|
Originally published In Press as doi:10.1074/jbc.M109553200 on April 1, 2002
J. Biol. Chem., Vol. 277, Issue 23, 20221-20233, June 7, 2002
Probing Interactions between the U2 Small Nuclear
Ribonucleoprotein and the DEAD-box Protein, Prp5*
Barham K. Abu
Dayyeh §,
Tiffani K.
Quan ,
Marygrace
Castro , and
Stephanie W.
Ruby ¶
From the Department of Molecular Genetics and
Microbiology, University of New Mexico Health Sciences Center,
Cancer Research and Treatment Center,
Albuquerque, New Mexico 87131
Received for publication, October 3, 2001, and in revised form, March 25, 2002
 |
ABSTRACT |
Pre-mRNA binding to the yeast U2 small
nuclear ribonucleoprotein (snRNP) during prespliceosome formation
requires ATP hydrolysis, the highly conserved UACUAAC box of the branch
point region of the pre-mRNA, and several factors. Here we analyzed
the binding of a radiolabeled 2'-O-methyl oligonucleotide
complementary to U2 small nuclear RNA to study interactions between the
UACUAAC box, U2 snRNP, and Prp5p, a DEAD box protein necessary for
prespliceosome formation. Binding of the 2'-O-methyl
oligonucleotide to the U2 snRNP in yeast cell extract was assayed by
gel electrophoresis. Binding was rapid, enhanced by ATP, and dependent
on the integrity and conformation of the U2 snRNP. It was also
stimulated by Prp5p that was found to associate physically with U2
snRNP. In vitro heat inactivation of the
temperature-sensitive prp5-1 mutant extract decreased
oligonucleotide binding to U2 and the ATP enhancement of binding by
3-fold. Furthermore, the temperature-sensitive prp5-1 mutation maps to the ATP-binding motif I within the helicase-like domain. Thus the catalytic activity of Prp5p likely promotes a conformational change in the U2 snRNP.
 |
INTRODUCTION |
The spliceosome is a large, dynamic ribonucleoprotein particle
that catalyzes nuclear pre-mRNA splicing. It is composed of multiple factors including five
snRNPs1 and numerous
non-snRNP proteins, which assemble on the pre-mRNA (1, 2). It
undergoes a number of conformational changes during its transit through
a splicing cycle. At least seven such changes are disruptions of RNA
base pairings (3-5), whereas other changes involve protein-protein and
RNA-protein interactions. Some of these changes are probably catalyzed
by DEXD/H-box proteins, eight of which are known to be
required for the splicing pathway in the yeast Saccharomyces
cerevisiae (6).
DEXH/D-box proteins are numerous in both prokaryotes and
eukaryotes and are involved in diverse biological processes, but they
all have a similar domain with six or seven signature motifs (7, 8). In
the archetypal DEAD box family member, EIF4a, these motifs encode
RNA-dependent ATPase and RNA unwinding activities (9, 10).
To date the spliceosomal DEXH/D box proteins are fulfilling
the prediction that they catalyze the RNA rearrangements in the
spliceosome. They are required at steps in which ATP hydrolysis and
spliceosomal structural changes both occur; most have been shown to
have RNA-dependent ATPase activity; and some have even been
found to have RNA unwinding activity (6). Nevertheless, the actual
targets of the spliceosomal DEAD box proteins are unknown. Some of the
proteins may not even unwind RNA but instead act as an RNPase to remove
protein bound to RNA (11, 12).
Two of the first DEAD-box proteins required for yeast prespliceosome
formation on the pre-mRNA are Sub2p (13-15) and Prp5p (16). The
prespliceosome is an early intermediate in spliceosome formation. It
immediately succeeds the binding of the U1 snRNP and at least two
proteins (Bbp and Mud2p) to the pre-mRNA. During prespliceosome
formation, Bbp and Mud2p are displaced from the pre-mRNA (17, 18);
ATP is hydrolyzed (19); and U2 snRNP binds to the pre-mRNA (20,
21). During U2 binding or shortly thereafter, the U2 snRNA base pairs
with the UACUAAC box of the pre-mRNA (22). One UACUAAC box nt, the
branch point nt, remains unpaired (23), however, and will eventually
initiate the first transesterification reaction of splicing catalysis
(2, 5).
Although Sub2p is thought to remove Bbp and Mud2p from the pre-RNA
(13-15, 24), the target and mechanism of action of Prp5p in
prespliceosome formation are unknown. In vitro, Prp5p
enhances deoxyoligo-directed RNase H cleavage of U2 snRNP (25), and the ATPase activity of the Prp5 is stimulated by U2 snRNA (26). These two
results suggest that U2 snRNA is the target of the Prp5p. This idea is
attractive because U2 alternates between two conformations involving
stem-loop II in its 5' end region, but only one conformation (stem-loop
IIA) forms the prespliceosome efficiently (27, 28). Genetic data as
well indicate that Prp5p somehow interacts with U2 (16, 29, 30).
However, it has not been shown whether or not Prp5p physically
associates with the U2 snRNP.
Biochemical assays to detect unwinding of a generic RNA substrate by
Prp5p have not been successful (26). This may be because Prp5p acts as
an RNPase on an RNA-protein substrate, or it requires a specific
substrate or protein cofactor as do some helicases (31, 32). The
function of Prp5p in vivo does depend on other proteins as
revealed by genetic assays. The Ts prp5-1 and
prp5-3 mutations are synthetically lethal with any one of
several mutations in the multimeric SF3 complex (16, 29, 33). The human
SF3 complex binds via one of its components, SF3b, to the 5' region of
U2 snRNA (34). Both the human and yeast SF3 complexes facilitate binding of U2 snRNP to the pre-mRNA and stabilize the
prespliceosome (1). Additionally another yeast protein, Cus2p,
physically associates with SF3 and the U2 snRNP as well as suppresses
the misfolding of the U2 snRNA and interacts genetically with Prp5p (35).
Previously, others (36, 37) have used 2'-O-methyl
oligonucleotides (2'-OMe oligos) to probe the structures and functions of the spliceosomal snRNPs in HeLa cell splicing extracts. An oligo
with a 2'-O-methyl is more resistant to the nucleases of the
extract than one with a 2'-hydroxyl. It also does not activate the
RNase H activity of the extract as does a 2'-deoxyoligo. Thus 2'-OMe
oligos can form stable hybrids with snRNAs and preserve the snRNPs to
which they may bind (36). In this study, we used small, 2'-OMe oligos
encoding the UACUAAC box to study factors required for pre-mRNA
binding to U2 snRNP in yeast whole cell splicing extracts (WCE). The
accessibility of the branch point interaction region (BpIR) of U2 snRNA
to the oligo was enhanced by ATP and was dependent on the integrity and
conformation of the U2 snRNP as well as on Prp5p activity. The Ts
prp5-1 mutation reduced the ATP-stimulated binding of the
2'-OMe oligo to U2 snRNP. Furthermore, the mutation mapped to the
ATP-binding motif I within the helicase-like domain. Finally, Prp5p
physically associated with the U2 snRNP. Thus, Prp5p likely catalyzes
an ATP-dependent conformational change of U2 snRNP.
 |
EXPERIMENTAL PROCEDURES |
Deoxyoligos and 2'-OMe Oligos--
Deoxyoligos SRU2, SRU1, and
oSR4 were as described previously (38). The following deoxyoligos were
synthesized by either Genosys, Inc., or the University of New Mexico
Center for Genetics in Medicine: oSR42 (5'
CCTCTTGATCATACCTTTCATGTCTTC), oSR43 (5' CCCCTCGAGGATCCATATGTCAAATAAACCC), oSR177 (5' AATTCAGGGTACCA), and
oSR178 (5' AATTTGGTACCCTG) for plasmid constructions; oSR125 (5'
CTATTGGAAGCGCATGTTTGATCAG), oSR152 (5' GTGTATTGTAACAAATTAAAAGG), oSR154
(5' GTTTATAATTAAATTTCAACCAGC), oSR127 (5' AAGTTCAAAAAATATGGCAAGC), and
oSR153 (5' GTATTGTTTCAAATTGACCAAA) for primer extensions of U1, U2, U4,
U5, and U6 snRNAs; and oSR115 (5' ATACTTACCTTAAGATATCAGAGGAG) with
oSR116 (5' AAAATAAATCAAAAATTATAAGATCCACCCG), oSR117 (5'
ACGAATCTCTTTGCCTTTTGGCTTAG) with oSR118 (5'
GCGAACGGGAAGACGAGAGAAACATC), oSR119 (5' ATCCTTATGCACGGGAAATACGCATATC) with oSR120 (5' AAAGTATTCAAAAATTCCCTACAAG), oSR121 (5'
AAGCAGTTTACAGATCAATGGCGG) with oSR122 (5' CGCCTTCCTTACTCATTGAGAAAAAGG),
and oSR123 (5' GTTCGCGAAGTAACCCTTCGTGGAC) with oSR124 (5'
AAAACGAAATAAATCCTTTGTAAAACGG) for PCR amplification of DNAs encoding
U1, U2, U4, U5, and U5, respectively.
The 2'-OMe oligos mU2-wt, mU2-4A, mU2-6C, mU2-4A6C, and mU2-bp (Fig. 1)
were synthesized by Oligos Etc. (Wilsonville, OR). The 2'-OMe oligos
mU2-dC (Fig. 1) and mActexon2 (5' (dC)5UUIIICUICAIIUC) were
synthesized by the Microchemical Facility at the California Institute
of Technology (Pasadena, CA) with phosphoramidates (39) obtained from
B. Sproat (EMBL, Heidelberg, Germany). The 5'terminal deoxycytidine residues of mU2-dC and mAct-exon2 were modified with
N4-(5-trifluoroacetylaminopentyl) for use in
experiments not described in this study.
Plasmids--
The following plasmids were obtained from others:
pGD231 (CEN-ARS-URA3-PRP5) and pGD532
(2µ-HIS3-PRP5) from G. Dalbadie-McFarland; PGAD-PRP5 from
D. Wiest, pBM272 (40) from M. Johnston; and pEG(KT) (41) from M. Osley.
Plasmid pGAD-PRP5 contains the PRP5 ORF amplified by PCR and
fused to the Gal4 activation domain vector pGAD424 via a unique
NdeI site spanning the start codon as described (26). The
pRS300 and pRS400 series of yeast shuttle vectors were as described
previously (42).
Plasmids were constructed with standard cloning techniques (43).
Plasmid pCM1 was cloned in two steps as follows: step 1, pSR501 was
constructed by ligating HincII-cut pGD532 under dilute conditions to remove the 1-kb HincII fragment upstream of
PRP5; and step 2, the MCS restriction sites between the
NotI and EcoRI were removed by cutting pSR501
with EcoRI and NotI, blunting the DNA ends with
Klenow, and ligating the DNA. Plasmid pPS12
(prp5 1615::LEU2) was constructed in
two steps as follows: step 1, the 3.9-kb PstI fragment of
PRP5 from pGD532 was purified by gel electrophoresis and
circularized by ligation under dilute conditions; and step 2, the
circularized fragment was cut with BsaHI and SacI
(removing 1.68 kb of coding sequence) and then ligated to pRS405 cut
with AccI and SacI. pPS24
(prp5 1815::LEU2) was constructed by
ligating a BclI-XhoI PRP5 fragment
amplified by PCR with oligos oSR42 and oSR43 to pPS12 cut with
BclI and XhoI.
The GST tag was fused to the N terminus of the Prp5p as follows. The
2.5-kb EcoRI-SalI fragment from pGAD-PRP5 was
ligated into the EcoRI and SalI sites of pRS423
to create pSR281. The StuI-EcoRI fragment with
GAL1 promoter of pEG(KT) and GST fragment was fused upstream
and out-of-frame to PRP5 ORF by cloning into pSR281 cut with
SmaI and EcoRI to create pSR282. The
PRP5 ORF and GST were put in-frame by ligating hybridized
oligos oSR177 and 178 into pSR282 cut with EcoRI and
NdeI to create plasmid pSR284.
Yeast Strains--
The following S. cerevisiae
strains were obtained from others: RL172 (Mata
prp5-1) from R. Last and J. Woolford (see Ref. 44); and
H170-wt (Mata leu2-3,112 his4-619 lys2 U2::Ura3 (Ycp-LEU-U2wt)) and
H170-C62U (Mata leu2-3, 112 his4-619 lys2
U2::Ura3 (YCp-LEU2-U2C62U)) from
M. Ares (45). Haploid strains with the indicated prp
mutations (16) and wild type haploid TSR1210 (46) were as described.
Diploid DSR1515 was made by mating SRYwtg (Mata
his3d200 his7 leu2 ura3-52) and SRYwth (Mata
his3d200 leu2 ura3-52) using standard yeast genetics (47).
Strain TSR477 was DSR1515 made heterozygous for
prp5 1815::LEU2 by transformation
with the pPS24 PstI fragment and confirmed by Southern blot
analysis. Sporulation and tetrad dissection of 16 asci from TSR477
yielded no viable LEU2 spore clones. TSR477 was transformed
with pGD231 and sporulated to yield haploid TSR489-7-3a
(Mata prp5d1815::LEU2 his3d200
leu2-3-112, ura3-52 (pCEN-URA3-PRP5)). The wild type
copy of PRP5 in yeast strain DSR489-7-3A was replaced with
either plasmid pSR282 or pSR284 by plasmid shuffling (47) to obtain
strains TSR1675 and TSR1673, respectively.
Cloning and Sequencing the prp5-1 Mutant Allele--
The
prp5-1 mutant allele was cloned by gap repair (48). Plasmid
pCM1 DNA was cut with NcoI and SpeI, purified by
gel electrophoresis, and then introduced into strain SRY5-1a
(Mata prp5-1 his3d200 leu2-3,-112, ura3-52) by
transformation to His prototrophy at 23 °C. Several restriction
endonucleases were tested for gapping. DNA gapped with NcoI
and SpeI yielded only Ts yeast cells when 30 independent
transformants were assayed. Plasmids (pTSR342-d1, pTSR342-d5, and
pTSR342-e44) from 3 of the 30 yeast clones were isolated and amplified
in Escherichia coli as described (48). All 3 plasmids
conferred Ts growth when tested in TSR489-7-3A by plasmid shuffling.
The 3.9-kb HincII-ClaI fragments from each plasmid were subcloned into HincII and ClaI sites
of pRS413 to yield plasmids pPS17, pPS18, and pSP19, respectively and
again confirmed for the Ts mutation in TSR489-7-3A. Fragments from
pPS17 were subcloned into pPS25 and tested in yeast cells to map the Ts
mutation to the 200-bp NcoI fragment. Plasmids pPS17, pPS18, and pPS25 were sequenced with the Sequenase version 2.0 kit (U. S.
Biochemical Corp.) across this fragment (43). Comparisons of the mutant
with the wild type sequences in pPS25 and in GenBankTM
showed only a single nucleotide difference.
Extract Preparation, Heat Inactivation, and in Vitro
Splicing--
Preparation of WCE by the "freeze-fracture" method,
in vitro synthesis of 32P-labeled yeast actin
precursor RNA, and splicing assays were as described (49). For heat
treatments, wild type and prp5-1 WCE were brought to 1.5 mM MgCl2, incubated for 10 min at 38 °C, and
then put on ice. Mutant prp2-1 WCE was treated as described (44). MgCl2, DTT, KPO4 (pH 7.4), and PEG8000
were then added to final concentrations of 3, 2, 60 mM, and
3% (w/v), respectively, for the final binding reactions as described
below. The reactions were next incubated with 5 mM
D-glucose (to deplete ATP) or water at 23 °C for 5 min.
The binding reaction was then initiated by the addition of radiolabeled
oligo to 5 nM and either water or ATP (to 2 mM), incubated at 23 °C, and processed as described below.
2'-OMe Oligo Binding Assays and Native Gel
Electrophoresis--
Each 2'-OMe oligo was radioactively labeled at
its 5' end as described previously (39) and separated from
unincorporated nts in two successive micro spin G-25 columns (Amersham
Biosciences). The 2'-OMe oligo binding assay contained 2 mM
DTT, 60 mM KPO4 (pH 7.4), 3% (w/v) PEG8000, 3 mM MgCl2, 2 mM ATP, and 40% (v/v) extract in 20 mM Hepes-K+ (pH 7.8 at 0 °C),
0.2 mM EDTA, 50 mM DTT, and 20% (v/v)
glycerol. The binding reaction was mixed on ice and then initiated by
adding radiolabeled 2'-OMe oligo to a concentration of 5 nM
and incubated at 23 °C. Five-µl reaction aliquots were each
quenched with 9 µl of ice-cold R buffer mix containing 5 µl of R
buffer (50 mM Hepes-K+ (pH 7.4), 2 mM magnesium acetate), 3 µl of load buffer (217 mM Tris phosphate (pH 8.0), at 0 °C, 40% (v/v)
glycerol, and 0.25% (w/v) each bromphenol blue and xylene cyanol), and
1 µl of H2O. For zero time points, 5-µl reaction
aliquots were added to ice-cold R buffer mix containing radiolabeled
oligo. Little oligo bound to the U2 snRNP in the zero time quenched
reactions even after prolonged incubation (data not shown).
To analyze any effect of ATP on oligo binding or GST selection (see
below), the reactions were first incubated with 5 mM
D-glucose (to deplete ATP) or water at 23 °C for 5 min
and then chilled on ice. The binding reaction was then initiated by the
addition of radiolabeled oligo to 5 nM and either water or
ATP (to 2 mM) and incubated at 23 °C.
Quenched samples were fractionated on a 3.2% (w/v) polyacrylamide gel
(50:1 acrylamide/bisacrylamide) in TPM8 buffer (48 mM Tris
phosphate (pH 8 at 0 °C), 1.5 mM magnesium acetate) at
4 °C for 16-20 h at 5.5-6.7 V/cm. Radiolabeled bands were
visualized by autoradiography and quantitated in dried gels with a
Molecular Dynamics Storm 840 PhosphorImager and ImageQuant software
version 5.0. Data were analyzed in Minitab version 13 by the
Anderson-Darling test for normal distribution, the Bartlett test for
variance homogeneity, one-way ANOVA for comparing means to 100%, and
Tukey's multiple ANOVA for all other comparisons of means (50, 51).
Only a 95% confidence level could be calculated for the one-way ANOVA. The data in Figs. 2B and 8B were normalized to
the 0-min values and analyzed by Tukey's multiple ANOVA comparison.
Northern Blot Analyses--
RNAs in native and denaturing gels
were electrophoretically transferred to PerkinElmer Life Sciences
GeneScreen as described previously (52). Northern blots were incubated
as described previously (52) with U-snRNA-specific probes made from DNA
fragments amplified by PCR with oligos oSR115-oSR124 and radiolabeled
by random deoxyoligo-primed extension (53).
Deoxyoligo-mediated RNase H Cleavage of the U2
snRNA--
Reactions for deoxyoligo-mediated RNase H cleavage
contained 2.2 mM DTT, 66 mM KPO4
(pH 7.4), 3.3% (v/v) PEG8000, 3.3 mM MgCl2, 0.2 mM ATP, wild type WCE (45% v/v), and either water or
the indicated concentrations of the deoxyoligo SRU2, SRU1, or oSR4 (38,
54). They were incubated for 30 min at 23 °C. For binding assays,
GST selections, or Northern analysis, additional ATP to 2 mM and either water or radiolabeled 2'-OMe oligo was added,
and the reactions were further incubated at 23 °C.
Western Analysis and Affinity Selection of
GST-Prp5p--
Protein concentrations in WCE were determined with the
DC protein assay kit (Bio-Rad). WCE samples containing 40-126 µg of protein were fractionated by SDS-PAGE and then transferred onto a
Millipore Immobilon-P membrane in Towbin buffer containing 0.01% SDS
and no methanol (43). Primary mouse anti-GST (Babco) or rabbit
anti-Bcy1 antibody (a gift from M. Werner-Washburne, University of New
Mexico, Albuquerque, NM) was diluted 1:2000 in antibody buffer (5%
nonfat milk, 10 mM Tris-HCl (pH 7.5), 150 mM
NaCl, and 0.01% Tween 20). The secondary antibody, goat anti-mouse IgG or goat anti-rabbit IgG conjugated with horseradish peroxidase (Amersham Biosciences), was diluted 1:10,000 in antibody buffer. Proteins were visualized with chemiluminescent ECL-plus (Amersham Biosciences).
Quenched oligo binding reactions were added to an equal volume of
packed glutathione-Sepharose 4B (Amersham Biosciences) that had been
prepared by washing three times with NET-2 (50 mM Tris-HCl (pH 7.6), 150 mM NaCl, and 0.05% Nonidet P-40) at 0 °C.
The slurry was gently agitated at 0 °C for 30 min and then washed
four times with ice-cold NET-2. A 10-20-fold volume of 50 mM sodium acetate, 10 mM EDTA, 1% SDS was then
added, and the RNAs were extracted with hot phenol as described (55).
Primer extension reactions were as described (56) except that the
reactions were supplemented with 50 ng/µl actinomycin D (Sigma).
 |
RESULTS |
2'-OMe Oligonucleotide Binding to Components in Whole Cell Splicing
Extracts--
To study the interactions between Prp5p and U2 snRNP, we
modified an assay used previously by Lamond and colleagues (36, 57) to
probe the structure of the U2 snRNP in HeLa cell extracts. They tested
several 2'-OMe oligos complementary to different regions of U2 snRNA
and found that only oligos complementary to the 5' end region of the
snRNA hybridized to the U2 snRNP in splicing extracts. Based on their
results and the sequence of a deoxyoligo, SRU2, previously used for
targeted RNase H degradation of the yeast U2 snRNA (38, 58), we
designed a 2'-OMe oligo, mU2-wt, complementary to the BpIR of U2 snRNA
(Fig. 1). When mU2-wt hybridizes to U2,
the "branch point nt" is predicted to bulge out from the helix.
When this oligo was added to an in vitro splicing reaction at a concentration of 250 nM, it inhibited splicing of the
exogenously added actin pre-mRNA substrate, whereas an oligo
complementary to the 3' end of the actin pre-mRNA substrate had no
effect (data not shown). Additionally, we tested another oligo, mU2-dC
(Fig. 1), similar to mU2-wt, but mU2-dC cannot form a bulged branch point nucleotide, and it has 4 modified deoxycytidines at its 5' end
that are not complementary to U2 snRNA. Nonetheless, the mU2-dC oligo
also inhibited splicing at the same concentration as mU2-wt. These
results suggest that mU2-wt and mU2-dC compete with the pre-mRNA
for essential splicing factors.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
Diagram of the 2'-OMe oligos used in this
study and their complementarity to U2 snRNA. The primary and
secondary structures of the 5' end region of U2 snRNA (28, 30) are
shown with the stem-loops of the active form of U2 indicated with
roman numerals and the Sm protein-binding site
(SM) in italics. The Cs C62U mutation in U2 is
indicated by the open arrowhead. The dashed lines
with filled arrowheads indicate other possible pairings: 1)
nts 98-105 with nts 54-61 (in bold) to form the conserved
complementary stem (CCS) (28); and 2) nts 25-30 with nts 42-47 (in
bold) (30). The wild type 2'-OMe mU2-wt is shown hybridized
to U2 with the UACUAAC box and the BpIR of U2 boxed. The
branch point nucleotide (A) of the UACUAAC box is shown
bulged out from the helix. The sequences of the 2'-OMe oligos used
in this study are given with the mutations in the UACUAAC box
designated by lowercase, underlined letters. The
5' end of oligo mU2-dC has 4 modified deoxycytidines (dC)
and inosine (I) instead of guanosine (see "Experimental
Procedures").
|
|
We used native gel electrophoresis to assay binding of these oligos to
factors in a whole cell extract (WCE) active for splicing. The
conditions of the binding assay were nearly the same as those of an
in vitro spliceosome assembly assay (59). However, in the
binding reaction, a radiolabeled 2'-OMe oligo was added instead of
radiolabeled pre-mRNA splicing substrate. Aliquots of the reaction were taken during incubation at 23 °C and then fractionated by electrophoresis in a native gel to separate bound from unbound oligo.
Five radiolabeled bands were obtained with either wild type oligo
mU2-wt or mU2-dC (Fig. 2A and
data not shown). Band 1 was the slowest migrating and least intense of
all five bands. It weakly appeared during the course of the reaction in
the presence or absence of ATP. Band 2 was the second most intense of
the five bands when formed on mU2-wt and, as described below, contains the U2 snRNP. The amount of band 2 rapidly increased during incubation at 23 °C and was usually more abundant in reactions with added ATP
compared with those depleted of ATP (Fig. 2B). Different
extracts and extract preparations varied as to the extent of ATP
stimulation; the extracts most active for pre-mRNA splicing also
gave the most ATP stimulation of band 2 formation. Usually 5-10% of
the input oligo was in band 2 by 30 min in reactions with ATP. The
amounts of radiolabeled 2'-OMe oligo bound to U2 snRNP in band 2 were proportional to the concentration of radiolabeled oligo in the reaction
over the range of concentrations tested (1-20 nM) and were
similar for mU2-wt and mU2-dC (data not shown). Band 3 formed in
samples kept on ice and was most intense at early times. It decreased
after only a few minutes of incubation at 23 °C for oligo mU2-wt and
more slowly for mU2-dC (Fig. 2A and data not shown). The
amount of band 3 varied considerably among different extracts. Band 4 was the second most abundant band formed with mU2-dC oligo (data not
shown) but was barely detectable with mU2-wt. It increased in abundance
with time, more so in reactions depleted of ATP than those with added
ATP. Extraction and analysis of band 4 from the gel indicated that
oligo mU2-dC was still intact and radiolabeled (data not shown).
Finally, band 5, which was the most intense of the five bands,
comigrated with unbound radioactive oligo (data not shown) and was
usually run off the gel.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 2.
2'-OMe oligos incubated in splicing extracts
migrated during native gel electrophoresis as five distinct bands, one
of which contained the U2 snRNP. A, binding of radiolabeled
2'-OMe oligos to yeast WCE factors. WCE with splicing buffer with
either glucose (to deplete endogenous ATP) or water was first incubated
at 23 °C for 5 min. The 32P-labeled 2'-OMe oligos mU2-wt
(lanes 1-8) and mU2-4A (lanes 9-14) and either
ATP (+ATP) or water ( ATP) were then added to
the reactions. The reactions were incubated at 23 °C during which
samples were removed at the indicated times. The samples were
fractionated by electrophoresis in a native, 3.5% polyacrylamide gel.
Radiolabeled bands (arrowheads B1 to
B4) were visualized by autoradiography. Bands 1 and 4 were
not visible in the exposures shown here, but their positions are
indicated. Band 5 (not shown) comigrated with unbound oligo and was
normally run off the gel. B, kinetics of band 2 formation in
the presence and absence of ATP. The amounts of radiolabeled mU2-wt
oligo in band 2 from reactions with and without ATP from four separate
experiments were measured. The mean (± S.D.) at each time is expressed
here as the percent of radiolabel in band 2 at 30 min in the presence
of ATP. Probability (p) that the mean with ATP equaled the
mean without ATP at 30 min was determined by ANOVA. C,
Northern analysis of spliceosomal snRNAs in the native gel in
A. The RNAs in lanes 1-8 of the gel in
A were transferred to a membrane, hybridized sequentially
with radiolabeled probes for U1, U2, U4 (not shown), U5 (not shown),
and U6 snRNAs, and visualized by autoradiography. The bands are
indicated by their snRNA contents. Three bands containing the U1 snRNA
are indicated as forms I-III. The radiolabeled mU2-wt oligo in the gel
was not retained on the membrane during the transfer process so it
cannot be seen here. The positions of bands 2-4 in the original gel
are indicated by the horizontal lines B2, B3, and
B4, respectively.
|
|
To determine which snRNPs, if any, comigrated with the radiolabeled
bands, the RNAs in the native gel with radiolabeled mU2-wt in Fig.
2A were transferred to a membrane. During the transfer process, the radiolabeled oligo was lost as detected by autoradiography of the membrane. The membrane was then incubated sequentially with
radiolabeled spliceosomal snRNA-specific probes (Fig. 2C and
data not shown). Band 2 comigrated with the U2 snRNP which migrated as
a single band. Although the U1 snRNP and U4/U6.U5 tri-snRNP
migrated close to band 2, additional experiments described below
indicated that they did not comigrate with band 2. Bands 3 and 4 did
not comigrate with any snRNP. The low abundance of band 1 prevented
definitive identification of any comigrating snRNP. Finally, there was
no discernible difference in the migration of any snRNP due to the
oligo (data not shown).
The Northern analysis also revealed that the U1 snRNP migrated as three
distinct species. The slowest, form I, comigrated with the U5 snRNP
consistent with previous gel electrophoretic (59), snRNP (60), and
purification assays (61, 62) indicating a complex containing the U1 and
U5 snRNPs. Although this band in Fig. 2 was amorphous, other WCEs gave
more defined bands (see, for example, Fig. 8). Form II contained only
the U1 snRNP and migrated as a sharp band. The fastest, form III,
partly ran with the U4/U6 snRNP. Nonetheless, there was little
similarity between the hybridization patterns of form III U1 and U4/U6
indicating that the U1 and U4/U6 snRNPs did not migrate together as a complex.
An Intact U2 snRNP Was Required for Formation of Band 2--
To
determine whether formation of bands 2, 3, or 4 depended on the U2
snRNP, we tested whether or not they would form when the BpIR of U2
snRNA was first removed by deoxyoligo-targeted RNase H cleavage. The
deoxyoligo SRU2 complementary to the BpIR directs cleavage of U2 snRNA
by RNase H activity present in the extract. Such cleavage destroys the
5' end region of the U2 snRNA and inhibits prespliceosome formation
(38, 58). Similarly, SRU1, a deoxyoligo complementary to the 5' end of
U1 snRNA, specifically directs cleavage of U1 and prevents U1 snRNP
from binding to the pre-mRNA and subsequent spliceosome formation
(38, 59). We found that when U2 snRNA was cleaved, band 2 did not form
with either the 2'-OMe oligo mU2-dC (data not shown) or mU2-wt (Fig. 3A). In contrast, cleavage of
U1 snRNA (Fig. 3A) or the addition of a control deoxyoligo
that does not cleave an snRNA (data not shown) had no effect on band 2 formation. Bands 3 and 4 decreased when any one of the three
deoxyoligos was added (Fig. 3A and data not shown). Thus
band 2 depended specifically on the integrity of the U2 snRNP and
normally contained the mU2 oligos bound to U2. The other two bands
contained factors that could bind to oligos without any apparent
sequence specificity. The low abundance of band 1 precluded its
assessment in these assays.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
An intact U2 snRNP was required for formation
of band 2. A, 2'-OMe mU2-wt oligo binding assay of extract
with cleaved U1 or U2 snRNA. The U1 or U2 snRNA in WCE was first
cleaved by deoxyoligo-mediated RNase H. Either 3.2 µM
SRU1 deoxyoligo complementary to the 5' end of U1 snRNA
(U1, lane 4), 250 nM SRU2 deoxyoligo
complementary to the BpIR of U2 snRNA (U2, lane
2), or water ( , lanes 1 and 3)
was added to WCE. The reactions were incubated in splicing buffer with
0.2 mM ATP at 23 °C for 30 min. ATP to 2 mM
and radiolabeled mU2-wt oligo were then added and the reactions
incubated for another 30 min at 23 °C. The samples were resolved by
native gel electrophoresis and visualized by autoradiography.
Arrowheads B2 and B3 indicate bands 2 and 3;
however, band 3 is not visible in this exposure. B,
comparison of oligo binding and migration of spliceosomal snRNPs in
SRU2-treated and untreated extracts. WCE was incubated with splicing
buffer and either water ( , lane 1) or 100 nM deoxyoligo SRU2 (U2, lane 2) at
23 °C for 30 min. Radiolabeled mU2-wt oligo and additional ATP were
then added and the reactions incubated for another 30 min at 23 °C.
The samples were resolved by native gel electrophoresis and visualized
by autoradiography as shown in the left panel. Arrowheads
B2 and B3 indicate bands 2 and 3, although band 3 is not visible in this exposure. The RNAs in the gel were then assayed
by Northern analysis with radiolabeled probes for U2 and U6 snRNAs and
visualized by autoradiography as shown in the middle and
right panels. The RNA bands are indicated by their snRNA
contents. The radiolabeled mU2-wt oligo in the gel was not retained
during the Northern analysis so it cannot be seen in the two
right panels. C, Northern analysis of U1 and U2 snRNAs extracted
from SRU2-treated and untreated extracts. WCE was incubated with
splicing buffer, 0.2 mM ATP, and either water
( , lane 2) or 100 nM deoxyoligo
SRU2 (U2, lane 3) at 23 °C for 30 min. The
RNAs in the reactions were then extracted, fractionated by denaturing
PAGE, and detected by Northern analysis by simultaneous hybridization
with probes for U1 and U2 snRNAs. Radiolabeled MspI
restriction endonuclease fragments of pBR322 DNA were used as size
markers (M) in lane 1.
|
|
To delineate further the relationship of band 2 with the spliceosomal
snRNPs, we directly compared the migration of band 2 with the migration
of the snRNPs in the SRU2-treated and untreated extracts. Oligo binding
with radiolabeled mU2-wt was first assayed in untreated or SRU2-treated
extracts by native gel electrophoresis (left panel in Fig.
3B). The spliceosomal snRNAs in the same gel were then
detected by Northern analysis (middle and right
panels in Fig. 3B). In the untreated extract, band 2 (as assayed by oligo binding) again comigrated exactly with the U2
snRNP (as assayed by Northern hybridization) but not with the U4/U6.U5
tri-snRNP. No band 2 formed in the treated extract (left
panel), and there was a 50% decrease in the amount of U2 snRNP in
the treated extract (middle panel). No significant
differences in the amount or migration of the other snRNPs were
observed in the treated versus untreated extracts
(right panel of Fig. 3B and data not shown).
To analyze the U2 snRNA in the SRU2-treated extracts, we extracted the
RNAs from treated and untreated extracts, separated them by denaturing
gel electrophoresis, and detected the U1 and U2 snRNAs by Northern blot
analyses. We found a difference in both the size and amount of U2 snRNA
in the treated versus untreated extract (Fig.
3C). All of the detected U2 snRNA in the treated extract was
~100 nts shorter than full-length corresponding to degradation from
the 5' end up to the Sm-binding site (Fig. 1) as shown previously (58)
and confirmed by primer extension assays (data not shown). The amount
of U2 snRNA in the treated extract was 50% that in untreated extract,
a difference similar to that in the native gel. There was no difference
in the amount or size of U1 snRNA from SRU2-treated and untreated extracts.
These results indicate that band 2 formation required an intact 5' end
region of U2 snRNA. As the 5' end region of U2 snRNA contains the BpIR,
the binding of the 2'-OMe oligo to U2 snRNA depended on the region
complementary to the oligo. Previously, most of the SRU2 deoxyoligo at
a concentration of 100 nM was degraded within 30 min in the
extract (58). This amount was sufficient in the experiment in Fig. 3 to
cleave all the U2 snRNA and to abolish mU2-wt oligo binding. Therefore,
it is unlikely that reduction of band 2 by addition of SRU2 to the
reaction was due to competition of SRU2 with mU2-wt for a factor
required for U2 binding. We conclude that band 2 contained the oligo
bound to the U2 snRNP. Although band 2 appeared to be
homogeneous, there could have been more than one type of complex
containing the 2'-OMe oligo bound to U2.
To test further the specificity of the binding of the 2'-OMe oligos to
the U2 snRNP, we designed three mutant 2'-OMe oligos as follows: mU2-4A
with a mutation in the highly conserved fourth position of the UACUAAC
box (UACaAAC); mU2-6C with a mutation in the branch point
nt (UACUAcC); and mU2-4A6C with the double mutation
(UACaAcC) (Fig. 1). These mutations in the
pre-mRNA greatly reduce spliceosome assembly and splicing in
vivo and in vitro (21, 38, 63, 64). In the
oligo-binding assay, however, 2'-OMe oligos with these mutations formed
bands 2 and 3 as efficiently as wild type (Fig. 2A and data
not shown). Due to their relatively weak signals when formed on the
mU2-wt oligo, bands 1 and 4 were not measured. Oligo binding was
further tested by competition experiments in which radiolabeled wild
type (mU2-wt) or mutant (mU2-4A, mU2-6C, or mU2-4A6C) oligo was added
along with 1-50-fold unlabeled, wild type mU2-wt oligo and vice versa
(data not shown). The results of these competition assays again
indicated that the mutant oligos bound U2 as well as the wild type
oligo. Thus these mutations, and the 1-bp difference in complementarity
of the mutant and wild type oligos (15 versus 16 bp), had no
detectable effect on binding.
The lack of an effect of the UACUAAC mutations suggested that the 10 nts flanking the UACUAAC box of the oligo could be contributing to
oligo binding. We therefore tested an additional oligo, mU2-bp, with no
complementarity to U2 in the flanking regions (Fig. 1). This oligo did
not form a band comigrating with mU2-wt band 2 (Fig.
4A) nor compete with mU2-wt
for binding to U2 (Fig. 4B) even at a 1000-fold molar excess
of mU2-wt (data not shown). Oligo mU2-bp formed bands 1 and 3 and two
new bands, x and y. These new bands were not affected by RNase H
degradation of either U1 or U2 (Fig. 4B). Similarly band 1 formation on either mU2-bp or mU2-wt was not affected by RNase H
cleavage of either U1 or U2. We conclude that the flanking sequences
and overall complementarity contributed significantly to the binding of
mU2-wt to U2 snRNP.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 4.
The overall complementarity of
the oligo mU2-wt was important for its binding to the U2 snRNP.
A, binding assays of 2'-OMe oligos mU2-wt and mU2-bp in
extract with cleaved U1 or U2 snRNA. U1 or U2 snRNA in WCE was first
cleaved by deoxyoligo-mediated RNase H. WCE with either water
( , lanes 1 and 2), 3.2 µM SRU1 deoxyoligo complementary to the 5' end of U1
snRNA (U1, lane 3 and 4), or 1 µM SRU2 deoxyoligo complementary to the BpIR of U2 snRNA
(U2, lane 5 and 6) was incubated in
splicing buffer with 0.2 mM ATP at 23 °C for 30 min. ATP
to 2 mM and either radiolabeled mU2-wt or mU2-bp were then
added and the reactions incubated for another 15 min at 23 °C. The
samples were resolved by native gel electrophoresis and visualized by
autoradiography. Arrowheads B1, B2, and
B3 indicate bands 1- 3. Arrowheads x and
y indicate two new bands formed on mU2-bp. To visualize
bands formed on both oligos at once, 2.5-fold more mU2-bp than mU2-wt
was used in this assay. B, competition binding assays with
mU2-wt and mU2-bp oligos. Radiolabeled mU2-wt oligo was mixed without
(lane 1) or with either a 5-, 10-, 20-, or 50-fold molar
excess of unlabeled mU2-wt (lanes 2-5) or mU2-bp
(lanes 6-9), incubated in reactions with added ATP for 30 min at 23 °C, and analyzed as in A.
|
|
In most spliceosome assembly assays, a non-sequence-specific,
competitor polyanion such as total RNA (20, 59) or heparin (21, 65) is
routinely added after the reaction is completed and just before the
sample is loaded onto the gel. Such polyanions test complex stability
and often enhance the resolution of splicing-specific complexes. We
tested the effects of heparin and tRNA on the electrophoretic properties of bound mU2-dC oligo and found that these polyanions affected bands 2 and 3 greatly (data not shown). The more heparin added
to the sample (from 0.01-4 µg of heparin per µl of extract), the
faster band 2 migrated in the gel, the more compact and intense (up to
3-fold) it became, and the less it was enhanced by ATP. Band 3 decreased with increasing amounts of heparin until it was completely
abolished. Band 4 as assayed on either oligo mU2-dC or mU2-wt showed no
difference. Similar effects on bands 2 and 3 were observed when tRNA
(0.05-5 µg per µl of WCE) was added to the samples. However,
because the amounts of heparin and tRNA which sharpened band 2 also
inhibited splicing (Ref. 21 and data not shown), we did not use them in
the assay because they could obscure physiologically relevant effects.
Nonetheless, these data indicate that bands 2 and 4, but not band 3, were stable in the presence of a non-sequence-specific competitor.
Judging by the effects of these polyanions on the migration and amount of band 2, however, we think that there is at least one component of
band 2 that is polyanion-sensitive.
In conclusion, the binding of the wild type 2'-OMe oligos to the U2
snRNP was rapid, stimulated by ATP, and dependent on the integrity of
the U2 snRNP. These are properties similar to prespliceosome formation
on a pre-mRNA substrate. The binding was also sequence-specific; an
oligo complementary to the 5' end of U1 snRNA does not form band
2,2 and the mU2 oligos bound
to the U2 snRNP were stable in the presence of polyanions. However,
unlike pre-mRNA, oligo mU2-wt binding was not affected by mutation
U4A or A6C of the UACUAAC box but instead depended on the overall
complementarity between the oligo and the U2 snRNA. Oligos mU2-dC and
mU2-wt formed three additional bands when incubated in WCE. Neither
band 1, 3, nor 4 depended on the integrity of the U1 or U2 snRNP nor
comigrated with any specific snRNP. Oligo mU2-bp with only the UACUAAC
box complementary to U2 snRNA formed bands 1 and 3 and two unique
bands, x and y, none of which depended on U1 and U2. Additional
experiments will be required to address the identities of bands 1, 3, 4, x, and y to determine whether these bands contain splicing factors.
The prp5-1 Mutation Mapped to the ATP-binding Domain of
Prp5p--
The DEAD box protein, Prp5p, has been shown to have ATPase
activity (26) and to be required for prespliceosome formation (16). It
was likely to be involved in the ATP stimulation of oligo binding to U2
snRNP. Previously, we showed that the Ts prp5-1 mutation
inhibits prespliceosome formation in vitro (16); however, the identity of the prp5-1 mutation was not known. We
therefore cloned the prp5-1 mutant allele by gap repair and
sequenced it (see "Experimental Procedures"). The mutation is a
single base change (G878A of the ORF) which would lead to the
substitution glycine 293 with aspartate (G293D) in the protein. This
substitution is 12 residues upstream of the glycine-lysine-threonine
(GKT) triplet in the highly conserved, nucleotide-binding motif 1 within the putative helicase domain. This motif is important for ATP binding and hydrolysis in other DEXD/H box proteins
(10).
In Vitro Heat Inactivation of prp5-1 Mutant Extract Decreased
mU2-wt Oligo Binding to the U2 snRNP--
To determine whether Prp5p
is required for 2'-OMe oligo binding to the U2 snRNP, we made WCE from
Ts prp5-1 mutant strains grown at the permissive temperature
and inactivated the extracts in vitro by mild heat
treatments. Both the heat-treated and unheated extracts were then
incubated in glucose at 23 °C for 5 min to deplete endogenous
ATP. Finally, the extracts were assayed for splicing
activity (data not shown) and for oligo binding to the U2 snRNP in the
presence and absence of added ATP (Fig.
5). In the active prp5-1
extract, the binding of mU2-wt oligo to U2 snRNP in the presence of
added ATP was about 2-fold that observed in reactions depleted of ATP
(Fig. 5, A and B). Heat inactivation of this
extract had two effects as follows: it reduced mU2-wt binding to about
one-third that in the active extract; and it eliminated stimulation by
added ATP. Heat inactivation of prp5-1 mutant extracts
prepared from different strains, one with a different genetic
background (strains RL172) and the other of similar background (SRY5-1c) gave similar results (data not shown). In contrast, heating
of a wild type extract (Fig. 5, A and B) had no
effect on oligo binding except to deplete effectively the extract of ATP. Due to variation in endogenous ATP levels among extract
preparations, the conditions sufficient to deplete the heat-treated and
unheated prp5-1 WCE of ATP were not sufficient to deplete
the unheated wild type WCE shown in Fig. 5A. Longer
incubation times in glucose at 23 °C did, however, show that this
unheated wild type WCE could be depleted of ATP and that added ATP
would then stimulate oligo binding (data not shown). As another control
for the heat treatments, we found that heat inactivation of the mutant
prp2-1 protein, which blocks a later step in the splicing
pathway (66), also did not affect oligo binding (data not shown). These
results suggested that the reduced oligo binding in the heated
prp5-1 mutant extracts was due to inactivation of mutant
prp5-1p. However, the reduction in oligo binding could have occurred
indirectly if loss of Prp5 activity rendered U2 snRNP more sensitive to
nuclease activity in the extract, thereby reducing the levels of U2
snRNA.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 5.
2'-OMe oligo binding assays of heat-treated
prp5-1 and wild type extracts. A, radiolabeled
mU2-wt oligo binding in active and heat-treated prp5-1
mutant and wild type extracts. Half of each active WCE from
prp5-1 and wild type yeast strains was heated at 38 °C
for 10 min in vitro. Splicing buffer with either glucose (to
deplete ATP) or water was then added to untreated (lanes
1-6) and heat-treated (lanes 7-12) WCE and incubated
at 23 °C for 5 min. Radiolabeled mU2-wt oligo and either ATP
(+ATP; lanes 1-3 and 7-9) or water
( ATP; lanes 4-6 and 10-12) were
then added and the reactions incubated at 23 °C for 10 and 30 min.
Following native gel electrophoresis, the bound oligo was visualized by
autoradiography. Arrowheads B2 and B3
indicate bands 2 and 3. No ATP stimulation was observed in the
unheated, wild type WCE because the 5-min incubation in glucose at
23 °C was not sufficient for complete ATP depletion for the
particular batch of wild type WCE used in this experiment. Longer
incubations of the unheated WCE at 23 °C did achieve depletion so
that subsequent ATP stimulation was observed (not shown). Heating of
this WCE at 38 °C (as shown) stimulated ATP depletion. B,
kinetics of radiolabeled mU2-wt oligo binding in active and
heat-treated extracts. The amounts of radiolabeled mU2-wt oligo in band
2 from reactions with heat-treated and untreated prp5-1 and
wild type WCE, with and without added ATP, were measured in the gels as
in A. The mean (±S.D.) amounts of band 2 at each time is
expressed here as the percent of radiolabel in band 2 at 30 min in each
active extract with added ATP. Probabilities that the mean amounts of
band 2 in the heated extract equaled that in untreated extract were
calculated by ANOVA from 4 (prp5-1) and 2 (wild type)
independent assays. Only the results for the statistical analyses of
the 30-min values are given here. Both reactions containing the heated
prp5-1 extract with and without added ATP were different
from those with the active extract with added ATP (p < 0.05) and without added ATP (p < 0.02). The heated
wild type extract without added ATP was different (p < 0.05) from the other wild type reactions. C, direct
comparison of the levels of radiolabeled oligo bound to U2 snRNP with
the levels of U2 snRNA in prp5-1 mutant extract. Active
(5, lanes 1 and 2) and heated
(5 , lane 3) mutant prp5-1 WCEs were
first assayed for binding of radiolabeled mU2-wt oligo in the presence
of added ATP as in A for 30 min at 23 °C. After native
gel electrophoresis, the bound oligo was visualized by autoradiography
(left panel, oligo binding); arrowheads
B2 and B3 designate bands 2 and 3. The U2 RNA in
the gel was then measured by Northern analysis (right
panel, Northern).
|
|
To investigate whether or not the reduced binding was due to U2 snRNA
degradation, we directly compared the amounts of oligo bound with the
amounts of U2 snRNA in inactivated and active prp5-1 extracts with added ATP. Oligo binding was first measured with radiolabeled mU2-wt oligo (left panel in Fig.
5C). The snRNAs in the same gel were then assayed by
Northern hybridization (middle and right panels
in Fig. 5C). Band 2 levels in inactivated prp5-1 extract averaged 35% in 3 independent determinations (± 9.5%, S.D.)
and were significantly less (p < 0.01 by Student's
t test) than levels in active extract. In contrast, U2 snRNA
levels in the inactivated extract (85 ± 10%) were not
significantly different from that (100%) in active extract. The other
snRNAs also did not detectably change (right panel in Fig.
5C and data not shown). Similar analyses of treated and
untreated prp2-1 and wild type extracts showed no
significant reductions in the amounts of U2 snRNA (data not shown).
Thus, the reduction in oligo binding in the heat-inactivated
prp5-1 extract was due to inactivation of mutant prp5-1p and
not due to a reduction in the amount of U2 snRNA. We conclude that
Prp5p was required for mU2-wt binding to the U2 snRNP and the ATP
enhancement of binding.
Prp5p Physically Associated with the U2 snRNP in the Presence or
Absence of the Oligo or ATP--
Results from this and previous
studies (16, 25, 26, 29) suggest that Prp5p physically associates with
the U2 snRNP. To test this, we constructed a gene encoding a GST-Prp5p
fusion and replaced the wild type, essential PRP5 gene with
this construct in yeast cells by plasmid shuffling (47). The GST-Prp5p
fusion was expressed and functional in yeast cells (Fig.
6A). We noted, however, that
the cells were also viable but grew slowly when the PRP5 ORF
was fused out-of-frame to GST. Although little or no full-length
GST-PRP5 fusion protein was detected in this strain (Fig.
8A), apparently enough Prp5p was produced for viability. Certain rare translational events noted for other yeast ORFS (67, 68)
could account for this production of Prp5p.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
Prp5p physically associated with the U2
snRNP. A, Western analysis of WCE with and without the
GST-Prp5 fusion protein. WCEs active for pre-mRNA splicing were
made from yeast strains with the in-frame, productive GST-Prp5p fusion
(lanes 1 and 2), the out-of-frame GST-Prp5p
fusion (lane 3), or wild type Prp5p (lane 4).
Proteins in WCE were detected by Western analysis by probing
sequentially with anti-GST monoclonal and anti-Bcy1 polyclonal
antibodies. GST-Prp5p and the control, Bcy1p (88) (a non-spliceosomal
protein), were visualized by chemiluminescence and autoradiography. The
following amounts of total WCE protein were analyzed: 126 µg,
lane 1; 42 µg, lane 2; 126 µg, lane
3; and 126 µg, lane 4. Protein standards are
indicated on the left. B, coselection of U2 snRNP with
GST-Prp5p. The WCEs in A with wild type (lanes 1-4) and
GST-Prp5p (lanes 5-8) were incubated on ice or at 23 °C
for 15 min under splicing conditions with or without added ATP but
without radiolabeled pre-mRNA. The reactions were then incubated on
ice with glutathione-Sepharose to select for GST-Prp5p. RNAs extracted
from the selected materials (lanes 1-8), from total wild
type WCE (T, lane 9), as well as no RNA
(no, lane 10) were assayed by primer extension
analysis with radiolabeled spliceosomal snRNA-specific probes. The
extension products were separated by denaturing PAGE and visualized by
autoradiography. Radiolabeled MspI restriction endonuclease
fragments of pBR322 DNA were used as size markers (M). About
one-quarter of the equivalent amount of total WCE used in the GST
selections was used in the reaction in lane 9.
|
|
In vitro affinity selections of the GST-Prp5p fusion protein
were conducted to determine whether Prp5p associated with the U2 snRNP.
Splicing reactions with or without added ATP and with extracts
containing wild type Prp5p or GST-Prp5p but without exogenously added
pre-mRNA or oligo were incubated at 0 or 23 °C. The reactions were then incubated on ice with glutathione-Sepharose to select for
GST-Prp5p. The coselected RNAs were extracted and analyzed by primer
extension assays using spliceosomal snRNA-specific probes. We found
that U2 snRNA, but not the other spliceosomal snRNAs, coselected with
GST-Prp5p (Fig. 6B). This enrichment was independent of ATP
as there was no difference between ATP-depleted and ATP-containing extracts. We conclude that Prp5p physically associated with the U2
snRNP in the absence or presence of ATP or pre-mRNA.
To determine whether Prp5p associated with the mU2-wt oligo, we
repeated the GST-Prp5p selection experiments but monitored the
radiolabeled oligo added to reactions. The oligo was enriched in the
selected material from the in-frame extract as compared with either the
out-of-frame extract (Fig. 7A)
or to an extract with wild type Prp5p (data not shown). The association
was also usually enhanced about 2-fold by added ATP, similar to the ATP stimulation in the oligo binding assays. To test whether the
association of the oligo with Prp5p depended on U2, we assayed
reactions in which the U2 snRNP was first cleaved by
deoxyoligo-directed RNase H. Ablation of U2 abolished association of
mU2-wt oligo with Prp5p (Fig. 7B). Thus, most of association
of Prp5p with the oligo required a functional U2 snRNP and was probably
indirectly mediated via the U2 snRNP. These data also suggest that
Prp5p is not directly binding to the UACUAAC box of the
pre-mRNA.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 7.
Coselection of the mU2-wt oligo and U2 snRNP
with GST-Prp5p. A, the active WCEs analyzed in Fig.
6A from the strains with the in-frame (lanes
5-10) and out-of frame GST-Prp5p (lanes 1-4) fusions
were incubated at 23 °C in splicing buffer either with (lanes
3 and 4, and 8-10) or without added ATP
(lanes 1 and 2, and 5-7) and with
radiolabeled mU2-wt oligo for the times indicated. The quenched samples
were then incubated at 0 °C with glutathione-Sepharose. Any
radiolabeled mU2-wt oligo in selected materials was then extracted,
fractionated by denaturing gel electrophoresis, and visualized by
autoradiography. B, RNase H degradation of the U2 snRNA
greatly reduced the coselection of mU2-wt and GST-Prp5p. Active WCE
made from the strains with the in-frame (lanes 5-8) and
out-of-frame GST-Prp5p (lanes 1-4) fusions were first
incubated at 23 °C in splicing buffer with ATP and with either water
(lanes 1, 2, 5, and 6) or
250 nM deoxyoligo SRU2 (lanes 3, 4,
7, and 8) to cleave U2 snRNA with RNase H. Radiolabeled mU2-wt oligo and additional ATP were then added, and the
reactions were incubated at 23 °C for the indicated times. The
samples were then processed as in A.
|
|
The Conformation of U2 snRNP Was Important for mU2-wt Oligo
Binding--
Prp5p has been implicated in a conformational switch of
two phylogenetically conserved U2 RNA structures because
prp5-1 is synthetically lethal with the cold-sensitive (Cs)
C62U mutation in U2 snRNA (16, 29). In vivo, C62U arrests
mitotic cell growth at temperatures below 25 °C and shifts the
equilibrium between two structures causing the bulk of U2 snRNA to
assume the conserved complementary stem (CCS) at the expense of
stem-loop IIA (Fig. 1) at both permissive and non-permissive
temperatures (27, 28). In vitro, C62U mutant extracts have
reduced rates of splicing and prespliceosome formation with increasing
reductions occurring with increasingly low temperatures (from 25 to
12 °C) (28).
To investigate the role of U2 RNA structure on oligo binding, we
assayed the effect of the C62U mutation on 2'-OMe oligo binding. Active
splicing extracts were prepared from the previously characterized, isogenic wild type and Cs mutant strains (27, 28) grown at the
permissive temperature and tested for splicing and mU2-wt binding at 23 and 15 °C in vitro (Fig.
8). We found that the C62U mutant extract
had significantly reduced splicing (data not shown) and oligo binding
to U2 snRNP (Fig. 8A) at 15 °C compared with 23 °C. In
contrast, the wild type extract was nearly equally active for oligo
binding and splicing at both temperatures (Fig. 8A). There
were also two differences in the mutant band 2 compared with wild type.
The mutant band 2 migrated noticeably slower than the wild type at
either 23 or 15 °C. The amount of mutant band 2 was also somewhat
lower than wild type at 23 °C, consistent with the slightly lower
rate of splicing in the mutant extract versus the wild type
extract at 23 °C as noted previously (28). However, the differences
in band 2 migration and amounts seen here might be due to either the
conformation or the amount of mutant U2 snRNP.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 8.
The mutant C62U U2 snRNP bound less 2'-OMe
oligo than the wild type at the non-permissive temperature.
A, 2'-OMe oligo mU2-wt binding in wild type and C62U mutant
extracts. WCEs active for splicing were prepared from isogenic wild
type and C62U mutant strains grown at the permissive temperature. The
WCEs were incubated with radiolabeled oligo mU2-wt and splicing buffer
with added ATP at either 23 (lanes 1-6) or 15 °C
(lanes 7-12) for the indicated times (min). The reactions
were fractionated by native gel electrophoresis and visualized by
autoradiography. Arrowheads B2 and B3
designate bands 2 and 3. B, kinetics of radiolabeled mU2-wt
binding to wild type and C62U mutant snRNPs. The amounts of
radiolabeled mU2-wt oligo in band 2 from wild type and C62U mutant WCEs
were measured in four independent assays as in A. The mean
(± S.D.) amount of band 2 at each time is expressed here as the
percent of band 2 at 30 min in the presence of added ATP for each
extract type. Probability (p) that the means at the two
temperatures were equal for each extract type was determined by ANOVA.
C, Northern analysis of spliceosomal snRNPs in wild type and
C62U mutant extracts. A mock binding assay had water instead of oligo
added to the reactions as in A. The mock reactions were
separated by native gel electrophoresis after which the RNAs in the gel
were detected by Northern analysis with radiolabeled probes specific
for the U1, U2, U4/U6, and U5 snRNAs. The bands are designated by their
snRNA content.
|
|
To test whether the reduced amount and migration of band 2 in the
mutant extract was caused by the Cs U2 mutation and not by differences
in the amount of mutant U2 snRNP or variability inherent in the assay,
we assayed the wild type and mutant U2 snRNPs directly in a mock
binding assay in which water was substituted for the oligo. The RNAs in
the native gel of the mock assay were assayed by Northern analysis
(Fig. 8C). There were three observations from this
experiment. First, the bulk of mutant C62U U2 snRNP migrated more
slowly during electrophoresis compared with the wild type at either
temperature (left panel in Fig. 8C). Such a shift
is indicative of a difference in U2 conformation be it a loss or gain
of protein or a difference in RNA structure. Second, there was no
decrease in the total amounts of mutant U2 snRNA in the reactions
incubated at 15 °C compared with 23 °C. Third, there was a lower
concentration of U2 snRNA in the mutant WCE compared with wild type
WCE. As no reductions in U2 levels were previously observed in the C62U
mutant in vivo (28), and all the spliceosomal snRNAs were
lower in the mutant WCE prepared in this study (Fig. 8C),
this lower mutant U2 concentration was introduced during extract
preparation. As this lower concentration contributed to the lower
amounts of mutant band 2 formed at 23 °C, we could not assess any
differences contributed by conformation at 23 °C. Nevertheless, we
could conclude that the reduction in oligo binding at 15 °C compared
with that at 23 °C in the mutant extract was caused by the C62U
mutation. Thus, the wild type U2 snRNP, which is predominantly in the
stem-loop IIA conformation and more active for prespliceosome formation
and splicing, bound the oligo more efficiently than the C62U mutant U2
which is mostly in the CCS form.
Probing for the other spliceosomal snRNAs in this experiment revealed
three other differences between the mutant and wild type WCE, all of
which involve the U1 snRNP. First, there was a large reduction in form
II of the U1 snRNP (Fig. 8C), and this form migrated more
slowly in mutant versus wild type extract at both 15 and
23 °C. Second, both the mutant and wild type extracts accumulated
form I (containing U1 and U5) at 23 °C, whereas only the wild type
accumulated this band at 15 °C. Third, a form of U1 snRNP migrating
between forms I and II was reduced in the mutant extract compared with
wild type. This form may be the same as form III in other extracts
(Fig. 2C) as it migrated with the same diffuse pattern, and
we have noted variable migration of this form among different extracts.
Although we do not understand the basis for these effects of the C62U
mutation on the U1 snRNP, they do suggest an interaction between the U1
and U2 snRNPs.
 |
DISCUSSION |
Binding of pre-mRNA to the yeast U2 snRNP during
prespliceosome formation requires ATP hydrolysis, the branch point
region of the pre-mRNA including the highly conserved UACUAAC box,
and several factors (1). Here we used a 17-nucleotide, 2'-OMe oligo encoding the UACUAAC box as a model in vitro assay for the
binding of pre-mRNA to U2 in splicing extracts. The binding of
2'-OMe oligo to U2 was rapid, enhanced by ATP, and dependent on the
integrity and conformation of the U2 snRNP. Thus, the binding of the
2'-OMe oligos to U2 snRNP relates in several aspects to prespliceosome formation on a pre-mRNA substrate. But as discussed below, we think
that rather than exactly mimicking a pre-mRNA, 2'-OMe oligo binding
is an indicator of the accessibility of U2 for pairing with
pre-mRNA. Nonetheless, using this assay we have found that Prp5p
activity was required for efficient binding of the oligo to the U2
snRNP. The prp5-1 mutation, which inhibited oligo binding, mapped to motif I, which constitutes part of the ATP binding and hydrolysis domain of the protein. Furthermore, Prp5p physically associated with the U2 snRNP in vitro. Our data indicate
that the target of Prp5p is the U2 snRNP and suggest that the
catalytic, ATPase activity of Prp5p is required to alter U2 snRNP conformation.
2'-OMe Oligo Binding as a Probe for U2 snRNP
Conformation--
Here we have shown that binding of the 2'-OMe oligo
mU2-wt to form band 2 is specific to the U2 snRNA in three ways. The
bound oligo comigrated with the U2 snRNP in band 2 but not with the other spliceosomal snRNPs. Deoxyoligo-mediated RNase H cleavage of U2
RNA in the region that base pairs with the UACUAAC box abolished binding. Finally, reducing the number of possible base pairs between the oligo and U2 RNA from 16 to 6, as in the mU2-bp oligo, eliminated oligo binding. The inability of the mU2-bp oligo to form band 2 was
somewhat surprising as this oligo still had an intact UACUAAC box but
was nonetheless consistent with the binding of the mutant oligos mU2-4A
and mU2-4A6C. These oligos had mutations in the UACUAAC box, but they
would still form 15 bp with U2, and they bound as well as the wild type
mU2-wt oligo. The same mutations in pre-mRNAs reduce spliceosome
assembly by about 75% (21, 38, 69), but most pre-mRNAs usually
have only the UACUAAC box and one or two flanking nts complementary to
U2 RNA (70). Our data indicate that the UACUAAC box of an oligo was
less important than its overall complementarity to U2, yet the small
oligos can probe the accessibility of U2's BpIR for pairing with a
UACUAAC box.
That the binding of the 2'-OMe oligo to U2 snRNP depends on the
conformation of U2 is supported by the finding that the Cs C62U mutant
form of U2 snRNP bound less oligo at 15 than at 23 °C. This finding
directly correlates with previous results (28) that the mutant U2
formed the prespliceosome at a reduced rate at 15 °C. Furthermore,
chemical probing showed previously (28) that most of the C62U mutant U2
is in the alternative RNA conformation, CCS, in vivo,
consistent with the observation here that the bulk of the mutant U2
snRNP in WCE migrated more slowly than the wild type snRNP during
native gel electrophoresis. Therefore, oligo binding is also indicative
of the functional state of the U2 snRNP. This finding further
underscores our assertion that oligo binding assays the accessibility
of the U2 snRNP for pairing with the UACUAAC box. Additionally, we
found that polyanions caused increased binding of a 2'-OMe oligo in the
wild type U2 snRNP as well as increased mobility of the wild type snRNP
during electrophoresis. These data suggest that there is protein, or a
structure stabilized by protein, which normally occludes U2's BpIR.
This protein may be removed by heparin or a competitor RNA or, as
discussed below, by the action of Prp5p.
Our design of oligo mU2-wt was based in part on the sequence of a
25-nucleotide 2'-OMe oligo "b" found previously by Lamond et
al. (36) to bind to the BpIR of the U2 in HeLa cell extracts. Although the two oligos bound similarly to U2, binding is stimulated by
ATP more for oligo b than for mU2-wt. One possible explanation for this
difference may lie in the sequences flanking UACUAAC. Oligo b could
form 12, 5'-flanking bp extending into stem-loop IIA of U2, whereas
oligo mU2-wt would form only 4 such base pairs. Two recent studies (71,
72) showed that nts 5' to the UACUAAC box confer ATP dependence to the
binding of 2'-hydroxy (ribo-) oligos to U2 in HeLa extracts. Binding of
an ~35-nt ribo-oligo was stimulated by ATP when the oligo had 6 or
more upstream nts with 6 being the minimum number tested (72). Binding
became strongly ATP-dependent when there were 18 or more
upstream nts in either the ribo or deoxy form. Unlike oligos b and
mU2-wt, however, the upstream region was not complementary to U2 snRNA and, in fact, could even be abasic. Furthermore, the ribo-oligos had a
degenerate UACUAAC box sequence typical of mammalian pre-mRNAs as
well as a polypyrimidine tract. We found that the level and ATP
stimulation of mU2-dC binding equaled those of mU2-wt even though
mU2-dC has five additional, noncomplementary 5' nts compared with
mU2-wt. This suggests that the 5'-flanking sequences in the yeast
system are not as important as in the mammalian one, but their role in
the ATP effect in the yeast system needs further analysis.
Binding of the mU2-wt oligo did not depend on a functional U1 snRNP as
ablation of the 5' end of U1 snRNA, which prevents U1 snRNP binding to
the pre-mRNA and subsequent prespliceosome formation (59, 73), did
not affect mU2-wt oligo binding. This findings as well as the lack of
effect by UACUAAC box mutations on oligo binding indicates that
prespliceosome formation on a pre-mRNA substrate requires more
factors than does mU2-wt binding to U2. Two factors expected to be
affected by UACUAAC mutations are the Bbp and Mud2 proteins. These
proteins bind to the UACUAAC box and polypyrimidine tract of the
pre-mRNA, respectively (17, 18, 74, 75). Binding of purified,
recombinant Bbp to a small RNA is reduced from 20- to 100-fold (75) by
the UACUAAC box mutations U4A and A6C, yet these same mutations had no
effect on mU2-4A and mU2-6C oligo binding to U2 in cell extracts (Fig. 2). However, depletion of Bbp from either yeast (18) or human (76) cell
extracts also has only mild effects on the kinetics of prespliceosome
and spliceosome formation. Finally, the overall complementarity of the
oligos such as mU2-4A, and the presence in WCE of Mud2p which binds
cooperatively with Bbp (17), may override the effects of UACUAAC
mutations on Bbp binding.
Prp5p Functions to Alter the U2 snRNP--
The 2'-OMe oligo
binding assay was also used to study Prp5p function. Previously we
showed that heat inactivation of prp5-1 mutant extract
in vitro inhibits prespliceosome formation (16). Here heat
inactivation of this mutant extract resulted in two changes. It reduced
oligo binding to about one-third that of active extract, and it removed
the ATP enhancement. Thus Prp5p is required for efficient mU2-wt
binding to U2 snRNP and for ATP stimulation of this binding. However,
the possibility that inactivation of the prp5-1 mutant
protein reduced activity of another ATPase or ATP-binding protein
cannot be ruled out. Nonetheless, in a similar study, complementing
inactivated prp5-1 mutant extract with recombinant, purified
Prp5p, restored ATP-stimulated, deoxyoligo RNase H degradation of U2
(25).
Although we have not shown here whether the stimulation by ATP is due
to its binding or hydrolysis, the nature of the prp5-1 mutation suggests that the catalytic, ATPase activity of Prp5p is
required for the stimulation. The mutation is predicted here to result
in a Gly-293 Asp substitution in motif I. Genetic (77, 78) and
structural (79-81) studies of superfamily two (SF2) helicases similar
to Prp5p indicate that motif I is important in ATP binding and
hydrolysis. The Gly-293 residue of Prp5p is predicted to be in a
similar position in the three-dimensional SF2 helicase structure as
tyrosine 386 in Prp16p, another spliceosomal DEAD-box protein (82).
Substitution of this tyrosine with aspartate in Prp16p decreases the
rate of ATP hydrolysis (83), so it is likely that the prp5-1
mutation alters ATP hydrolysis.
This study has also shown that Prp5p physically associates with the U2
snRNP in the absence of pre-mRNA or 2'-OMe oligo. This association
is phylogenetically conserved as the recent
purification3 and
analysis4 of the human Prp5
protein also find Prp5p to be a U2 snRNP component. Furthermore, the
ATPase activity of the Prp5p is stimulated by U2 snRNA (26). The
combined results of our study and previous studies (16, 25, 26,
29) support the conclusion that Prp5p catalyzes a conformational change
in the U2 snRNP which makes the BpIR of the U2 snRNP more accessible
for pairing with the pre-mRNA during prespliceosome formation.
What is the target of the catalytic activity of Prp5p within the U2
snRNP? It is tempting to think that Prp5p acts as an RNPase to remove
Cus2p because removal of Cus2p by genetic deletion allows formation of
a functional prespliceosome in the absence of ATP (84). However, this
formation occurs at a reduced rate that can still be stimulated by ATP.
Furthermore, it also still requires some function of Prp5p as
inactivating prp5-1p in an extract without Cus2p prevents
prespliceosome formation (84). Something else is being acted upon in an
ATP- and Prp5p-dependent manner in the absence of Cus2p. If
Prp5p is the catalyst, then it is acting on a target not completely
abrogated by the loss of Cus2p. This target may be the U2 snRNA itself,
another protein, or both U2 RNA and protein.
There are several proteins that are part of the U2 snRNP or required
for prespliceosome formation which could be targets. Prp9p, an SF3
subunit, has been suggested previously (25) to be the target of Prp5p
because SRU2 deoxyoligo-targeted degradation is stimulated by
inactivation of the prp9 mutant protein. Indeed, any one of the
several yeast SF3 subunits in addition to Prp9p is a likely target
because of the genetic interactions of SF3 with Prp5p (16, 29, 33, 35,
85). Biochemical data also suggest that SF3 could be the target; the
BpIR in purified human U2 snRNP is accessible to micrococcal nuclease
in the absence but not the presence of SF3 (34). Two other proteins,
Bbp and Mud2p, are released from the pre-mRNA during prespliceosome
formation (18); however, this removal is likely catalyzed by another
DEAD-box helicase, Sub2p (13). Interestingly the essential requirement for Sub2p in vivo can be bypassed by deleting
MUD2, yet ATP is still required for prespliceosome formation
in sub2 mud2 deletion mutant extracts (13). This suggests
that the ATPase activity of the Prp5p is necessary for prespliceosome
formation in the absence of Sub2p and Mud2p and is consistent with our
observation that most ATP stimulation in oligo binding was removed
during inactivation of prp5-1p.
One of three U2 snRNA structures is also a likely Prp5p target. Because
the prp5-1 mutation is synthetically lethal with a specific
subset of U2 mutations that alter stem-loop IIA (16, 29), a popular
hypothesis is that Prp5p switches the two mutually exclusive,
phylogenetically conserved conformations, stem-loop IIA and the
competing CCS (Fig. 1). One such U2 mutation, C62U, causes the bulk of
U2 RNA to assume the CCS form and, at low temperatures, imposes a
rate-limiting step in prespliceosome formation (28). As shown here, it
also reduces oligo binding at low temperatures. A simple explanation of
these genetic and biochemical data is that normally Prp5p converts CCS
to stem-loop IIA to activate the U2 snRNP for prespliceosome formation.
As the C62U mutation destabilizes form IIA rather than hyperstabilizes
CCS (28), the synthetic lethality of C62U with prp5-1 would
be due to an excess of CCS exacerbating the putative lowered activity
of mutant prp5-1p. An alternative explanation for the synthetic
lethality is that C62U indirectly affects Prp5p activity because it
directly alters interactions of SF3, Cus2p, or both with U2 RNA. In
support of this idea, SF3b, a multimeric component of SF3, binds to the 5' region of the human U2 (34), and yeast SF3b interacts genetically with Prp5p (33, 86). Additionally, some cus2 mutations
suppress C62U by binding to an RNA (most likely U2), prevent
accumulation of CCS, and interact genetically with mutations in SF3b or
Prp5p (35). A third alternative, but not mutually exclusive,
explanation for the synthetic lethality may lie in an interaction
between the U1 and U2 snRNPs as the U2 C62U mutation also affects the migration and form of the U1 snRNP (Fig. 8C). This effect on
U1 is probably protein-mediated as no direct contacts between the U1
and U2 RNAs have been detected in several studies (2), but a complex
containing the U1 and U2 snRNPs in the absence of pre-mRNA has been
observed (87).
The third possible RNA target for Prp5p as previously suggested (25) is
a stem formed by the pairing of phylogenetically invariant nts 25-30
with nts 42-47 flanking either side of the BpIR of U2 (Fig. 1) (30).
This possibility is supported by synthetic lethal interactions between
mutations in some of these flanking nts and PRP5 (30). It is
attractive because the unwinding of this stem in the prespliceosome
would also free some of the U2 nts for subsequent pairing with U6. Some
of these U2-U6 pairings are essential for eventual splicing catalysis
(2). The use of the oligo binding assay should further delineate the
target of the Prp5p within the U2 snRNP and the relationship of Prp5 with Cus2p, SF3, and U2 RNA structure.
 |
ACKNOWLEDGEMENTS |
We thank the following for
strains, antibodies, oligos, or plasmids: J. Abelson, M. Ares, J. Beggs, P. Fabrizio, L. Krinke, G. McFarland-Dalbadie, D. McPheeters, C. O'Day, M. Werner-Washburne, D. Wiest, and J. Woolford. We are grateful
to R. Luhrmann, C. Newham, and C. Query for communicating results prior
to publication; to M. Ares, M. Osley, D. Peabody, B. Schwer, and J. Summers for comments on the manuscript; to G. Brock for advice on
statistics; to the University of New Mexico Center for Genetics in
Medicine for sequencing some of the plasmids and synthesizing some of
the deoxyoligos; and to the CalTech microchemical facility for
synthesizing the 2'-OMe oligos mU2-dC and mAct-exon2.
 |
FOOTNOTES |
*
This work was supported by National Science Foundation Grant
MCB9709915 and by grants from the Dedicated Health Research Funds Committee of the University of New Mexico Health Sciences Center.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Current address: Brown University, Division of Medicine Box G-8005,
Providence, RI 02912.
¶
To whom correspondence should be addressed: Dept. of Molecular
Genetics and Microbiology, University of New Mexico Health Sciences
Center, 900 Camino de Salud, NE, Albuquerque, NM 87131. Tel.:
505-272-5830; Fax: 505-272-8199; E-mail: sruby@unm.edu.
Published, JBC Papers in Press, April 1, 2002, DOI 10.1074/jbc.M109553200
2
T. Quan and S. Ruby, unpublished results.
3
R. Luhrmann, personal communication.
4
C. Query, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
snRNP, small nuclear
ribonucleoprotein;
2'-OMe oligo. 2'O-methyl oligonucleotide, ANOVA, analysis of variance;
BpIR, branch point interaction region;
Cs, cold-sensitive;
CCS, conserved complementary stem in U2 RNA;
dC, deoxycytidine;
DTT, dithiothreitol;
GST, glutathione
S-transferase;
oligo, oligonucleotide;
ORF, open reading
frame;
PEG, polyethylene glycol;
snRNA, small nuclear RNA;
Ts, temperature-sensitive;
WCE, yeast whole cell splicing extract;
nt, nucleotide.
 |
REFERENCES |
| 1.
|
Kramer, A.
(1996)
Annu. Rev. Biochem.
65,
367-409[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Burge, C. B.,
Tuschi, R. H.,
and Sharp, P. A.
(1999)
in
The RNA World
(Gestland, R. F.
, Cech, T.
, and Atkins, J. F., eds)
, pp. 525-560, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 3.
|
Madhani, H. D.,
and Guthrie, C.
(1994)
Annu. Rev. Genet.
28,
1-26[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Ares, M.,
and Weiser, B.
(1995)
Prog. Nucleic Acids Res. Mol. Biol.
50,
131-159[Medline]
[Order article via Infotrieve]
|
| 5.
|
Nilsen, T. W.
(1998)
in
RNA Structure and Function
(Simons, R.
, and Grunberg-Manago, M., eds)
, pp. 279-307, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 6.
|
Staley, J. P.,
and Guthrie, C.
(1998)
Cell
92,
315-326[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Gorbalenya, A. E.,
and Koonin, E. V.
(1993)
Curr. Opin. Struct. Biol.
3,
419-429[CrossRef]
|
| 8.
|
Luking, A.,
Stahl, U.,
and Schmidt, U.
(1998)
Crit. Rev. Biochem. Mol. Biol.
33,
259-296[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Pause, A.,
and Sonenberg, N.
(1992)
EMBO J.
11,
2643-2654[Medline]
[Order article via Infotrieve]
|
| 10.
|
de la Cuz, J.,
Kressler, D.,
and Linder, P.
(1999)
Trends Biochem. Sci.
24,
192-198[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Schwer, B.
(2001)
Nat. Struct. Biol.
8,
113-116[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Will, C. L.,
and Luhrmann, R.
(2001)
Science
291,
1916-1917[Free Full Text]
|
| 13.
|
Kistler, A. L.,
and Guthrie, C.
(2001)
Genes Dev.
15,
42-49[Abstract/Free Full Text]
|
| 14.
|
Libri, D.,
Graziani, N.,
Saguez, C.,
and Boulay, J.
(2001)
Genes Dev.
15,
36-41[Abstract/Free Full Text]
|
| 15.
|
Zhang, M.,
and Green, M. R.
(2001)
Genes Dev.
15,
30-35[Abstract/Free Full Text]
|
| 16.
|
Ruby, S. W.,
Chang, T. H.,
and Abelson, J.
(1993)
Genes Dev.
7,
1909-1925[Abstract/Free Full Text]
|
| 17.
|
Berglund, N.,
Colot, H.,
and Rosbash, M.
(1998)
Genes Dev.
12,
858-867[Abstract/Free Full Text]
|
| 18.
|
Rutz, B.,
and Seraphin, B.
(1999)
RNA (New York)
5,
819-831
|
| 19.
|
Liao, X. C.,
Colot, H. V.,
Wang, Y.,
and Rosbash, M.
(1992)
Nucleic Acids Res.
20,
4237-4245[Abstract/Free Full Text]
|
| 20.
|
Pikielny, C. W.,
Rymond, B. C.,
and Rosbash, M.
(1986)
Nature
324,
341-345[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Cheng, S.-C.,
and Abelson, J.
(1987)
Genes Dev.
1,
1014-1027[Abstract/Free Full Text]
|
| 22.
|
Parker, R.,
Siliciano, P. G.,
and Guthrie, C.
(1987)
Cell
49,
229-239[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Query, C. C.,
Moore, M. J.,
and Sharp, P. A.
(1994)
Genes Dev.
8,
587-597[Abstract/Free Full Text]
|
| 24.
|
Fleckner, J.,
Zhang, M.,
Valcarcel, J.,
and Green, M. R.
(1997)
Genes Dev.
11,
1864-1872[Abstract/Free Full Text]
|
| 25.
|
Wiest, D.,
O'Day, C.,
and Abelson, J.
(1996)
J. Biol. Chem.
271,
33268-33276[Abstract/Free Full Text]
|
| 26.
|
O'Day, C.,
Dalbadie-McFarland, G.,
and Abelson, J.
(1996)
J. Biol. Chem.
271,
33261-33267[Abstract/Free Full Text]
|
| 27.
|
Zavanelli, M. I.,
and Ares, M.
(1991)
Genes Dev.
5,
2521-2533[Abstract/Free Full Text]
|
| 28.
|
Zavanelli, M. I.,
Britton, J. S.,
Igel, A. H.,
and Ares, M., Jr.
(1994)
Mol. Cell. Biol.
14,
1689-1697[Abstract/Free Full Text]
|
| 29.
|
Wells, S. E.,
and Ares, M., Jr.
(1994)
Mol. Cell. Biol.
14,
6337-6349[Abstract/Free Full Text]
|
| 30.
|
Yan, D.,
and Ares, M. J.
(1996)
Mol. Cell. Biol.
16,
818-828[Abstract]
|
| 31.
|
Rozen, F.,
Edery, I.,
Meerovitch, K.,
Dever, T. E.,
Merrick, W. C.,
and Sonenbreg, N.
(1990)
Mol. Cell. Biol.
10,
1134-1144[Abstract/Free Full Text]
|
| 32.
|
Yamaguchi, M.,
Dao, V.,
and Modrich, P.
(1998)
J. Biol. Chem.
273,
9197-9201[Abstract/Free Full Text]
|
| 33.
|
Wells, S. E.,
Neville, M.,
Haynes, M.,
Wang, J.,
Igel, H.,
and Ares, M.
(1996)
Genes Dev.
10,
220-232[Abstract/Free Full Text]
|
| 34.
|
Kramer, A.,
Gruther, P.,
Groning, K.,
and Kastner, B.
(1999)
J. Cell Biol.
145,
1355-1368[Abstract/Free Full Text]
|
| 35.
|
Yan, D.,
Periiman, R.,
Igel, H.,
Howe, K. J.,
Neville, M.,
and Ares, M.
(1998)
Mol. Cell. Biol.
18,
5000-5009[Abstract/Free Full Text]
|
| 36.
|
Lamond, A. I.,
Sproat, B.,
Ryder, U.,
and Hamm, J.
(1989)
Cell
58,
383-390[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Ast, G.,
and Weiner, A.
(1997)
RNA
3,
371-381[Abstract]
|
| 38.
|
Ruby, S. W.,
and Abelson, J.
(1988)
Science
242,
1028-1035[Abstract/Free Full Text]
|
| 39.
|
Sproat, B. S.,
lamond, A. I.,
Beijer, B.,
Neuner, P.,
and Ryder, U.
(1989)
Nucleic Acids Res.
17,
3373-3386[Abstract/Free Full Text]
|
| 40.
|
Johnston, M.,
and Davis, R. W.
(1984)
Mol. Cell. Biol.
4,
1440-1448[Abstract/Free Full Text]
|
| 41.
|
Mitchell, D. A.,
Marshall, T. K.,
and Deschenes, R. J.
(1993)
Yeast
9,
715-722[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Sikorski, R. S.,
and Hieter, P.
(1990)
Genetics
122,
19-27
|
| 43.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning
, 2nd Ed.
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 44.
|
Lustig, A. J.,
Lin, R. J.,
and Abelson, J.
(1986)
Cell
47,
953-963[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Ares, M., Jr.,
and Igel, A. H.
(1990)
Genes Dev.
4,
2132-2145[Abstract/Free Full Text]
|
| 46.
|
Awasthi, S.,
Palmer, R.,
Castro, M.,
Mobarak, C. D.,
and Ruby, S. W.
(2001)
J. Biol. Chem.
276,
31004-31015[Abstract/Free Full Text]
|
| 47.
|
Guthrie, C.,
and Fink, G.
(1991)
Methods Enzymol.
194,
1-933[Medline]
[Order article via Infotrieve]
|
| 48.
|
Orr-Weaver, T.,
Szostak, J. W.,
and Rothstein, R. J.
(1983)
Methods Enzymol.
101,
228-245[Medline]
[Order article via Infotrieve]
|
| 49.
|
Ruby, S. W.
(1999)
Methods Mol. Biol.
118,
323-349[Medline]
[Order article via Infotrieve]
|
| 50.
|
Winer, B. J.,
Brown, D. R.,
and Michels, K. M.
(1991)
Statistical Principles in Experimental Design
, 3rd Ed.
, McGraw-Hill Inc., New York
|
| 51.
|
Cody, R. P.,
and Smith, J. K.
(1991)
Applied Statistics and the SAS Programming Language
, 4th Ed.
, Prentice-Hall, Inc., Englewood Cliffs, NJ
|
| 52.
|
Ruby, S. W.
(1999)
Methods Mol. Biol.
118,
365-390[Medline]
[Order article via Infotrieve]
|
| 53.
|
Feinberg, A. P.,
and Vogelstein, B.
(1983)
Anal. Biochem.
132,
6-13[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Ruby, S. W.,
Goelz, S. E.,
Hostomsky, Z.,
and Abelson, J.
(1990)
Methods Enzymol.
181,
88-97
|
| 55.
|
Vijayraghavan, U.,
Company, M.,
and Abelson, J.
(1989)
Genes Dev.
3,
1206-1216[Abstract/Free Full Text]
|
| 56.
|
Lesser, C. F.,
and Guthrie, C.
(1993)
Genetics
133,
851-863[Abstract]
|
| 57.
|
Barabino, S. M. L.,
Sproat, B. S.,
and Lamond, A. I.
(1992)
Nucleic Acids Res.
20,
4457-4464[Abstract/Free Full Text]
|
| 58.
|
McPheeters, D. S.,
Fabrizio, P.,
and Abelson, J.
(1989)
Genes Dev.
3,
2124-2136[Abstract/Free Full Text]
|
| 59.
|
Ruby, S. W.
(1997)
J. Biol. Chem.
272,
17333-17341[Abstract/Free Full Text]
|
| 60.
|
Ast, G.,
and Weiner, A.
(1997)
RNA (New York)
3,
371-381
|
| 61.
|
Neubauer, G.,
Gottschalk, A.,
Fabrizio, P.,
Seraphin, B.,
Luhrmann, R.,
and Mann, M.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
385-390[Abstract/Free Full Text]
|
| 62.
|
Gottschalk, A.,
Kastner, B.,
Luhrmann, R.,
and Fabrizio, P.
(2001)
RNA (New York)
7,
1554-1565
|
| 63.
|
Vijayraghavan, U.,
Parker, R.,
Tamm, J.,
Rossi, J.,
Abelson, J.,
and Guthrie, C.
(1986)
EMBO J.
7,
1683-1695
|
| 64.
|
Rymond, B. C.,
Torrey, D. D.,
and Rosbash, M.
(1987)
Genes Dev.
1,
238-246[Abstract/Free Full Text]
|
| 65.
|
Konarska, M. M.,
and Sharp, P. A.
(1986)
Cell
46,
845-855[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Kim, S.-H.,
and Lin, R.-J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
888-892[Abstract/Free Full Text]
|
| 67.
|
Farabaugh, P. J.
(2000)
Prog. Nucleic Acids Res. Mol. Biol.
64,
131-170[Medline]
[Order article via Infotrieve]
|
| 68.
|
Zhou, W.,
Edelman, G. M.,
and Mauro, V. P.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
1531-1536[Abstract/Free Full Text]
|
| 69.
|
Rymond, B. C.,
Pikielny, C.,
Seraphin, B.,
Legrain, P.,
and Rosbash, M.
(1990)
Methods Enzymol.
181,
122-147[Medline]
[Order article via Infotrieve]
|
| 70.
|
Spingola, M.,
Grate, L.,
Haussler, D.,
and Ares, M. J.
(1999)
RNA (New York)
5,
221-234
|
| 71.
|
Ast, G.,
Pavelitz, T.,
and Weiner, A.
(2001)
Nucleic Acids Res.
29,
1741-1749[Abstract/Free Full Text]
|
| 72.
|
Newham, C. M.,
and Query, C. C.
(2001)
RNA (New York)
7,
1298-1309
|
| 73.
|
Rosbash, M.,
and Seraphin, B.
(1991)
Trends Biochem. Sci.
16,
187-190[CrossRef][Medline]
[Order article via Infotrieve]
|
| 74.
|
Abovich, N.,
Liao, X. C.,
and Rosbash, M.
(1994)
Genes Dev.
8,
843-854[Abstract/Free Full Text]
|
| 75.
|
Berglund, J. A.,
Chua, K.,
Abovich, N.,
Reed, R.,
and Rosbash, M.
(1997)
Cell
89,
781-787[CrossRef][Medline]
[Order article via Infotrieve]
|
| 76.
|
Guth, S.,
and Valcarcel, J.
(2000)
J. Biol. Chem.
275,
38059-338066[Abstract/Free Full Text]
|
| 77.
|
Schmid, S. R.,
and Linder, P.
(1991)
Mol. Cell. Biol.
11,
3463-3471[Abstract/Free Full Text]
|
| 78.
|
Hotz, H. R.,
and Schwer, B.
(1998)
Genetics
149,
807-815[Abstract/Free Full Text]
|
| 79.
|
Kim, J. L.,
Morgenstern, K. A.,
Girffith, J. P.,
Dwyer, M. D.,
Thomson, J. A.,
Murcko, M. A.,
Lin, C.,
and Caron, P. R.
(1997)
Structure
6,
89-100
|
| 80.
|
Benz, J.,
Trachsel,
and Baumann, U.
(1999)
Structure
7,
671-679[Medline]
[Order article via Infotrieve]
|
| 81.
|
Johnson, E. R.,
and McKay, D. B.
(1999)
RNA (New York)
5,
1526-1534
|
| 82.
|
Burgess, S.,
Couto, J. R.,
and Guthrie, C.
(1990)
Cell
60,
705-717[CrossRef][Medline]
[Order article via Infotrieve]
|
| 83.
|
Schwer, B.,
and Guthrie, C.
(1992)
Mol. Cell. Biol.
12,
3540-3547[Abstract/Free Full Text]
|
| 84.
|
Perriman, R.,
and Ares, M. J.
(2000)
Genes Dev.
14,
97-107[Abstract/Free Full Text]
|
| 85.
|
Igel, H.,
Wells, S.,
Perriman, R.,
and Ares, M., Jr.
(1998)
RNA (New York)
4,
1-10
|
| 86.
|
Pauling, M. H.,
McPheeters, D. S.,
and Ares, M. J.
(2000)
Mol. Cell. Biol.
20,
2176-2185[Abstract/Free Full Text]
|
| 87.
|
Daugeron, M.-C.,
Tazi, J.,
Jeanteur, P.,
Brunel, C.,
and Cathala, G.
(1992)
Nucleic Acids Res.
20,
3625-3630[Abstract/Free Full Text]
|
| 88.
|
Toda, T.,
Cameron, S.,
Sass, P.,
Zoller, M.,
Scott, J. D.,
McMcullen, B.,
Hurwitz, M.,
Krebs, E. G.,
and Wigler, M.
(1987)
Mol. Cell. Biol.
7,
1371-1377[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. R. Kosowski, H. R. Keys, T. K. Quan, and S. W. Ruby
DExD/H-box Prp5 protein is in the spliceosome during most of the splicing cycle
RNA,
July 1, 2009;
15(7):
1345 - 1362.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Perriman and M. Ares Jr.
Rearrangement of competing U2 RNA helices within the spliceosome promotes multiple steps in splicing
Genes & Dev.,
April 1, 2007;
21(7):
811 - 820.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Perriman, I. Barta, G. K. Voeltz, J. Abelson, and M. Ares Jr.
ATP requirement for Prp5p function is determined by Cus2p and the structure of U2 small nuclear RNA
PNAS,
November 25, 2003;
100(24):
13857 - 13862.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|