deficient embryos at E10.5.
Shh is sufficient for the induction of floor plate cells (19), which
express Hnf3 and Shh itself. In PKA-deficient embryos, the
expression of both Shh and Hnf3 was expanded dorsally (Fig. 5, B and F). Shh
expression was detected in the ventral half of the neural tube at
levels similar to a normal floor plate. The expression domain of
Hnf3 was also greatly expanded in the ventral neural tube, albeit at
levels lower than those found at the ventral midline (Fig.
5F). Cells with lower Hnf3 expression did not display typical floor plate morphology, i.e. a single layer with
basal nuclei. Interestingly, the dorsal expansion of Shh and Hnf3
expression was correlated only with the abnormal morphology in the
affected neural tube. In the cervical neural tube, Shh and Hnf3 were
expressed normally (Fig. 5, C and D; data not
shown). The same localized effect was also observed with the whole
mount in situ hybridization of PKA-deficient embryos at
E9.5, which demonstrated that the ectopic expression of Hnf3 was
localized to the region posterior to the forelimb buds (Fig.
5G).
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 5.
Dorsalized expression of Shh and
Hnf3 in the affected neural tube at the
posterior region of PKA-deficient mice, but not in the anterior neural
tube. A-F, immunohistochemistry on neural tube
sections of E10.5 wild type (A, C, and
E) and PKA-deficient (B, D, and
F) embryos. A and B, expression of Shh
at the lumbar (posterior) region. C and D,
expression of Shh at the cervical (anterior) region. E and
F, expression of Hnf3 at the lumbar (posterior) region.
G, whole-mount in situ hybridization of E9.5
embryos showing the expression of Hnf3. Notice the dorsalized
expression in the PKA-deficient embryo (left) is localized
in the neural tube posterior to the forelimb buds. H, a
drawing of a mouse embryo showing the regions of anterior and
posterior neural tube.
|
|
Shh is required for the induction of motor neurons and adjacent
interneuron progenitors in the ventral neural tube, which is mediated
by regulating the expression of several homeodomain proteins (20-25).
The dorsalized expression of Shh in PKA-deficient embryos may lead to
an altered patterning of neuronal identity in the neural tube. We
analyzed the pattern of ventral neuronal progenitors in the
PKA-deficient neural tube by focusing on the expression of two
homeodomain proteins, Pax6 and Nkx2.2. Shh signaling represses the
expression of Pax6, which, in turn, represses the expression of Nkx2.2
in V3 interneuron progenitor cells at the region dorsolateral to the
floor plate (24, 25) (Fig. 6,
A and C). In the affected neural tube of
PKA-deficient embryos, the expression of Pax6 was repressed in most of
the neural tube, with some dorsal Pax6 expressing cells remaining (Fig.
6B). Consistent with this, expression of Nkx2.2 was dorsally
expanded with the dorsal boundary extending into the medial/dorsal
ventricular zone of the neural tube (Fig. 6D). The
dorsalized expression of Pax6 could be a consequence of ectopic
activation of the Shh response in the affected neural tube. These
results indicate a change of neuronal identity in the affected neural
tube that leads to a ventralized neural tube, which we confirmed by
examining the induction of motor neurons. Motor neuron progenitor
cells, which are located immediately dorsal to V3 interneuron
progenitors, express low levels of Pax6 but not Nkx2.2. The
post-mitotic motor neurons were detected by the expression of the
homeodomain proteins Islet1/2, which mark DRG cells and differentiated
motor neurons (24). In wild type mice, Islet1/2-expressing motor
neurons are located immediately dorsal to V3 interneurons in
ventrolateral regions adjacent to the ventricular zone of the neural
tube (Fig. 6G). In PKA-deficient mice, Islet1/2-labeled
motor neurons were dorsally expanded into the intermediate zone,
consistent with the Nkx2.2 expansion and Pax6 repression (Fig.
6H).
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 6.
Ventralized neuronal identity in the affected
neural tube. Immunohistochemistry on sections of lumbar neural
tube of E10.5 wild type (A, C, E, and
G) and PKA-deficient (B, D,
F, and H) embryos showing the expression domains
of Pax6 (A and B), Nkx2.2 (C and
D), Pax7 (E and F), and Islet1/2
(G and H). Notice the expression of Pax7 in the
somites remains normal in PKA-deficient mice (arrows in
E and F).
|
|
Because of the appearance of ventral neuronal progenitors in the dorsal
neural tube, we next examined the fate of dorsal cell types in the
affected neural tube. Pax7, one of the class I homeodomain proteins
(26), is normally expressed in the dorsal half of the neural tube and
repressed by Shh in the ventral neural tube (Fig. 6E) (23).
The ventral limit of Pax7 expression defines the ventral boundary of
the dorsal neuron progenitors (26). In the affected neural tube of
PKA-deficient embryos, there was no detectable Pax7 expression (Fig.
6F), indicating a significant loss of dorsal cell types.
Consistent with the observed ectopic expression of Shh and Hnf3, the
altered distribution of the neuronal cell types only occurred in the
neural tube posterior to the forelimb buds in PKA-deficient embryos. In
the cervical region of the neural tube, the results of marker analysis
appeared normal (data not shown). These observations indicate that the
spinal neural tube is not a homogeneous structure and suggest
differences in signal transduction systems along the anterior-posterior
axis of the neural tube.
Complete C-deficient Embryos Survive to Gastrulation Stage--
In
our study of PKA-deficient mice, we also produced complete C-deficient
embryos in which all four C alleles were mutated. From the mating
between C+/C1+/ mice, by ratio, 1 of
16 embryos will be completely C-deficient. We examined embryos at
stages E8.5 to E10.5 from timed mating of
C+/C1+/ mice, and discovered 20 complete C-deficient embryos
(C/C1/) from 329 implantations
(1/16). The expected ratio in production of complete C-deficient
embryos indicated that defects in these embryos did not prevent
implantation, although the complete C-deficient embryos were all in
various stages of resorption. It is unlikely that maternal PKA activity
is sufficient to sustain development up to the gastrulation stage.
Either PKA activity is not absolutely required for very early
development or other related kinases are able to partially compensate.
For instance, PrKX, an X chromosome-linked kinase related to catalytic
subunits of PKA, has been shown to interact with RI subunits in a
cAMP-dependent manner (27).
| |
DISCUSSION |
PKA-deficient mice were bred by crossing C and C1
heterozygotes to obtain embryos with only one functional C allele.
Based on previous characterization of the C and C1 null mice, we
might expect some compensatory increase in C expression from the
remaining functional allele, but this is insufficient to maintain PKA
activity. The decreased PKA activity leads to the appearance of axially localized neural tube defects in the thoracic to sacral regions of the
neural tube and may also include exencephaly if both C alleles are
mutated and only a single functional C allele remains. The affected
neural tube in PKA-deficient mice is closed but expanded with an
abnormal neuroepithelium. The vertebral arches fail to fuse in the
malformed region of the spinal cord. Decreasing PKA activity results in
dorsal expansion of Shh signaling and ventralization of the pattern of
neuronal identity in the defective neural tube. An increase in
apoptotic cell death in the abnormal neuroepithelium and dorsal root
ganglia suggests that PKA is also involved in neuronal cell survival
during development.
Neural Tube Defects in PKA-deficient Mice--
NTDs are common
congenital abnormalities in humans with an occurrence of 1 in ~1000
births. The etiology of neural tube defects is multifactorial, and both
genetic and environmental factors are involved. Mouse models have been
used to study the embryonic mechanisms and genetic basis of neural tube
defects (28, 29), and these studies have uncovered a heterogeneous
collection of genes that may be involved.
More than 60 mouse mutants have been reported to exhibit neural tube
defects (29, 30). However, most of them also have syndromes involving
other tissues that cause early embryonic lethality. In these mutants,
NTDs are likely to be secondary to primary defects in other
developmental systems. In a few mutants that survive to later stages of
embryogenesis, mutations are likely to be more specific to neurulation
and cause defects in the neural tube directly. For example,
Splotch (Sp) mice resulting from mutation of the Pax3 gene develop neural tube defects with varying
penetrance during neurulation and die by E13 because of cardiac defects
(31). Targeted disruption of p53 (coding for a tumor
suppressor) (32, 33), MARCKS (a substrate of protein kinase
C) (34), or ApoB (a transporter protein) (35) genes all lead
to exencephaly in 20-30% of embryos. These mutants can survive to
birth and are not severely defective in other developmental systems
except for the neural tube defects.
The PKA-deficient mice examined in this study exhibit neural tube
defects without other apparent malformation, suggesting that PKA can
play a specific role in neural tube formation. In contrast to the low
penetrance of NTDs in other mutants, PKA-deficient mice develop spinal
neural tube defects with 100% penetrance. Some mice that retain one
functional C allele are born alive without other apparent
malformations except spina bifida at their thoracic and lumbar regions.
Mice that retain one functional C allele display a more profound
developmental abnormality that includes exencephaly in ~25% of
embryos as well as the characteristic NTD described above for the mice
with a single C allele.
In many mouse mutations, spina bifida presents as a severe form in
which both vertebral arches and the neural tube fail to close. Other
less severe forms of spina bifida are characterized by normal closure
and development of the neural tube but open vertebral arches (30). In
general, the more severe form is a result of malformation caused
primarily by a neural defect, whereas the other forms of spina bifida
may be caused by mesodermal defects. The anatomy of a closed but
defective neural tube in PKA-deficient mice appears to represent a
novel category. The abnormal neuroepithelium and the altered
differentiation of neuronal precursors in the neural tube indicate that
the primary defect in PKA-deficient embryos is affecting the developing
neuroepithelium. We propose that the dramatic expansion of the closed
neural tube causes failure of the vertebral arches to fuse in
PKA-deficient mice. These special features make the PKA-deficient mice
an interesting model for the study of neural tube defects.
Increased Apoptotic Cell Death in the Affected Neural Tube of
PKA-deficient Mice--
Apoptosis is a highly regulated cellular
process that is essential for embryonic development. The PKA signaling
pathway has been implicated in the regulation of apoptosis by
modulating the levels and/or activities of Bcl-2 and related proteins,
and this may depend on the isoforms of PKA expressed, their subcellular localization, and availability of specific substrates (36). Studies
have suggested that PKA action is at a site upstream of caspase-3 (37,
38). Therefore, we used activated caspase-3 as a marker for apoptotic
cells and observed an increased incidence of cell death in the neural
tube and DRG in PKA-deficient mice. This suggests that PKA activity
serves as an anti-apoptotic signal in the developing neural tube.
Although apoptosis increases in the PKA-deficient neural tube, this is
unlikely to be the primary mechanism leading to the neural tube defect
and is more likely the result of misspecification of neuronal cell
types caused by induction of Shh signaling earlier in development.
Dorsalized Shh Signaling in PKA-deficient Neural Tube--
Shh is
a notochord and floor plate-derived signal required to pattern the
ventral neural tube and induce the formation of motor neurons and
ventral interneurons (21-23, 39). The induction of different cell
types in the ventral neural tube is controlled in a
concentration-dependent manner. Cells positioned in
progressively more ventral regions are exposed to higher Shh
concentrations, and this triggers differentiation into distinct cell
types (21, 24, 25).
Shh signal response can be negatively regulated by PKA. Either too much
or too little PKA activity can result in changes in gene expression and
tissue patterning by modulating the Shh signaling pathway (5-8). In
the developing neural tube, expression of a dominant-negative
regulatory subunit of PKA in dorsal aspects of the central nervous
system activated Shh signaling in the region of the dorsal midbrain and
mid/hindbrain junction. This resulted in the dorsal activation of
Hnf3 and Shh, aberrant motor neuron induction, and ectopic
expression of Patched (Ptc) and Gli1 (6). In our PKA-deficient mice, we
have observed a similar effect resulting in dorsal expansion of
Shh-dependent cell types and ventralization of the neural
tube. This dorsal expansion of Shh-dependent response includes Shh itself, which can be found in a significantly expanded domain. Therefore, we cannot distinguish between a cell autonomous or
nonautonomous mechanism explaining the expansion of the
Shh-dependent cell types. The increased Shh response in
ventral plate cells induces them to adopt a more ventral fate,
including V3 interneurons and motor neurons. Subsequently, cells
positioned in the dorsal neural tube are induced to differentiate into
ventral cell types. Because the expression of the dorsal marker Pax7 is
undetectable, it is likely that the dorsal cell progenitors are never
induced. Despite the marked ventralization of neuronal cell types, the relative position of different gene expression domains remained, suggesting that the mutually repressive interaction between class I and
class II homeoproteins (26) is maintained in the PKA-deficient neural
tube. Moreover, not all of the cells that express Hnf3 in the
ventral neural tube display the floor plate morphology. A possible
explanation is that the floor plate cells are induced early in
development and cells in the ventral neural tube of PKA-deficient mice
are induced to express Hnf3 at later stages, when they are no longer
capable of adopting the floor plate cell fate. This is in contrast to
what has been observed in Patched mutants, in which all
cells expressing Shh and Hnf3 are floor plate cell-like (40).
The dorsalized Shh signaling was only observed in the affected neural
tube at the thoracic to sacral regions. In the head and cervical
regions that showed wild type morphology, the distribution of Shh
signaling and pattern of the neuronal cell types remained normal. The
strong correlation between the dorsalized Shh signaling and the neural
tube defect suggested that the ectopic expression of Shh itself might
be responsible for the neural tube defect. Alternatively, the PKA
deficiency may elicit downstream signaling events that lead to changes
in gene expression in a completely Shh-independent manner. This could
be explored further by producing PKA-deficient embryos on a Shh null background.
Studies have suggested several downstream components in the Shh pathway
as potential targets for PKA phosphorylation. For instance, Smoothened
(Smo) contains a cluster of putative PKA sites in its C-terminal
cytoplasmic domain and PKA could target Smo for degradation by direct
phosphorylation (41). Studies have also shown that Gli2 and Gli3, two
major mediators of Shh signals, can be phosphorylated upon PKA
stimulation (42). Phosphorylation of Gli3 has been shown to promote its
proteolytic processing to generate a repressor form of the
transcription factor (42). A recent study of Shh and
Gli3 double mutants showed that a null mutation in Gli3 can
partially rescue the mutant phenotypes of a Shh knockout embryo (43).
However, it is interesting to note that this rescue of ventral cell
fates was dependent on position along the rostral-caudal axis. Motor
neurons were substantially rescued only in the lumbar region, and the
rescue of V0 and V1 interneurons was also much greater in this region.
Because PKA activity regulates the formation of Gli3 repressor, it
seems likely that PKA deficiency is mimicking the Gli3 knockout by
preventing proteolytic processing to the repressor form. Normally, Gli3
might function as a weak activator of Shh signaling in the ventral
neural tube, and studies have shown that Gli3 is expressed throughout the neural plate (44, 45). It is possible that PKA phosphorylates Gli3,
thus promoting the conversion of Gli3 from a weak activator to a
repressor in the dorsal neural tube, whereas this conversion is blocked
by Shh signaling in the ventral neural tube. Therefore, in
PKA-deficient mice, the level of the repressor form of Gli3 could be
reduced in the dorsal neural tube, resulting in changes in neuronal
specification that mimics Shh signaling. However, reducing the level of
Gli3 repressor alone is unlikely to be sufficient to cause a defect in
the neural tube because mice lacking Gli3 show no ectopic activation of
Shh signaling and no discernible phenotype in the spinal cord (46, 47).
Perhaps, other factors that interact with Shh signaling, such as BMP
and Wnt (48), are also modulated by PKA activity. Although endogenous
processing of Gli2 has not been demonstrated, it has been shown that an
N terminus-deleted form of Gli2, but not full-length Gli2, can induce Shh-dependent cell types in the dorsal neural tube when
ectopically expressed (49). It is possible that PKA deficiency may lead to an increase in Gli2 activator levels.
The increased Shh signal response seen in the PKA-deficient mice is
consistent with previous work in Drosophila, zebrafish, and
mice. However, the localized effect in a discrete region of the neural
tube suggests that PKA-dependent modulation of Shh signaling differs qualitatively along the posterior to anterior axis.
Our dissection of the neural tube does not show significant changes in
the expression of PKA catalytic subunits from posterior to anterior
regions, suggesting that the sensitivity of the thoracic to sacral
region is not the result of differential levels of PKA activity.
Although the large changes in PKA activity produced in PKA-deficient
mice lead to developmental defects, it is likely that smaller changes
in PKA activity are normally regulating neural precursor
differentiation during development. This suggests that as yet unknown
factors may be interacting with receptors to regulate intracellular
cAMP and modulate developmental signals such as Shh.
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed. Tel.: 206-616-4237;
Fax: 206-616-4230; E-mail: mcknight@u.washington.edu.
CiteULike 
Complore 
Connotea 
