 |
INTRODUCTION |
The accurate repair of DNA damage, such as a chromosomal
double-strand break (DSB),1
is essential to prevent chromosomal alterations and the loss of genetic
information. DSBs can be formed by oxygen free radicals, topoisomerase
failure, radiation treatment, and possibly most commonly, DNA
replication. Repair of DSBs in mammalian cells, as in other organisms
(1), occurs by multiple pathways (2, 3). One pathway of DSB repair
involves homologous recombination in which a homologous sequence
templates repair by gene conversion after strand invasion of a broken
end, and thus can be termed homology-directed repair (HDR). The sister
chromatid is by far the preferred template for HDR in mammalian cells
(4). Two other pathways for repair are non-homologous end-joining
(NHEJ), which results in deletions or insertions at a DSB, and
single-stranded annealing (SSA), which involves the annealing of
complementary strands at or near the DSB site. Various components of
DSB repair pathways are known to be essential for cellular viability,
embryonic development, and tumor suppression in mammalian cells (5). Therefore, characterizing the roles of such components in mammalian cells is essential for an understanding of how cells maintain genomic integrity.
Insight into mechanisms of HDR has come in large part from analysis of
genes of the RAD52 epistasis group in Saccharomyces cerevisiae, which includes genes important for meiotic and mitotic recombination and cellular resistance to DNA-damaging agents such as
methylmethane sulfonate (MMS) and x-rays (1), and for which mammalian
homologues have been identified (6, 7). One of these genes,
RAD51 (8, 9), encodes the homologue of the RecA protein
which is pivotal for homologous recombination in Escherichia
coli (10, 11). Like RecA, RAD51 forms helical nucleoprotein
filaments on DNA in an ATP-dependent manner (12-14). These
filaments catalyze DNA strand exchange, an early step in homologous
recombination pathways (15).
Although RecA in E. coli and its counterpart Rad51 in
S. cerevisiae are dispensable for viability of these
organisms, disruption of the RAD51 gene in vertebrate cells
leads to increased numbers of chromosome aberrations in the absence of
DNA-damaging agents, including chromosome breaks, and cellular and
embryonic lethality (16-18). These phenotypes imply that RAD51 plays
an important role in the repair of spontaneously arising DNA damage in
vertebrate cells. As strand breaks can arise during DNA replication,
vertebrate RAD51 may catalyze strand exchange-mediated replication fork
restart, as has been proposed for RecA in E. coli (19, 20).
Besides being essential for cell viability, RAD51 has also been
implicated in the tumor suppression functions of BRCA1 and BRCA2 (21). RAD51 binds directly to regions of the BRCA2 protein and, together with
BRCA1, interacts in nuclear foci. Importantly, cell lines containing
mutations in Brca1 or Brca2 are defective in HDR
(22-25). However, mammalian cell lines carrying defined mutations
within Rad51 have not as yet been examined for recombination phenotypes.
To begin to understand the role of RAD51 in mammalian cells, we sought
to characterize the DNA repair functions of the mammalian RAD51
protein. In this report, we have examined two mutants of human RAD51,
hRAD51-K133A and hRAD51-K133R, that are defective for ATP binding and
ATP hydrolysis, respectively (26). Overexpression of hRAD51-K133R, but
not hRAD51-K133A, has been shown previously (26) to complement a
RAD51 null allele in hyper-recombinagenic chicken DT40
cells, with the only reported phenotype being a decreased frequency of
gene targeting. By using a dominant negative approach, we generated
mouse ES cell lines that express hRAD51-K133R at comparable levels to
endogenous RAD51, whose expression is retained in these cells, although
we have not obtained cell lines that similarly express the hRAD51-K133A
protein. We found that cells expressing hRAD51-K133R exhibit
hypersensitivity both to the cross-linking agent mitomycin C (MMC) and
to ionizing radiation (IR), a decrease in spontaneous sister-chromatid
exchange (SCE), and a defect in HDR of an induced chromosomal DSB.
Moreover, expression of a peptide inhibitor of RAD51 nucleoprotein
filament formation, derived from BRCA2, exacerbates the HDR defect in
this line. These results indicate that ATP hydrolysis by mammalian
RAD51 has a key role during homologous recombination and DNA repair.
| |
EXPERIMENTAL PROCEDURES |
Plasmids and Cell Lines--
Generation of the E14-DRGFP cell
line in which the DR-GFP reporter was targeted to the hprt
locus has been described previously (27, 28). To generate cell lines
expressing hRAD51-WT, hRAD51-K133R, and hRAD51-K133A, cDNAs for
these human RAD51 genes (26) were cut with
BamHI and SalI and cloned into a modified
form of pCAGGS (29), pCAGGS-BSKX-H3/Not, which expresses cDNAs from
a human cytomegalovirus enhancer/chicken 
-actin promoter. The
vector pCAGGS-BSKX-H3/Not contains a polylinker
(BglII-SmaI-KpnI-XhoI) inserted between the XhoI and BglII sites of
pCAGGS, such that the orientation of the BglII and
XhoI sites is reversed, compared with pCAGGS, and a
NotI linker inserted into the HindIII site just
downstream. Expression cassettes were inserted as
SalI/NotI fragments into the Pim1
locus gene-targeting vector p59.N/RV at unique
SalI/NotI sites, which are downstream of the
hygromycin resistance gene coding sequence fused to Pim1
exon 4 (30). The p59.N/RV vector is a version of p59 that has a
NotI linker inserted at the unique SmaI site just
downstream of the SalI site and also contains
EcoRV sites on both ends of the genomic fragment, allowing for linearization of the targeting vector with EcoRV. Each
of these linearized vectors (70 µg) was electroporated into E14-DRGFP cells (5 × 106 ES cells suspended in 650 µl of
phosphate-buffered saline (PBS) in a 0.4-cm cuvette) by pulsing the
cells at 800 V, 3 microfarads. Hygromycin selection was applied 48 h later at 110 µg/ml. After 10 days, surviving colonies were isolated
and analyzed for targeting to Pim1 as described previously
(30).
To construct the BRC3 expression vector, the coding sequence for amino
acids 1415-1483 of BRCA2 was PCR-amplified from a human BRCA2 cDNA using primers flanking this sequence. The PCR
primers generated a stop codon at the 3' end and restriction
endonuclease sites at both ends of the PCR product (EcoRI
and BbsI sites at the 5' end; BglII site at the
3' end). A PCR product for mBRC3 was created the same way, except that
the 5' primer contained the
Phe1428-Lys1434 deletion mutation (31).
PCR products were digested with EcoRI and BglII
and cloned into these sites of the pCAGGS expression vector.
Subsequently, an EcoRI/BbsI fragment encoding a
start methionine followed by three copies of a nuclear localization signal (32) was cloned in-frame, upstream of the BRC repeats. The BRC3 and mBRC3 sequences containing the nuclear localization signal
were verified by the Sloan-Kettering Institute Core Facility.
DR-GFP Assays--
To measure the repair of an
I-SceI-generated DSB, 50 µg of the I-SceI
expression vector pCBASce (33) was mixed with 5 × 106
ES cells suspended in 650 µl of PBS in a 0.4-cm cuvette, followed by
pulsing the cells at 250 V, 950 microfarads. In experiments with the
BRC repeat, 70 µg of the BRC3 or mBRC3 expression vectors were
additionally added. To determine the amount of HDR, the percentage of
cells that were GFP-positive was quantitated by flow cytometric analysis 7 days after electroporation on a Becton Dickinson FACScan, as
described previously (28).
To determine the percentage I-SceI site loss for each
electroporation (27), genomic DNA was isolated 7 days after
transfection. 2 µg of genomic DNA was used as the template for PCR
with primers at 200 nM in a reaction volume of 50 µl. The
primer sequences were DRGFP1 5' AGGGCGGGGTTCGGCTTCTGG and DRGFP2 5'
CCTTCGGGCATGGCGGACTTGA. PCRs were performed using the Roche Molecular
Biochemicals GC-rich PCR System in a PerkinElmer Life Sciences GeneAmp
PCR System 9600. Amplification was for a total of 35 cycles, the first
10 cycles using a 1-min elongation time and the final 25 cycles using a 2-min elongation time. Following amplification, PCR products were purified using an Amersham Biosciences GFX PCR DNA and Gel Band Purification Kit. PCR products were digested with I-SceI for
20 h with 10 units of I-SceI (Roche Molecular
Biochemicals) and separated on a 1.5% agarose gel. The gel was stained
with ethidium bromide, and the ethidium signals for the
I-SceI-resistant and I-SceI-cleaved band were
quantified using a Bio-Rad Chemidoc 2000 system with rolling disc
background subtraction.
Western Blotting--
Cells (5 × 106)
suspended in 100 µl of PBS and mixed with an equal volume of protein
extraction buffer (34) were heated at 100 °C for 10 min and
subsequently spun for 10 min. 5 µl of this protein extract was
separated on two 12% SDS-PAGE gels; one was stained with Coomassie
Blue to confirm equal loading, and the other was transferred to
Polyscreen polyvinylidene difluoride membrane (PerkinElmer Life
Sciences). The membrane was probed with anti-RAD51 IgG goat antibodies
(Santa Cruz Biotechnology) and horseradish peroxidase-conjugated mouse
anti-goat secondary antibodies (Pierce), and immunoblot signals were
detected using ECL reagent (Amersham Biosciences).
Mitomycin C and Ionizing Radiation Survival Assays--
MMC and
IR survival assays were performed as described previously (22, 35). For
MMC treatment, 2 × 105 cells for each line were
exposed to various doses of MMC for 4 h and washed three times
with PBS. Cells were trypsinized, counted, and then plated at various
concentrations for 7-10 days of cell growth. For IR treatment, 2 × 105 cells, in solution, were exposed to various doses of
IR by varying the duration of exposure to a 137Cs source.
Cells were diluted and plated at various concentrations for 7-10 days
of cell growth. For both the MMC and IR experiments, clonogenic
survival was determined for a given concentration of cells that were
plated by dividing the number of colonies on each treated plate by the
number of colonies on each untreated plate.
Sister-Chromatid Exchange Assays--
Subconfluent ES cells
cultured on 100-mm plates were incubated with bromodeoxyuridine (Sigma)
at 10 µM for 48 h. Colcemid (Invitrogen) was then
added at a final concentration of 0.15 µg/ml for 1 h after which
time cells were harvested for metaphase preparation. Slides were aged
for 3 days and stained with 10
4 M 33258 Hoechst (Sigma) for 10 min. After washing in water, slides were mounted
and then placed under a 120-watt Plant Lite (General Electric, Inc.) at
a distance of 10 cm for 2 h. Slides were then washed and stained
in 2% Giemsa (LabChem, Inc.) in Gurr's buffer (Bio/Medical
Specialties, Inc.) for 15 min and then washed again and examined under
an Olympus microscope mounted with a Sony CCD camera. Metaphases that
showed no more than 5 undifferentially stained chromosomes were
selected for counting SCEs. Statistical analysis was performed using
the Student's two-tailed t test.
| |
RESULTS |
Stable Expression of the ATP Hydrolysis-defective hRAD51-K133R
Mutant at Moderate Levels Is Not Lethal to Mouse ES Cells--
To
begin to identify the activities of mammalian RAD51 that are involved
in DNA repair, we attempted to generate cell lines that express mutant
forms of the protein. Considering that mutant RAD51 may not be able to
support cellular viability in the absence of the wild-type protein, we
took a dominant negative approach, expressing mutant forms of the
protein exogenously, while maintaining expression of the endogenous
wild-type protein. In this manner, we could take advantage of homotypic
interactions of RAD51, such that mutant forms of the protein would have
the potential to form mixed nucleoprotein filaments with the endogenous
protein and thereby interfere with the function of the wild-type RAD51
without completely abolishing its activity (36-38). In these
experiments, we attempted to generate mouse cell lines that exogenously
express two mutant forms of human RAD51, which is 99% identical to
mouse RAD51 (9): hRAD51-K133A, which is defective for ATP binding, and
hRAD51-K133R which is competent for ATP binding but is defective for
ATP hydrolysis (26). In parallel, we developed cell lines that
exogenously express hRAD51-WT for comparison.
To generate these cell lines, we gene-targeted the RAD51 expression
cassettes to a specific chromosomal locus in the wild-type mouse ES
cell line E14-DRGFP (parental), which contains a substrate for the
quantification of HDR of a chromosomal DSB (27, 28). To this end, each
RAD51 expression cassette was cloned into a Pim1 genomic
fragment containing a linked promoterless hygromycin gene (Fig.
1A), which allows efficient
selection of gene-targeted clones (30, 33). The RAD51-targeting
vectors, hRAD51-WT, hRAD51-K133R, and hRAD51-K133A, were introduced
into the parental cell line by electroporation, and stably integrated
clones were selected using hygromycin. In these experiments, the
frequency of hygromycin-resistant clones was ~8-fold higher for the
hRAD51-WT vector (2 × 106) than for the
hRAD51-K133R vector (1.5 × 107), whereas no clones
were found with the hRAD51-K133A vector (<1 × 108). The inability to generate viable clones with the
hRAD51-K133A expression vector is consistent with similar findings in
chicken DT40 cells (26) and suggests that its expression is lethal.
View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Expression of human RAD51 at the
Pim1 locus in mouse ES cells. A, expression
cassettes for hRAD51 were cloned into a genomic fragment of the
Pim1 gene containing a linked promoterless hygromycin
resistance gene (hyg) to allow for efficient targeting.
Shown are diagrams of wild-type and targeted Pim1 loci and
the fragment of Pim1 used as the probe for the Southern
blot. Targeting vectors were transfected into the mouse ES cell line
E14-DRGFP (parental), and hygromycin-resistant clones were isolated.
B, Southern blot analysis of gene-targeting of the
Pim1 locus. Genomic DNA from hygromycin-resistant clones was
digested with HincII and probed with a DNA fragment of the
Pim1 locus. Shown are Pim1 Southern blot signals
for the parental cell line and hRAD51-WT and hRAD51-K133R expressing
cell lines. C, Western blot analysis of RAD51 expression in
the targeted cell lines. Protein from equivalent numbers of cells of
the parental cell line and the hRAD51-WT and hRAD51-K133R expressing
lines was separated by SDS-PAGE and probed for RAD51 by immunoblotting.
Shown is the immunoblot signal for RAD51 for each cell line from the
same film exposure. Loading of equivalent amounts of protein was
confirmed by Coomassie staining of a protein gel run in parallel (data
not shown).
|
|
Subsequently, these hygromycin-resistant clones were analyzed by
Southern blotting to identify clones that had correctly integrated the
vector at the Pim1 locus. From this analysis, 6 of the 8 clones derived from the hRAD51-WT vector and 7 of 13 clones derived
from the hRAD51-K133R vector were found to have undergone targeted integration (Fig. 1B, data not shown). These targeted clones
were used for subsequent experiments to analyze the effects of
wild-type and mutant RAD51 expression. Initially, multiple
independently targeted clones were examined and found to behave
similarly in the assays described below, such that one clone each for
hRAD51-WT and hRAD51-K133R was chosen for detailed analysis. We refer
to these cell lines as hRAD51-WT or hRAD51-K133R expressing cell lines,
to indicate that they are exogenously expressing these RAD51 proteins
in conjunction with the endogenous wild-type protein.
Expression of RAD51 protein in the targeted clones was analyzed by
Western blotting of total protein using an antibody that recognizes
both human and mouse RAD51. Targeted clones from both the hRAD51-WT and
hRAD51-K133R expression vectors exhibit elevated levels of total RAD51
compared with the parental line, by ~4- and 2-fold, respectively
(Fig. 1C). The 2-fold increase in total RAD51 in the
hRAD51-K133R expressing ES cell line compared with the parental line
suggests that the mutant protein accounts for approximately half of the
RAD51 in these cells. It is unclear what accounts for the somewhat
higher amount of RAD51 in the hRAD51-WT expressing line relative to the
hRAD51-K133R expressing line, although it is possible, for example,
that the wild-type protein is somewhat more stable than the mutant
protein. In summary, therefore, viable cell lines were generated that
exogenously express moderate levels of both the hRAD51-WT and
hRAD51-K133R proteins, together with the endogenous wild-type protein,
whereas no viable cell lines were identified that express the
hRAD51-K133A protein.
Cells Expressing hRAD51-K133R Exhibit an Increased Sensitivity to
DNA-damaging Agents--
Because moderate expression of the
hRAD51-K133R protein, in otherwise wild-type cells, is not lethal, we
could examine the impact of RAD51 with impaired ATP hydrolysis on the
repair of different DNA lesions. As a first step, we compared the
effects of the DNA-damaging agents MMC and IR on the relative viability of the parental and RAD51 expressing lines. We tested these agents because vertebrate cell lines deficient for homologous recombination have been found to be extremely hypersensitive to MMC, which produces interstrand cross-links, while having relatively less hypersensitivity to IR, which produces strand breaks and other types of lesions (22, 39,
40). To test whether mammalian cells expressing hRAD51-K133R are
hypersensitive to these agents, the parental cell line and the
hRAD51-WT- and hRAD51-K133R expressing lines were tested for clonogenic
survival following brief exposure to varying concentrations of MMC or
doses of IR. In both cases, clonogenic survival of untreated cells was
established as 100% survival for each cell line.
In the MMC experiments, the survival of the parental line and hRAD51-WT
expressing line was not compromised by exposure to 0.1 µM
MMC, whereas the hRAD51-K133R expressing line showed a mild sensitivity
at this concentration (52% survival) (Fig.
2A). At a higher concentration
of 0.6 µM MMC, the parental line and the hRAD51-WT
expressing line exhibited mild sensitivity (46 and 38% survival,
respectively), whereas the hRAD51-K133R expressing line showed a marked
sensitivity at this concentration (10.5% survival).
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Cell lines expressing hRAD51-K133R exhibit an
increased sensitivity to both the interstrand cross-linking agent MMC
and IR. The percent clonogenic survival of cells treated with
these DNA-damaging agents was computed relative to that of untreated
cells, which was set to 100% for each line. A, MMC
sensitivity. Clonogenic survival of the parental cell line and the
hRAD51-K133R and hRAD51-WT expressing lines was assessed after
treatment for 4 h without MMC, with 0.1 µM MMC, and
with 0.6 µM MMC. B, IR sensitivity. Clonogenic
survival of the parental cell line, hRAD51-K133R and hRAD51-WT
expressing lines, and a Rad54/ cell line was
assessed after treatment with 0, 2, 4, and 8 Gy of IR. Each percentage
shown is the mean of three experiments, and error bars
represent the S.D.
|
|
In the IR experiments, the survival of the parental line was not
compromised by exposure to 2 Gy, whereas the hRAD51-K133R expressing
line showed a mild sensitivity at this dose (53% survival) (Fig.
2B). Exposure of cells to 4 Gy resulted in mild sensitivity of the parental line and hRAD51-WT expressing line (35 and 40% survival, respectively), whereas the hRAD51-K133R expressing line showed a marked sensitivity at this dose (10% survival) (Fig. 2B). In addition, a Rad54/ mouse
ES cell line was included in these experiments to compare the IR
sensitivity of the hRAD51-K133R expressing ES cell line (35).
Interestingly, these two cell lines showed similar degrees of
sensitivity at these and higher doses (Fig. 2B). Thus, cells expressing the hRAD51-K133R protein at levels similar to the endogenous wild-type protein exhibit an increased sensitivity to both MMC and IR
and thus are defective for the repair of some types of DNA damage.
Cells Expressing hRAD51-K133R Have Reduced Spontaneous
Sister-Chromatid Exchange--
Although damage induced by MMC or IR
may be repaired by homologous recombination, sensitivity to these
agents does not provide a direct measure of recombination. To begin to
analyze the efficiency of homologous recombination in the hRAD51-K133R
expressing cell line, we investigated the spontaneous rate of SCE, an
apparent indicator of homologous recombination (41), in this line and the parental line. Spontaneous SCEs were visualized cytologically in
metaphase spreads following differential labeling of newly replicated
chromatids with 5-bromodeoxyuridine. By using this method, the number
of spontaneous SCEs per metaphase, normalized to the total number of
chromosomes observed in each metaphase, was determined for metaphases
from the two cell lines. In these experiments, the hRAD51-K133R
expressing cell line exhibited a lower average number of SCEs per
metaphase (5.25 ± 2.2) than the parental line (8.6 ± 4.3).
There was also a statistically significant difference
(p < 0.001) between the two cell lines in the
distribution of SCEs per metaphase (Fig.
3). For example, the percentage of metaphases with 10 or more SCEs was 2.4% for the hRAD51-K133R expressing cell line compared with 35% for the parental line. Thus,
expression of the hRAD51-K133R protein in otherwise wild-type cells
leads to a reduced rate of observable spontaneous SCE.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
Cells expressing hRAD51-K133R have a reduced
number of spontaneous SCEs per metaphase compared with wild-type
cells. Metaphase spreads for the parental cell line and the
hRAD51-K133R expressing line were analyzed. A total of 34 and 42 metaphases were analyzed from the parental cell line and the
hRAD51-K133R expressing line, respectively, for the number of SCEs per
metaphase. Shown are the percent of metaphases in each group of
0-3, 4-6, 7-9,
10-12, 13-15, 16-18, and
19-21 SCEs per metaphase, for both the parental cell line
and the hRAD51-K133R expressing line.
|
|
Expression of hRAD51-K133R Inhibits HDR of a Chromosomal DSB While
Not Affecting Overall DSB Repair--
Because the initiating events
that lead to SCEs and the repair of lesions generated by MMC and IR are
uncertain, we next wanted to address the effect of hRAD51-K133R
expression on the repair of a defined lesion. In these experiments, we
compared the parental cell line and the hRAD51-WT and hRAD51-K133R
expressing lines for the repair of an endonuclease-generated
chromosomal DSB using the reporter DR-GFP (Fig.
4A) (27, 28). In this
reporter, which is integrated at the hprt locus, a DSB is
generated by expressing the rare-cutting endonuclease
I-SceI, whose 18-bp recognition site has been integrated
into a gene (SceGFP) encoding green fluorescent protein, in
such a way that it disrupts the gene. Repair of the I-SceI
break by gene conversion gives rise to a functional GFP gene
when directed by the downstream GFP repeat, iGFP,
which is an internal GFP gene fragment truncated at both
ends. This HDR event can be scored in individual cells as green
fluorescence, using flow cytometric analysis (Fig. 4B), as
established previously by analysis of genomic DNA of purified green
fluorescent cells (23, 28). By using this assay, transfection of the
I-SceI expression vector into the parental cell line and
hRAD51-WT expressing cell line resulted in 2.2 and 2.1% GFP-positive
cells (Fig. 3C), respectively, similar to wild-type cell
lines analyzed previously (23, 27). In contrast, transfection with the
I-SceI expression vector in the hRAD51-K133R expressing cell
line resulted in only 0.44% GFP-positive cells, ~5-fold less than
the other two lines (Fig. 4C). These results indicate that
the hRAD51-K133R expressing cell line is deficient at HDR.
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
Cell lines expressing hRAD51-K133R exhibit
defects in HDR of a chromosomal DSB. A, the hprtDRGFP
reporter substrate. The recombination reporter DR-GFP was targeted to
the hprt locus. SceGFP is a GFP gene
that contains the I-SceI site within the coding region.
Cleavage of this I-SceI site in vivo can result
in HDR directed by the downstream GFP repeat,
iGFP. HDR by gene conversion without crossing over restores
functionality to the GFP gene, which can be scored by green
fluorescence. B, flow cytometric analysis of ES cells
containing the targeted hprtDRGFP reporter. Shown are plots of green
fluorescence on the y axis and orange fluorescence on the
x axis for 10,000 cells of the parental cell line and
hRAD51-WT and hRAD51-K133R expressing lines transfected with an
I-SceI expression vector. A plot of untransfected parental
cells is also shown. The GFP-positive population is denoted by the R1
gate as those cells that fluoresce more green than orange in contrast
to the GFP-negative population that fluoresces equally green and
orange. C, the percentage of GFP-positive cells from the
parental cell line and hRAD51-WT and hRAD51-K133R expressing lines
transfected with an expression vector for I-SceI. Each
percentage shown is the mean of four independent transfections, and
error bars represent the S.D.
|
|
Repair of the I-SceI-induced break can occur by HDR, as
described above, or it can occur by other repair pathways that do not
give rise to GFP-positive cells (28). These other pathways include
NHEJ, which would result in small insertions or deletions around the
I-SceI site, and SSA, which would result in a homologous deletion between the GFP repeats, forming a 3'-truncated
GFP gene (Fig. 5A).
To determine whether expression of the hRAD51-K133R protein
specifically reduces HDR or more globally affects DSB repair, we
measured overall DSB repair. Because loss of the I-SceI site
is a common feature of the repair products from these three pathways,
we quantified total DSB repair as the percent of SceGFP genes that have lost the I-SceI site.
View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
DSB repair is not globally reduced in the
hRAD51-K133R expressing cell line. A, DSB repair products
that have lost the I-SceI site after I-SceI
expression. Shown are diagrams of the parental DR-GFP substrate along
with the products of three pathways of DSB repair that result in
I-SceI site loss: HDR, NHEJ, and SSA. Loss of the
I-SceI site in cells transfected with an I-SceI
expression vector is quantified using PCR of genomic DNA with
primers 1 and 2 (arrows).
B, analysis of I-SceI site loss by PCR
amplification of SceGFP. PCR amplification of the genomic
region surrounding the I-SceI break site in
SceGFP results in a 725-bp product that is cleaved by
I-SceI into two fragments of 546 and 179 bp. After repair of
the DSB by HDR, NHEJ, or SSA, the ~725-bp product is not cleaved by
I-SceI. Shown are PCR products digested with
I-SceI and resolved on agarose gels from the parental cell
line and hRAD51-WT and hRAD51-K133R expressing lines transfected with
an expression vector for I-SceI. The ~725- and 546-bp
fragments are denoted as the I-SceI and I-SceI+
products, respectively. To determine the percent of the PCR product
from each cell population no longer digestible by I-SceI,
the ~725- and 546-bp fragments were quantified using a Bio-Rad
Chemidoc 2000 system, and the quantity of the 546-bp band was corrected
to compensate for weaker staining due to reduced length. Quantification
by this method was validated by analyzing mixed concentrations of
genomic DNA samples from pure populations of I-SceI+ and
I-SceI cells (data not shown). C, the percent
HDR relative to I-SceI site loss. This percentage was
determined for each cell line by dividing the percentage GFP-positive
cells by percent I-SceI site loss after transfection of the
I-SceI expression vector. Each percentage shown is the mean
of four independent transfections, and error bars represent
the S.D.
|
|
The percent of I-SceI site loss was determined by amplifying
the SceGFP gene from genomic DNA of cells transfected with
the I-SceI expression vector, using primers that flanked the
I-SceI site, and then cleaving the amplified product with
I-SceI (Fig. 5A). Reconstruction experiments,
using defined concentrations of cells that have lost the
I-SceI site, have demonstrated that there is a direct
correlation between the percentage of cells known to have lost the
I-SceI site and the percent I-SceI site loss as
determined by PCR analysis (data not shown). By using this analysis,
transfection of the I-SceI expression vector into each of
the parental cell lines and the hRAD51-WT and hRAD51-K133R expressing
lines was found to result in ~10% I-SceI site loss, although untransfected cells did not exhibit I-SceI loss
(Fig. 5B). To attempt to differentiate repair pathways, we
also cleaved the amplified products by BcgI, as HDR and SSA
products are both cleavable by this enzyme (Fig. 5A). For
each cell line, the BcgI-cleavable products were 
2% of
the total PCR products, which is at or below the limit of detection for
this assay (data not shown). Thus, although HDR is readily quantifiable
by GFP fluorescence, HDR and SSA are difficult to quantitate using the
PCR assay. As NHEJ products are not cleavable by BcgI, this
result indicates that NHEJ predominates among the DSB repair pathways
that are detectable with this substrate.
The efficiency of HDR relative to that of total repair was then
estimated by dividing the percentage of GFP-positive cells by the
percent I-SceI site loss (Fig. 5C). From the
analysis of at least four independent transfections for each cell line,
the hRAD51-K133R expressing cell line exhibited a significant decrease in the percentage of HDR relative to I-SceI site loss,
compared with both the parental cell line (5.8-fold decrease) and
hRAD51-WT expressing cell line (5.3-fold decrease). These data indicate that expression of hRAD51-K133R, in otherwise wild-type cells, results
in a specific defect in HDR rather than an overall deficiency in DSB repair.
Expression of a BRC Repeat from BRCA2 Exacerbates the HDR
Deficiency Caused by Expression of hRAD51-K133R--
Because the
hRAD51-K133R protein has been shown previously (26) to catalyze DNA
strand exchange in vitro, it is possible that disruption of
strand exchange is not the mechanism by which the hRAD51-K133R protein
inhibits HDR. A prediction of this hypothesis is that if strand
exchange were still proficient in the hRAD51-K133R expressing cell
line, inhibition of strand exchange would exacerbate the HDR defect in
this line. RAD51 nucleoprotein filament formation, a prerequisite of
strand exchange, has been shown recently to be inhibited by a peptide
from a region of the human BRCA2 protein that contains 8 copies of an
amino acid sequence termed a BRC repeat (31, 42). Specifically, a
69-amino acid peptide of BRCA2 containing the third BRC repeat (BRC3,
amino acids 1415-1483) has been shown to inhibit RAD51 nucleoprotein
filament formation, whereas a mutant peptide, mBRC3, with a deletion of
7 amino acids that are highly conserved among BRC repeats
(
Phe1428-Lys1434), does not inhibit
this process (31). Also, expression of another BRC repeat, BRC4, has
been shown to inhibit gene targeting (43) and RAD51 irradiation-induced
focus formation (44).
To test the effect of the BRC3 peptides on repair of the DSB in DR-GFP,
we co-transfected the I-SceI expression vector with vectors
we generated for the expression of either BRC3 or mBRC3, each with an
N-terminal nuclear localization signal. HDR events were scored as green
fluorescence, as described above. In these experiments, expression of
BRC3 in the parental cell line reduced the number of GFP-positive cells
by 2-fold, whereas expression of mBRC3 had no effect (Fig.
6). Expression of BRC3 in the hRAD51-WT expressing cell line had a smaller effect, reducing the number of
GFP-positive cells 1.5-fold, with expression of mBRC3 again having no
effect. Expression of BRC3 in the hRAD51-K133R expressing cell line
also reduced the number of GFP-positive cells, in this case 6-fold
below the already reduced level, such that HDR is decreased 31-fold
relative to the parental cell line (i.e. 2.2 versus 0.07%).
View larger version (39K):
[in this window]
[in a new window]
|
Fig. 6.
Cell lines expressing BRC repeat 3 from human
BRCA2 exhibit defects in HDR of a chromosomal DSB. A, flow
cytometric analysis of the parental cell line and hRAD51-WT and
hRAD51-K133R expressing lines transfected with an expression vector for
I-SceI in combination with expression vectors for either
BRC3 or mBRC3. Shown are plots of green fluorescence on the y
axis and orange fluorescence on the x axis for 10,000 cells for these transfections. B, percent of GFP positive
cells from the transfections of the I-SceI expression vector
alone or in combination with expression vectors for BRC3 or mBRC3. Each
percentage shown is the mean of four independent transfections, and
error bars represent the S.D.
|
|
To determine whether the effect of BRC3 expression on the percent of
GFP-positive cells is because of a specific loss of HDR events rather
than decreased total DSB repair, we examined the efficiency of HDR
relative to I-SceI site loss for each of these transfections, using the PCR-based assay described above. In these experiments, co-expression of I-SceI with either BRC3 or
mBRC3 in each of the cell lines resulted in ~10% I-SceI
site loss, similar to that obtained by transfection of the
I-SceI expression vector alone (Fig.
7A). Subsequently, the percent
HDR relative to I-SceI site loss was computed by dividing
the percentage of GFP-positive cells by the percent I-SceI
site loss for each individual transfection (Fig. 7B). In the
parental cells, the percent HDR relative to I-SceI site loss
was reduced 1.8-fold with BRC3 expression, whereas such expression had
little or no effect on the hRAD51-WT expressing cell line. In cells
expressing hRAD51-K133R, the percent HDR relative to I-SceI
site loss was reduced 3.1-fold with BRC3 expression. Therefore,
co-expression of hRAD51-K133R and BRC3 led to an overall 18-fold
reduction in HDR relative to I-SceI site loss compared with
the parental cell line. Expression of mBRC3, by contrast, had no effect
on HDR relative to I-SceI site loss in any of the cell
lines.
View larger version (35K):
[in this window]
[in a new window]
|
Fig. 7.
DSB repair is not globally reduced with BRC3
expression. A, determination of percent I-SceI
site-loss after I-SceI expression. Shown are PCR products
digested with I-SceI and resolved on agarose gels from
parental cell line and hRAD51-WT and hRAD51-K133R expressing lines
transfected with an expression vector for I-SceI alone or in
combination with expression vectors for either BRC3 or mBRC3. The
I-SceI+ and I-SceI products are labeled as in
Fig. 5B. The percent of the PCR product from each cell
population no longer digestible by I-SceI was determined as
in Fig. 5B. B, percent HDR relative to
I-SceI site loss from the transfections of the
I-SceI expression vector alone or in combination with
expression vectors for BRC3 or mBRC3. Each percentage shown is the mean
of four independent transfections, and error bars represent
the S.D.
|
|
Thus, whether measured directly by the number of GFP-positive cells or
relative to total DSB repair leading to I-SceI site loss,
expression of BRC3 reduces HDR in the hRAD51-K133R expressing cell line
as well as the parental cell line. By contrast, the excess RAD51
protein in the hRAD51-WT expressing line appears to interfere with the
inhibitory effect of BRC3.
| |
DISCUSSION |
RAD51 is an essential gene in vertebrate cells (16-18)
and has been implicated in tumor suppression through its interactions with the breast cancer susceptibility genes BRCA1 and
BRCA2 (5, 21). To begin to investigate the function of RAD51
in mammalian DNA repair, we used a dominant negative approach,
expressing the ATP hydrolysis-defective hRAD51-K133R protein in mouse
ES cells that retain expression of the endogenous wild-type RAD51
protein. We found that expression of hRAD51-K133R impairs multiple
types of DNA repair, i.e. HDR of a chromosomal DSB, repair
leading to SCE, and repair of damage arising both from the
cross-linking agent MMC and from IR. In contrast, overall DSB repair,
predominantly NHEJ, was not affected by expression of hRAD51-K133R.
Although it is formally possible that reduced HDR and the other DNA
repair phenotypes we observed arise from disruption of some other
function of RAD51 than ATP hydrolysis, these results implicate ATP
hydrolysis by RAD51 as being important for efficient levels of certain
types of DNA repair in mammalian cells.
Although RAD51 has been shown to play a central role in recombination
reactions in many organisms (15), the effect of a defined mutation in
RAD51 on HDR in mammalian cells has not been reported
previously, even in a dominant negative context. The ~5-fold
reduction in HDR of the I-SceI endonuclease-generated DSB we
found in the hRAD51-K133R expressing cells is similar to that seen in
ES cells with hypomorphic mutations of Brca1 and Brca2 (22-25), although Rad54 null ES cells have
a much milder HDR defect (45). Gene-targeting defects also arise from
expression of the hRAD51-K133R mutant, as reported previously in
chicken DT40 cells (26) and as suggested in our experiments by the
decreased efficiency with which we obtained targeted ES cell clones.
However, mutations in homologous recombination genes can have very
different effects on gene targeting and HDR. Notably, Rad54
and Brca1 mutations have been shown to have much larger fold
effects on gene targeting than on HDR (22, 45), whereas a
Brca2 mutation gives a more profound HDR defect (23).
Mutations in NHEJ genes also differentially affect gene targeting and
HDR (27, 46). Thus, the various DSB repair proteins in mammalian cells
appear to have distinct roles in different recombination reactions,
with those proteins having major roles in HDR also being critical for
cellular and organismal viability (i.e. Rad51,
Brca1, and Brca2).
In yeast, spontaneous interchromosomal recombination has been shown to
be defective in cells expressing an ATP hydrolysis mutant of RAD51
(36), although in this case it is not clear if the initiating event is
a DSB. In ES cells, we also found that spontaneous SCE is reduced in
cells expressing the hRAD51-K133R protein. SCE events may be somewhat
distinct mechanistically from HDR of an endonuclease-generated DSB,
because SCEs are predicted to be promoted by one-ended DSBs that arise
during DNA replication (20), in contrast to the two-ended DSBs that
arise from I-SceI endonuclease cleavage (27). Thus, ATP
hydrolysis by RAD51 appears to be important for mechanistically
different homologous recombination processes.
Although the efficiency of HDR in the hRAD51-K133R expressing cells is
reduced, it was not completely abolished. The residual HDR in the
hRAD51-K133R expressing cells could be RAD51-independent, because
RAD51-independent pathways have been identified in S. cerevisiae (47-49). However, this residual HDR appears to be
RAD51-dependent given that it is substantially reduced by
expression of a peptide that disrupts an early step in RAD51-mediated
strand exchange, i.e. a BRC repeat, BRC3, from BRCA2. BRC3
interacts with RAD51 in vitro (50, 51) and prevents its
association with DNA into nucleoprotein filaments (31), which is a
prerequisite for RAD51-mediated strand exchange (15). These results
suggest that the hRAD51-K133R expressing cells could be relatively
proficient at strand exchange, because of strand exchange activity of
the hRAD51-K133R protein itself (26) or residual activity from the
endogenous wild-type protein. Other HDR processes could nevertheless
require ATP hydrolysis; for example, ATP hydrolysis by RAD51 has been
shown to cause dissociation of RAD51 from complexes with DNA (52). This
dissociation could be important for completing recombination or for
turnover of the protein to monomers, enabling them to function in
subsequent reactions.
Nevertheless, we cannot rule out that ATP hydrolysis by RAD51 in
mammalian cells has effects upon strand exchange during HDR in
vivo. ATP hydrolysis by yeast Rad51 has been shown to be
dispensable for efficient and extensive strand exchange (53, 54).
Despite these observations, it is formally possible that the human
RAD51-K133R protein could be defective for extensive strand exchange,
because the strand exchange activity of this protein has only been
tested using short oligonucleotide DNA molecules (26). It is also
important to consider that wild-type RAD51 protein is also present in
the cells expressing hRAD51-K133R, such that wild-type and mutant protein could form mixed RAD51 nucleoprotein filaments which may have
intermediate activities during extensive strand exchange in
vivo. In general, the in vivo requirements for strand
exchange could be different from those in vitro, due to the
presence of other factors and where chromosomes are the substrates for recombination.
Although chicken DT40 cells that express hRAD51-K133R as the only RAD51
in the cell are no more sensitive to IR than wild-type chicken cells
(26), we found that the hRAD51-K133R expressing ES cells are
hypersensitive to IR. Mouse ES cells and chicken DT40 cells may
therefore have different requirements for RAD51 in the repair of IR
damage. Despite this disparity between the mouse and chicken cell
lines, the phenotypes of the hRAD51-K133R expressing mouse cells are
similar to that of other mammalian HDR mutants, such as
XRCC2, XRCC3, and BRCA1, which have
increased sensitivity to MMC as well as to IR (22, 39, 40, 55, 56). Although not examined in our study, sensitivity to the alkylating agent
MMS has also been shown in S. cerevisiae to be affected by
ATP hydrolysis defects of RAD51, as tested both in a dominant negative
context and when expressed at normal levels in a rad51 null
mutant (36-38). These results again point to a role for ATP hydrolysis
by RAD51 during DNA repair, although it is important to note that
overexpression of an ATP hydrolysis-defective mutant in yeast will
suppress the MMS sensitivity of a rad51 null mutant (54).
Because disruption of RAD51 results in cellular lethality in
mammalian cells (17, 18), it has been difficult to discern its role in
DNA repair. In this report, we have begun to examine the effect of
defined RAD51 mutations on DNA repair in mammalian cells
using a dominant negative approach. Although we have successfully achieved moderate levels of hRAD51-K133R expression in otherwise wild-type cells, it is still unclear whether the ATP hydrolysis mutant
could substitute for wild-type RAD51 in mammalian cells, as it does in
chicken cells. Our attempts to express the mutant at higher levels have
thus far been unsuccessful,2
suggesting that viability of the hRAD51-K133R expressing ES cells may
be dependent upon sufficient levels of expression of the wild-type protein to counteract the effects of the mutant.
A dominant negative approach to study RAD51 function has been reported
previously (57, 58) to be successful in mammalian cells using a mouse
Rad51 fusion protein containing an N-terminal extension from the yeast
Rad51 protein. The effect of this fusion protein could conceivably be
linked to altered ATP hydrolysis by RAD51 because, like the
hRAD51-K133R mutant, it reduces HDR. However, it seems more likely that
the N-terminal extension interferes with some other aspect of RAD51
function, because spontaneous SCE was only slightly diminished in cells
expressing the fusion protein (57, 58), and these cells are not
sensitive to IR (57), unlike cells expressing the hRAD51-K133R protein.
The expectation in these previously reported dominant negative
experiments and those described here is that the mutant RAD51 proteins
interact with the wild-type protein to form mixed complexes or even
mixed nucleoprotein filaments with DNA. However, it is also possible that the mutant proteins disrupt DNA repair by the wild-type protein by
interacting directly with recombination intermediates or by associating
with other DSB repair proteins.
In addition to an essential function for cellular viability, a role for
RAD51 in tumor suppression is suggested by the interaction of RAD51
with the breast and ovarian tumor suppressors BRCA1 and BRCA2 (21),
which are known to promote HDR and gene targeting (22-25, 43), and
also by the findings that single nucleotide polymorphisms and mutations
in RAD51 are associated with breast tumors (5). Further
analysis of RAD51 function, either by the dominant negative approach
described here or with knock-in mutations, will be essential for a
thorough understanding of RAD51 function in DNA repair, genome
stability, and tumor suppression.
,
TOP
ABSTRACT
INTRODUCTION
Supported by American Cancer Society Post-doctoral Fellowship
PF-00-106-01-MGO.
CiteULike 
