|
Originally published In Press as doi:10.1074/jbc.M110631200 on March 28, 2002
J. Biol. Chem., Vol. 277, Issue 23, 20438-20445, June 7, 2002
Regulation of Metallothionein Transcription by the
Metal-responsive Transcription Factor MTF-1
IDENTIFICATION OF SIGNAL TRANSDUCTION CASCADES THAT CONTROL
METAL-INDUCIBLE TRANSCRIPTION*
Nurten
Saydam ,
Timothy K.
Adams§,
Florian
Steiner ,
Walter
Schaffner , and
Jonathan H.
Freedman§¶
From the Institute of Molecular Biology, University
of Zurich, Winterthurerstrasse 190, CH-8057 Zurich, Switzerland and the
§ Nicholas School of the Environment and Earth Sciences,
Duke University, Durham, North Carolina 27708
Received for publication, November 5, 2001, and in revised form, March 12, 2002
 |
ABSTRACT |
Every living organism must detoxify nonessential
metals and carefully control the intracellular concentration of
essential metals. Metallothioneins, which are small, cysteine-rich,
metal-binding proteins, play an important role in these processes. In
addition, the transcription of their cognate genes is activated in
response to metal exposure. The zinc finger transcription factor MTF-1 plays a central role in the metal-inducible transcriptional activation of metallothionein and other genes involved in metal homeostasis and
cellular stress response. Here we report that the phosphorylation of
MTF-1 plays a critical role in its activation by zinc and cadmium. Inhibitor studies indicate that multiple kinases and signal
transduction cascades, including those mediated by protein kinase C,
tyrosine kinase, and casein kinase II, are essential for zinc- and
cadmium-inducible transcriptional activation. In addition, calcium
signaling is also involved in regulating metal-activated transcription.
In contrast, cAMP-dependent protein kinase may not be
directly involved in the metal response. Contrary to what has been
reported for other transcription factors, inhibition of transcriptional
activation does not impair the binding of MTF-1 to DNA, suggesting that
phosphorylation is not regulating DNA binding. Elevated phosphorylation
of MTF-1 is observed under condition of protein kinase C
inhibition, suggesting that specific dephosphorylation of this
transcription factor contributes to its activation.
 |
INTRODUCTION |
Metallothioneins
(MT)1 are a family of
evolutionarily conserved, low molecular weight, cysteine-rich
metal-binding proteins (1, 2). The precise physiological function of MT
has not been fully elucidated. However, proposed roles include
(a) participation in maintaining the homeostasis of
essential transition metals; (b) sequestration of toxic
metals, such as cadmium and mercury; and (c) protection
against intracellular oxidative damage (1-4).
Metallothionein expression is primarily controlled at the level of
transcription. Transcription can be induced by a variety of
physiological agents and environmental stressors such as transition metals, glucocorticoids, cAMP, phorbol esters, alkylating
agents, oxidizing agents, ultraviolet and ionizing radiation, and
hypoxia (1, 5-12). The activation of MT transcription by transition metals is mediated by regulatory elements, designated metal-responsive elements (MREs). MREs contain a 7-bp core sequence (TGCRCNC) and are
present in multiple copies in the promoter/enhancer regions of almost
all metal-inducible MTs (13, 14). Inducible transcription is mediated
by a variety of other regulatory elements located in promoter/enhancer
regions of MT genes, which include glucocorticoid response elements,
cAMP response elements, AP-1 elements, and antioxidant response
elements (1, 5, 15, 16).
Metal-inducible MT transcription is regulated by the transcription
factor MTF-1 (metal transcription factor-1) (17, 18). MTF-1 is an
evolutionarily conserved protein that specifically binds to MREs and
has been characterized in several species including human, mouse,
pufferfish (Fugu rubripes), zebrafish (Danio
rerio), trout (Oncorhynchus mykiss), and
Drosophila (17, 19-22). MTF-1 contains six zinc
finger domains and several trans-activation domains:
acidic-rich, proline-rich, and serine/threonine-rich (17). Deletion
analysis of MTF-1 suggests that interactions among all of the domains
are required for metal-inducible transcription (23).
Two models have been proposed to describe how the interaction among
MREs, MTF-1, and zinc activates MT transcription. The first proposes
that MTF-1 acts as a zinc sensor that cannot bind to DNA in the absence
of metal (18, 24-27). As cells accumulate zinc, the metal binds in the
finger domains, causing a conformational change in the protein and
subsequent binding to the MRE. When MT levels are sufficient, it
chelates the metal from the zinc fingers; now, MTF-1 can no longer bind
to the MREs and transcription ceases.
An alternative model hypothesizes the existence of a zinc-sensitive
inhibitor, which complexes with MTF-1 rendering it inactive (28). As
cellular zinc levels increase, the metal binds to the inhibitor
releasing it from MTF-1, allowing the transcription factor to bind to
the MRE to activate transcription. When MT levels are sufficient, the
zinc is removed from the inhibitor, allowing it once again to bind to
MTF-1 thereby inhibiting transcription.
Typically, zinc is used as the inducer when the interactions among
MREs, MTF-1, and MT transcription are investigated. There is a paucity
of information regarding the molecular mechanism of MT transcriptional
activation by other transition metals and environmental stressors. A
combination of mutational and transcriptional analyses clearly show
that cadmium activation of MT transcription is dependent on MTF-1 and
MREs (18, 29). MTF-1 binding to MREs and the activation of MT
transcription is also induced by oxidative stress (25, 30). Although
the current models can account for the regulation of MT transcription
by zinc, they do not adequately explain the control of MTF-1 activity
by non-zinc stressors.
We propose a model in which the regulation of MT transcription, via the
MTF-1/MRE interaction, is controlled by several signal transduction
cascades that affect MTF-1 phosphorylation. It has been reported
previously that the level of MTF-1 phosphorylation is modified
following exposure to cadmium or zinc in vivo (31, 32). The
phosphorylation of MTF-1 may be affected by one or more metal- or
stress-responsive signal transduction pathways. This model is based on
several observations. First, protein motif analysis (PROSITE) (33) of
MTF-1 indicates the presence of several evolutionarily conserved,
potential phosphorylation sites. As many as 11 PKC sites, 13 casein
kinase II sites, and 1 tyrosine kinase site are predicted in the four
characterized MTF-1s from different species. Second, exposure of cells
to activators of signal transduction cascades causes an increase in the
steady-state level of MT mRNAs (5, 7, 12, 34). Similarly, addition of signal transduction inhibitors attenuates or abolishes
metal-inducible MT mRNA expression (35). Finally, many of the
effectors that induce MT transcription, metals (zinc, cadmium, mercury,
arsenic, chromium) as well as other environmental stressors (oxidative stress, radiation), modulate the activity of intracellular signal transduction cascades (36-39).
In this report, we show that MTF-1 is phosphorylated in vivo
on serine and tyrosine residues, and that the level of phosphorylation is affected by metal exposure and kinase inhibitors. In addition, several signal transduction cascades have been identified that modulate
cadmium- and zinc-inducible MTF-1/MRE-mediated activation of MT transcription.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture and Transfection--
COS-7 cells (ATCC CRL-1651),
SV 40 transformed fibroblasts of African Green monkey kidney cells,
were maintained in complete Dulbecco's modified Eagle's medium (DMEM)
containing 10% fetal bovine serum, 5% nonessential amino acids, 5%
L-glutamine, and penicillin/streptomycin (Invitrogen).
HEK293, adenovirus transformed human embryonic kidney cells (ATCC
CRL-1573), and HeLa cells (ATCC CCL-2) were maintained in DMEM
supplemented with 10% fetal bovine serum.
For transient transfection studies, HEK293 and HeLa cells were grown in
DMEM supplemented with 5% fetal bovine serum for 16 h prior to
transfection. These cells were then transfected using the calcium
phosphate transfection method as previously described (40, 41).
COS-7 were grown to ~60% confluence in complete DMEM. The medium was
then removed, and the cells were washed with Opti-MEM reduced serum
medium (Invitrogen) immediately before transfection. Transient
transfection was accomplished by lipofection using Lipofectin per
manufacturer's instructions (Invitrogen).
Expression Plasmids and Fusion Genes--
The plasmid encoding a
vesicular stomatitis virus (VSV) G protein-tagged hMTF-1 fusion
protein, designated phMTF-1-VSV, has been previously described (42). An
expression vector encoding a myc-His6-tagged
mMTF-1 fusion protein was constructed that contained a 2,007-bp
cDNA fragment. This fragment includes 670 amino acids of mMTF-1;
however, it is missing the five C-terminal amino acids (671LQLPP675). The mMTF-1 fusion protein
contains a His6 tag, which can be used for protein
purification, and a Myc epitope, which can be used to identify the
expressed protein by Western immunoblot analysis and for
purification by immunoprecipitation.
To construct this expression vector, pc-mMTF-1, which contains the
full-length mMTF-1 cDNA (18), was digested with NcoI and
ApaI to yield a 2,007-bp cDNA fragment (1 bp 5' of the
start codon and 19 bp 5' of the TAG stop codon). This fragment was
inserted into the NcoI and ApaI sites of
pGEM-5zf(+) (Promega). The resulting plasmid, designated pG5-mMTF-1,
was then digested with ApaI and SpeI to release
the original fragment and an additional 18 bp from the multiple cloning
site of pGEM-5zf(+). This fragment was directionally cloned into the
NheI (SpeI-compatible) and ApaI sites
of pcDNA3.1-myc-his (Invitrogen). The final recombinant expression vector is designated pmMTF-1-myc-his.
Expression of both the hMTF-1-VSV and mMTF-1-myc-his
mRNAs is under the control of the cytomegalovirus promoter, which
allows high level expression in a variety of cells. Transfection of
cells with either phMTF-1-VSV or pmMTF-1-myc-his expression
plasmids results in the constitutive expression of the MTF-1 fusion proteins.
Two parameters were used to assess the biological activity of the
mMTF-1 and hMTF-1 fusion proteins: the ability to activate MT
transcription and to specifically bind to MREs. Co-transfection of
either MTF-1 expression vector with 153CAT (see below) results in a
significant increase in reporter gene expression in the absence of
metals, compared with cells not transfected with
pmMTF-1-myc-his or phMTF-1-VSV. This effect has been
described previously in cells transfected with MTF-1 expression
plasmids and has been attributed to the unusually high levels of MTF-1
(17). When cadmium was added to the culture medium, the level of
reporter gene expression significantly increased (p < 0.05) compared with cells not exposed to cadmium.
Electrophoretic mobility shift assays demonstrated that the
mMTF-1-myc-his and phMTF-1-VSV fusion proteins specifically
bind to the MRE sequence. In vitro transcribed/translated
fusion proteins bound to a 32P-labeled MRE-containing
oligonucleotide, and binding was successfully competed with the
unlabeled MRE oligonucleotide. Furthermore, an oligonucleotide that
contained a nonfunctional MRE sequence did not compete with the labeled
probe (44). The results of the transfection and EMSA analyses with the
mouse and human MTF-1 fusion proteins are similar to those previously
reported for endogenous MTF-1 (17, 19). They indicate that both
hMTF-1-VSV and mMTF-1-myc-his are functionally equivalent to
the non-fusion form of MTF-1.
A series of reporter plasmids were used to assess the levels of MT
transcription. Metallothionein transcription in HEK293 and HeLa cells
was determined from the amount of luciferase produced using mouse
MT-I-Luc or 4xMREd-Luc reporter constructs. The construction of
MT-I-Luc has been described previously (42). The 4xMREd-Luc reporter
plasmid was created by excising the concatenated MREs from 4xMREd-OVEC
(17) following digestion with XhoI and PvuII, which released a 111-bp fragment. The ends of the fragment were made
blunt, and it was subsequently inserted into the SmaI site of pGL3-basic (Promega).
The level of MT transcription in COS-7 cells was established by
measuring the level of chloramphenicol acetyltransferase produced using
42CAT, which contains the minimal mouse MT-I promoter ( 42 to +62);
153CAT, which contains the region of the mMT-1 gene from 153 to
+62; and MREd'5CAT, which contains five tandem copies of
MREd' inserted upstream of TATA box in 42CAT. Complete descriptions of the MT-CAT reporter genes can be found in Ref. 43, by Dalton et al.
In Vivo 33P and 32P Labeling--
HEK293
cells were transfected with 5 µg of phMTF-1-VSV for 24 h. After
transfection, the medium was replaced with phosphate-free DMEM
(Invitrogen). After 3 h the medium was replaced with the phosphate-free DMEM containing [33P]orthophosphate (0.1 mCi/ml). Either zinc (100 µM ZnCl2) or
cadmium (60 µM CdCl2) was added to the
33P-containing medium. Incubation proceeded for 3 h,
after which nuclear and cytoplasmic extracts were prepared as
previously described (17). The hMTF-1-VSV fusion protein was isolated
from nuclear and cytoplasmic extracts by immunoprecipitation using
anti-VSV antibody (Sigma). The amount of 33P incorporated
into hMTF-1-VSV was determined following SDS-PAGE by PhosphorImager analysis.
COS-7 cells were transfected with 16 µg of pmMTF-1-myc-his
for ~6 h, at which time the medium was removed and replaced with complete DMEM. The cells were then allowed to recover for an additional 48 h. Cells were then washed with phosphate-free DMEM and then incubated in phosphate-free DMEM containing
[32P]orthophosphate (0.25 mCi/ml) for 30 min. Metals (50 µM CdCl2 or 100 µM
ZnCl2) were then added to the culture medium, and the cells
incubated an additional 1-4 h. Following this incubation, the
mMTF-1-myc-his fusion protein was purified by either nickel affinity chromatography or immunoprecipitation. To determine the affects of inhibiting PKC activity on the level of mMTF-1
phosphorylation, the PKC inhibitor H-7 was applied to cells (100 µM) 30 min prior to the addition of cadmium or zinc.
Nickel Affinity Chromatography--
Cells were lysed in 50 mM Tris-HCl buffer, pH 8.0, containing 1% Triton X-100, 8 M urea, and 25 mM NaCl. The fusion protein was
then purified using Ni-NTA affinity chromatography by first incubating
the cell lysate with Ni-NTA resin (Qiagen) at 22 °C for 30 min with
constant shaking. At the end of this incubation, the Ni-NTA resin was
collected and washed twice with 20 mM imidazole buffer. The
mMTF-1-myc-his fusion protein was subsequently eluted with
500 mM imidazole.
Immunoprecipitation--
Cell lysates were prepared in 50 mM Tris-HCl buffer, pH 8.0, containing 1% Triton X-100, 25 mM NaCl, 2 µg/ml aprotinin, 100 µg/ml
phenylmethylsulfonyl fluoride, and 2 mg/ml pepstatin. Lysates were
first pre-treated with a 50% (v/v) slurry of Protein G-agarose (Roche
Biomedical) in lysis buffer for 3 h at 4 °C with constant agitation. After removing the resin by centrifugation, a fresh aliquot
of resin and anti-Myc monoclonal antibody (Invitrogen) was added to the
treated lysate. The mixture was incubated for 24 h at 4 °C,
after which the resin was collected and washed three times with lysis
buffer. The washed resin was then combined with SDS-PAGE sample buffer
(40) and incubated for 6 min at 100 °C, and the supernatant was collected.
mMTF-1-myc-his proteins isolated by affinity chromatography
or immunoprecipitation were resolved by SDS-PAGE and subsequently transferred to polyvinylidene difluoride membranes (Millipore Corp).
The identification and quantification of the 32P-labeled
mMTF-1-myc-his fusion protein was accomplished by
autoradiography and PhosphorImager analysis (Molecular Dynamics).
The location of the fusion protein was determined by Western immunoblot
analysis, using either anti-Myc or anti-poly-His6
antibodies, and enhanced chemiluminescence. Proteins purified by
immunoprecipitation were identified using an anti-mMTF-1 antibody.
Analysis of Phosphorylated Amino Acid Residues--
Amino acid
residues that are phosphorylated in MTF-1, and the effects of metal
exposure on their level of phosphorylation were determined by Western
immunoblot analysis. COS-7 cells were transfected with
pmMTF-1-myc-his and exposed to metals as described above;
however, [32P]orthophosphate was omitted. The fusion
protein was purified by immunoprecipitation, using anti-Myc antibodies,
and resolved by SDS-PAGE. Identification of phosphorylated amino acid
residues was accomplished following Western immunoblot analysis using
anti-phosphothreonine, anti-phosphoserine, or anti-phosphotyrosine
antibodies (Sigma). The level of mMTF-1 fusion protein expression was
determined using anti-mMTF-1 antibody.
Signal Transduction Cascade Inhibition--
The effects of
exposing HEK293, HeLa, and COS-7 cells to kinase inhibitors on the
levels of MRE-mediated MT transcription were determined using
luciferase- and CAT-based reporter genes.
Luciferase Assay--
HEK293 and HeLa were grown on six-well
tissue culture dishes in DMEM supplemented with 5% fetal bovine serum
for 16 h before transfection. Cells were transiently transfected
with 2 µg/well mMT-I-Luc or 4xMREd-Luc reporter plasmid, and 0.5 or 1 µg/well pCMV-LacZ as a reference. Sixteen hours after transfection,
cells were washed and then incubated for an additional 24 h in
DMEM containing 5% fetal bovine serum. Following this incubation, the medium was replaced with DMEM containing 0.5% bovine serum albumin. After incubating for an additional 24 h under serum-free
conditions, cells were treated with kinase inhibitors. Inhibitor
treatments were initiated 30 min prior to the addition of cadmium (60 µM CdCl2) or zinc (100 µM
ZnCl2). Cells were exposed to metals for 4 h in both
the presence and absence of the inhibitors. Cell lysates were prepared
and luciferase activities measured according to manufacturer's
instructions (Promega). A description of the inhibitors and the
concentrations used in the assays can be found in Table I.
Chloramphenicol Acetyltransferase Enzyme-linked Immunosorbent
Assay--
COS-7 cells were plated on to 24-well tissue culture dishes
and incubated for 24 h. Cells were washed twice with
phosphate-buffered saline and transfected with 42CAT, 153CAT, or
MREd'5CAT reporter genes for 3-4 h. Cells were
co-transfected with pSV- Gal (Promega), to control for transfection
efficiency. Following this incubation, the transfection medium was
replaced with complete DMEM, and cells were incubated for an additional
24 h.
To determine the effects of inhibiting signal transduction cascades on
MTF-1/MRE-mediated MT transcription, chemical inhibitors (Table
I) were added to the transfected cells in
complete DMEM. Following a 0.5-1-h incubation, no metal, 50 µM CdCl2, or 100 µM
ZnCl2 was added, and cells incubated for an additional
3 h. Extracts were prepared, and CAT concentrations and
-galactosidase activities determined by sandwich enzyme-linked
immunosorbent assay using a CAT-ELISA kit (Roche Biotechnologies) and a
-galactosidase enzyme assay system (Promega), respectively. All
assays were performed in triplicate and normalized to -galactosidase
activity.
Electrophoretic Mobility Shift Assays--
HEK293 cells were
incubated with 100 µM ZnCl2 or 60 µM CdCl2 for 3 h in the presence or
absence of kinase inhibitors. Binding reactions were performed by
incubating 2-5 fmol of a 32P-end-labeled, double-stranded
oligonucleotide containing core MRE consensus sequence with nuclear
extracts as previously described (17). The sequences of the two strands
in the MRE oligonucleotide are:
cgagggagctctgcacacggcccgaaaagtg (plus strand) and tcgacacttttcgggccgtgtgcagagctccctcgagct (minus strand). The
bases in bold designate core MRE sequence.
 |
RESULTS |
Phosphorylation of MTF-1 in Vivo--
Radiolabeled proteins
corresponding to the MTF-1 fusion proteins were isolated from
transfected HEK293 and COS-7 cells. In vivo labeling of both
the hMTF-1 and mMTF-1 fusion proteins showed that MTF-1 is
constitutively phosphorylated in the absence of added metal. The
phosphorylated form of MTF-1 is located primarily in the cytoplasm of
nonexposed cells (Fig. 1A).
Following a 3-h incubation with zinc or cadmium, the level of MTF-1
phosphorylation increased. This increase was primarily observed as a
higher level of phosphorylation in the nuclear form of MTF-1. However,
significant levels of phospho-MTF-1 were still observed in the
cytoplasmic fraction (Fig. 1A). These results confirm that
MTF-1 is phosphorylated in both the presence and absence of added
metals. In addition, they indicate that exposure to transition metals
increases the level of phosphorylation.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1.
Phosphorylation of MTF-1 in vivo.
A, HEK293 cells were transfected with 5 µg of phMTF-1-VSV
for 24 h, labeled with [33P]orthophosphate for
3 h in either the absence or presence of 100 µM zinc
or 60 µM cadmium. Nuclear (upper panel) and
cytoplasmic (lower panel) extracts were then prepared and
hMTF-1 fusion proteins purified by immunoprecipitation. Immunocomplexes
were resolved by SDS-PAGE, transferred onto nitrocellulose membranes,
and visualized by PhosphorImager analysis. B, COS-7 cells
were transfected with 16 µg of pmMTF-1-myc-his and exposed
to 100 µM zinc for 4 h or no metal (NM).
The fusion protein was purified by immunoprecipitation and resolved by
SDS-PAGE. Identification of MTF-1-myc-his
(MTF-1), and phosphorylated serine (P-ser) or
tyrosine (P-tyr) residues was accomplished by Western
immunoblot analysis using anti-mMTF-1, anti-phosphoserine, and
anti-phosphotyrosine antibodies.
|
|
To identify which types of amino acid residues are phosphorylated
in vivo, nonradiolabeled, immunopurified
mMTF-1-myc-his was probed with anti-phosphoserine,
anti-phosphothreonine, and anti-phosphotyrosine antibodies. Both
anti-phosphoserine and anti-phosphotyrosine antibodies cross-reacted
with mMTF-1-myc-his (Fig. 1); however, the binding of
anti-phosphothreonine antibodies was not observed (data not shown).
These results indicate that MTF-1 is phosphorylated at multiple sites:
serine and tyrosine residues. Similar to what was observed in the
in vivo radiolabeling experiments, the protein is
constitutively phosphorylated and the level of phosphorylation increases in response to metal exposure (Fig. 1).
Effects of Signal Transduction Cascade Activators and Inhibitors on
MT Transcription--
Protein motif analysis of MTF-1 indicates that
it contains a variety of potential sites that may be phosphorylated via
different signal transduction pathways. To determine which signal
transduction pathway contributes to the regulation of MTF-1 activity,
the effects of kinase inhibitors and activators on MRE-mediated MT
transcription were investigated in HeLa, HEK293, and COS-7 cells.
Protein Kinase C--
The effects of three PKC inhibitors,
staurosporine, H-7, and BIM-I, on zinc-inducible MT transcription were
investigated in HeLa cells. Exposure to staurosporine or H-7, in either
the presence or absence of zinc, reduced mMT-I promoter activity to
levels below that observed in cells not exposed to metal (Fig.
2). Treatment with BIM-I also
significantly reduced the level of zinc-inducible mMT-1 transcription.
Similar results were obtained with HeLa cells transfected with the
4xMREd reporter gene (Fig. 2). In these studies, however, treatment
with staurosporine and H-7 did not reduce the level of reporter gene
expression below that observed in cells not exposed to zinc. Thus, in
these cells, PKC inhibitors did not affect the basal level of
expression.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of PKC inhibitors on metal-inducible
transcription. HeLa cells were transfected with mMTI-Luc and
CMV-Lac Z (upper panel) or 4xMREd-Luc and CMV-Lac Z
(lower panel) and then serum-starved for 24 h. Cells
were then exposed to the PKC inhibitors staurosporine, H-7, or BIM-I
for 30 min prior to the addition of 100 µM zinc.
Following a 4-h incubation, cells were harvested and processed for
luciferase and -galactosidase assays. The level of reporter gene
activity was also measured in cells exposed to inhibitors, but not to
zinc (NM), or cells not exposed to metals and inhibitors
(No Treatment). Table, COS-7 cells were
transfected with 42CAT, 153CAT or MREd'5CAT, and
pSV- Gal, for 3 h. After a 24-h recovery period, cells were
pre-incubated with the PKC inhibitor H-7 for 30 min, and then cadmium
(50 µM) or zinc (100 µM) was added.
Following a 4-h incubation, cells were harvested and CAT concentrations
and -galactosidase activities determined. Reporter gene activity in
the presence of metal, but in the absence of inhibitors
(NI), and in cells not exposed to metals or inhibitors
(NM) were also determined. The data presented are the mean
values from three independent experiments with the standard deviations.
*, significant change in reporter gene expression (p < 0.05).
|
|
The effect of H-7 on cadmium- and zinc-inducible MT transcription was
also examined in COS-7 cells. Zinc-induced -153CAT and MREd'5CAT reporter gene activity were reduced by 77%
(p < 0.001) and 83% (p < 0.001),
respectively, in the presence of H-7 (Fig. 2). Treatment with H-7
reduced cadmium-inducible transcription to a similar extent, 86%
(p < 0.001) and 74% (p < 0.005). The level of MT transcription in the presence of metal and H-7 was not
significantly different from those of samples containing no metal, or
cells transfected with the negative control plasmid -42CAT
(p 0.99).
The results from these studies indicate that the MTF-1/MRE-mediated
activation of MT transcription is regulated by PKC-responsive signal
transduction pathways. These results are consistent with previous
reports demonstrating that exposure of animals or cultured cells to PKC
activators (TPA) increases the steady-state level of MT mRNA (7).
Exposure of HeLa or COS-7 cells to the PKC activators ( )-indolactam
or TPA, however, did not significantly increase the level of
MRE-regulated MT transcription, even following prolonged exposure
(Table II). This suggests that PKC
activation is necessary but not sufficient for metal induction.
Casein Kinase II--
Mammalian MTF-1s contain more than 11 predicted casein kinase II phosphorylation sites. The effects of the
casein kinase II inhibitors DRB and heparin on metal-inducible MT
transcription were examined in HeLa, HEK293, and COS-7 cells. In HeLa
cells, treatment with DRB significantly reduced the level of both
cadmium- and zinc-inducible reporter gene expression at all of the
concentrations tested (5-50 µM) (Fig.
3). In HEK293 cells, however, DRB was an effective inhibitor of cadmium-inducible transcription at
concentrations above 10 µM, and of zinc-inducible
transcription at 50 µM (Fig. 3).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of casein kinase II inhibition on
metal-inducible transcription. HEK293 (upper panel) or
HeLa (lower panel) cells were transfected with 4xMREd-Luc
and CMV-LacZ and then serum-starved for 24 h. Cells were exposed
to various concentrations (0, 5, 10, and 50 µM) of the
casein kinase II inhibitor DRB for 30 min prior to the addition of
either 100 µM zinc or 60 µM cadmium.
Following a 4-h incubation, cells were harvested and processed for
luciferase and -galactosidase assays. The level of reporter gene
activity was also measured in cells exposed to 50 µM DRB
but not metal (DRB Only), or cells not exposed to metals and
inhibitor (No Treatment). Table, COS-7 cells were
transfected with CAT reporter genes and pSV- Gal, for 3 h. After
a 24-h recovery period, cells were pre-incubated with the casein kinase
inhibitor, heparin for 30 min, and then cadmium (50 µM)
or zinc (100 µM) was added. Following a 4 h
incubation, cells were harvested, and CAT concentrations and
-galactosidase activities determined. Reporter gene activity in the
presence of metal, but in the absence of inhibitors (NI),
and in cells not exposed to metals or inhibitors (NM) were
also determined. The data presented are the mean values from three
independent experiments with the standard deviations. *, significant
change in reporter gene expression (p < 0.05).
|
|
Treatment of COS-7 cells with heparin (2 µg/ml) significantly
inhibited cadmium-inducible reporter gene expression in cells transfected with -153CAT (Fig. 3). This concentration of heparin, however, did not affect zinc-inducible expression. In addition, heparin
did not affect cadmium- or zinc-inducible expression of the
MREd'5CAT reporter. It may require higher concentrations of this inhibitor to affect MT transcription.
Treatment of cells with spermidine, a casein kinase II activator,
slightly activated reporter gene expression in COS-7 cells, in the
absence of metals (Table II). The results from the inhibitor and
activator studies using the three cell lines suggest that casein kinase
II may modulate the activity of MTF-1.
Tyrosine Kinase--
Inhibition of tyrosine kinase activity with
herbimycin A (5 µM) significantly reduced the level of
cadmium- and zinc-inducible reporter gene activity in both HEK293 and
HeLa cells (Fig. 4). These results
suggest that phosphorylation of the tyrosine residue in MTF-1 is
involved in the activation of MRE/MTF-1-regulated MT transcription.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of tyrosine kinase inhibition on MT
transcription. HeLa (upper panel) or HEK293
(lower panel) cells were transfected with 4xMREd-Luc and
CMV-LacZ and then serum-starved for 24 h. Cells were exposed to
the tyrosine kinase inhibitor herbimycin for 30 min prior to the
addition of 100 µM zinc or 60 µM cadmium.
Following a 4-h incubation, cells were harvested and processed for
luciferase and -galactosidase assays. The level of reporter gene
activity was also measured in cells that were not exposed to metal
(NM), or cells not exposed to the inhibitors (No
Treatment). The data presented are the mean values from three
independent experiments with the standard deviations.
|
|
Calcium and Calmodulin--
Calcium is required for the activation
of many kinases; therefore, the effects of intracellular calcium
chelators and calcium ionophores on MRE/MTF-1-mediated transcription
were investigated. Exposure to the intracellular calcium chelator,
BAPTA-AM, reduced the level of cadmium- and zinc-inducible 4xMREd
promoter activity to levels below that observed in cells not exposed to
metals (Fig. 5). This effect is not
attributed to chelation of cadmium or zinc by BAPTA-AM, which is known
to have very low affinity for these metals. Consistent with these
results, exposure of COS-7 cells to the calcium ionophore A-23187
markedly increased the level of -153CAT and MREd'5CAT
activity in the absence of added metals (Table II). These results
suggest that calcium-mediated signal transduction pathways are involved
in the activation of MTF-1.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of intracellular calcium chelators on
MT transcription. HeLa cells were transfected with 4xMREd-Luc and
CMV-LacZ and then serum-starved for 24 h. Cells were exposed to
the intracellular calcium chelator BAPTA-AM (+) for 30 min prior to the
addition of 100 µM zinc or 60 µM cadmium.
Cells were also exposed to metal, in the absence of BAPTA-AM ( ).
Following a 4-h incubation, cells were harvested and processed for
luciferase and -galactosidase assays. The data presented are the
mean values from three independent experiments with the standard
deviations, and are presented as the fold increase in reporter gene
activity relative to that observed in cells that were not treated with
metals or chelator (No Treatment).
|
|
Electrophoretic Mobility Shift Assay--
Exposure to PKC,
tyrosine kinase, or casein kinase II inhibitors decreases the level of
MTF-1/MRE-mediated gene expression. To investigate the relation between
kinase inhibition and the binding of MTF-1 to the MRE, EMSAs were
performed. Pretreatment of HEK293 cells with kinase inhibitors did not
significantly affect the cadmium- or zinc-inducible binding of MTF-1 to
the MRE (Fig. 6). In contrast, the
level of MTF-1-MRE complex formed increased in the presence of
inhibitors. These results suggest that the regulation of MRE-mediated
transcription by these kinases, or their related signal transduction
pathways, is not mediated by inhibiting the DNA binding activity of
MTF-1. This does not, however, exclude effects on cytoplasmic nuclear
transport of MTF-1, or chromatin accessibility of template promoter
targets.

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of kinase inhibitors on the DNA
binding activity of MTF-1. HEK293 cells were incubated with the
indicated kinase inhibitors for 30 min prior to exposure to 100 µM zinc or 60 µM cadmium, or no metal
(NM). Following a 3-h incubation, nuclear extracts were
prepared and analyzed by EMSA using a 32P-labeled
MRE-containing oligonucleotide. Nuclear extracts were also prepared
from cells that were exposed to cadmium or zinc, but not inhibitors
(No Inhibitor). The location of the MTF-1/MRE
oligonucleotide complex is indicated by the arrow.
|
|
Effect of Protein Kinase C Inhibition on MTF-1
Phosphorylation--
We observed that the inhibition of PKC activity
prevents both cadmium- and zinc-inducible MT transcription in the three
cell lines examined. Therefore, the effect of inhibiting PKC activity on the phosphorylation of MTF-1 was investigated.
When PKC activity was inhibited in zinc-treated COS-7 cells with H-7,
the amount of 32P incorporated into
mMTF-1-myc-his increased, compared with zinc-treated cells
not exposed to H-7 (Fig. 7). Similarly,
the amount of phosphorylation on the serine residues significantly
increased for the zinc-treated cells exposed to H-7 (Fig. 7). Similar
results were obtained when cells were exposed to cadmium and H-7
(results not shown). In control experiments, H-7 treatment alone caused
an increase in the level of MTF-1 phosphorylation. It should be noted
that treatment with H-7 did not affect the steady-state level of MTF-1
(Fig. 7).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of PKC inhibition on the level of
MTF-1 phosphorylation. COS-7 cells were transfected with 16 µg
of pmMTF-1-myc-his for 24 h. A, Cells were
exposed to 100 µM zinc or no metal and
[32P]orthophosphate for 4 h in the presence
(H-7) or absence (NI) of the PKC inhibitor H-7.
The fusion protein was purified by immunoprecipitation, immunocomplexes
were then resolved by SDS-PAGE, transferred onto a nitrocellulose
membrane, and the amount of 32P-labeled MTF-1 determined by
PhosphorImage analysis. B, cells exposed to 100 µM zinc or no metal for 4 h in the presence
(H-7) or absence (NI) of H-7. The fusion protein
was purified by immunoprecipitation and subsequently transferred to
nitrocellulose membranes. The identification of
MTF-1-myc-his (MTF-1), and phosphorylated serine
(P-ser) was accomplished by Western immunoblot analysis
using anti-mMTF-1 and anti-phosphoserine antibodies, respectively. The
arrowhead indicates the location of the MTF-1 fusion
protein.
|
|
 |
DISCUSSION |
It is well documented that metal-activated MT transcription is
mediated primarily through the MRE-binding transcription factor MTF-1.
Although this protein was discovered almost a decade ago, the mechanism
by which metals activate transcription via MRE/MTF-1 interactions is
still largely unresolved. Previous studies indicate that
metal-inducible transcription requires several processes: nuclear
translocation, DNA binding, and transcriptional activation. Here we
report that activation of MT transcription via the MRE is dependent on
interactions with several signal transduction pathways and a change in
the level of MTF-1 phosphorylation.
The initial examination of MTF-1 activity demonstrated that
transcription depends on the binding of this factor to the MRE (17).
The binding of MTF-1 to MREs requires the occupancy of zinc finger 1 with zinc (24). These observations lead to the hypothesis that the
biological activity of MTF-1 may be homologous to that of the yeast
transcription factors ACE-1 and AMT-1, which function as copper
sensors, binding metal to activate transcription (46). The sensor model
of MTF-1, however, cannot explain the activation of MTF-1/MRE-mediated
transcription by other metals or stressors. Occupancy of the zinc
fingers by other transition metals even inhibits MTF-1-binding to DNA
in vitro (47). Thus, zinc is required for the formation of
zinc fingers and DNA binding. DNA binding, however, is not synonymous
with transcriptional activation. This is supported by the observations
that metal-inducible, MTF-1/MRE-mediated transcription is completely
blocked with PKC and casein kinase II inhibitors (Figs. 2 and 3), but
these agents do not inhibit MTF-1 binding to DNA (Fig. 6).
Recent reports identified a second component in the activation of
mammalian MT transcription: the metal- and stress-inducible translocation of MTF-1 from the cytoplasm to the nucleus (42, 48). Our
studies demonstrate that, following metal exposure, the phosphorylated
form of MTF-1 accumulates in the nucleus (Fig. 1). It is reasonable to
hypothesize that modifications of specific residues could control
nuclear translocation and transcriptional activation. It has been
reported that, in response to IL-12 induction, STAT-4 is phosphorylated
at both tyrosine and serine residues, which leads to its activation and
nuclear translocation (49). The unique tyrosine kinase phosphorylation
site in human MTF-1, Tyr140, is contiguous with the MTF-1
nuclear localization sequence 133KRKEVKR139
(42). Phosphorylation of this residue may contribute to the regulation
of MTF-1 nuclear transport. It should be noted that the location of the
unique, putative tyrosine phosphorylation site that is contiguous with
nuclear localization sequence is conserved in vertebrate MTF-1 proteins.
The binding of MTF-1 to DNA is highly correlated with transcriptional
activation; however, a mechanistic link has not been described. Results
presented in this report and previous studies indicate that DNA binding
can be disparate from transcriptional activation (32, 42). It has been
clearly demonstrated that, under conditions where MT transcription is
inhibited, DNA binding still occurs. Furthermore, the binding of MTF-1
to MREs increases. This increase may be caused by a change in the
affinity of MTF-1 for DNA following a change in the level of
phosphorylation. It may also be the result of an increase in
concentration of nuclear-MTF-1 caused by either a higher level of
nuclear transport or de novo synthesis of MTF-1.
The observations that (a) MTF-1 is phosphorylated,
(b) its level of phosphorylation increases in response to
metal exposure, and (c) several kinase inhibitors block or
attenuate metal-inducible MT transcription support a model in which
transcriptional activation via the MTF-1/MRE interaction is controlled
by several signal transduction pathways that ultimately affect the
level of MTF-1 phosphorylation. A codicil to this hypothesis is that
the interaction among several signaling pathways may "fine-tune"
the basal and inducible activity of MTF-1.
In the presence of the PKC inhibitor H-7, the level of MTF-1
phosphorylation increases (Fig. 7). This is surprising at first glance,
because H7, staurosporine, and BIM-I are potent inhibitors of
metal-inducible MT transcription (Fig. 2). Although contradictory, these results are consistent with a model in which metal-activated transcription is controlled by a change in the phosphorylation pattern
of MTF-1 that also involves dephosphorylation. A dephosphorylation activation mechanism is not without precedence. A similar mechanism is
responsible for activating the binding of c-jun to the AP-1 promoter
elements. The ability of c-Jun to bind DNA is a result of the
activation of a phosphatase by PKC, which dephosphorylates residues
adjacent to the DNA-binding domain, subsequently allowing AP-1 binding
(50). Although c-Jun is dephosphorylated prior to DNA binding, it must
remain phosphorylated at serine 63 and 73 to maintain proper function
(51, 52). A similar requirement could explain why serine residues in
MTF-1 remain phosphorylated in the presence of zinc and cadmium.
In the dephosphorylation model, only transcriptional activation of
MTF-1 is controlled by the removal of specific phosphorylated residues.
The total level of MTF-1 phosphorylation may be greater following
exposure to metals or stress, as shown in Fig. 1; however, specific
residues are dephosphorylated to activate transcription. The
dephosphorylation of MTF-1 is performed by a "MTF-1 phosphatase," whose activity may be controlled by upstream regulatory proteins.
The inhibitor studies indicate that metal-activated MT transcription
via MTF-1/MRE interactions is controlled by signal transduction pathways that involve PKC, casein kinase II, tyrosine kinase, and
calcium. The activation of the signal transduction pathways associated
with these kinases by metals and other environmental stressors has been
well documented (36, 53, 54). The activity of casein kinase II is also
affected by environmental stressors. In response to oxidative stress,
casein kinase II translocates to the nucleus, and the enzymatic
activity of the kinase increases (54, 55). The stress-inducible
increase in heme oxygenase-1 transcription is dependent, in part, on
the activity of tyrosine kinase (56).
The ability of PKC inhibitors and activators to affect the steady-state
levels of MT mRNA, and the results presented in this report
indicate that the MAP kinase signaling pathway directly regulates MT
transcription, through MTF-1/MRE interactions. Transition metals and
oxidative stress have been shown to modulate the activity of several
members of the MAP kinase signaling cascade (57, 58). Recently, c-Jun
N-terminal kinase has been shown to contribute to the regulation of
metal-inducible MTF-1 transcriptional activation (32). In addition, p38
and extracellular signal-regulated kinase 1/2 are also involved in
controlling metal-inducible
transcription.2
The observation that multiple signal transduction pathways contribute
to the ability of MTF-1 to regulate MT transcription provides an
explanation to the observation that deletion of various regions in
MTF-1 affects its ability to activate transcription. However, no single
domain could be assigned as the "metal-activation" domain (23).
Because potential targets of the various signal transduction pathways
are located throughout the protein, it is likely that changing the
phosphorylation status of several of these residues would control
metal-activated transcription.
Exposure to metals, organic chemicals, physical stress (heat, cold,
radiation), intracellular damage, and physiologic agents (hormones,
second messengers) causes an increase the steady-state level of MT
mRNA (6, 59-62). In addition, several of these non-metal stressors
activate MT transcription via MREs (11, 28, 30, 63). The observation
that multiple signal transduction pathways ultimately converge at
MTF-1, to activate MT transcription, provides a mechanistic link
between exposure to structurally unrelated stressors and the activation
of MT transcription. Potentially any stressor that can activate an
MTF-1-regulating signal transduction pathway could increase MT
transcription. Furthermore, agents that activate parallel signal
transduction pathways that converge with PKC, casein kinase II, and
tyrosine kinase-regulated pathways will affect MT transcription.
Although originally isolated as the transcription factor that controls
MT expression, MTF-1 has been shown to be essential for normal liver
development (64). Recently, several non-MT genes have been identified
that contain MREs in their upstream regulatory region and the level of
expression of which is affected by the loss of MTF-1 (65). Several of
these genes have roles in mediating the stress response; however, for
others, intracellular stress has not reported to affect their
expression. These observations suggest that MTF-1 may be a more general
transcription factor, and not limited to controlling stress response
genes. The ability of several signal transduction pathways to affect
MTF-1 activity may contribute to its activity in regulating liver
development and non-stress response genes.
A detailed analysis of the specific residues in MTF-1 that are modified
following exposure to zinc, cadmium or other stressors, and various
kinase inhibitors will help to define how each signaling pathways
affects the level of MTF-1 phosphorylation. The effects of individual
and combinatorial site-specific mutations on the ability of MTF-1 to
regulate MT transcription will be required to determine the precise
mechanism by which metals and other stressors activate transcription
via MTF-1/MRE interactions and the functional relationship between the
phosphorylation of specific residues and the in vivo
activity of MTF-1.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Glen K. Andrews (University of
Kansas Medical Center, Kansas City, KS) for anti-MTF-1 antisera
and the metallothionein-CAT reporter plasmids.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant R01 ES09949 (to J. H. F.) and grants from the
Swiss National Science Foundation and the Kanton Zürich (to
W. S.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Duke University,
Box 90328, Durham, NC 27708-0328. E-mail: jonf@duke.edu.
Published, JBC Papers in Press, March 28, 2002, DOI 10.1074/jbc.M110631200
2
J. H. Freedman and W. Schaffner,
unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
MT, metallothionein;
EMSA, electrophoretic mobility shift assay;
MRE, metal-responsive
element;
MTF-1, metal-responsive transcription factor;
mMTF-1, mouse
MTF-1;
hMTF-1, human MTF-1;
CAT, chloramphenicol acetyltransferase;
PKC, protein kinase C;
H-7, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine dihydrochloride;
BIM-I, bisindolylmaleimide;
DRB, 5,6-dichloro-1- -D-ribofuranosylbenose;
BAPTA-AM, bis-(o-aminophenoxy)-N,N,N',N'-tetraacetic
acid;
TPA, 12-O-tetradecanoylphorbol-13-acetate;
A-23187, calcium ionophore ionomycin;
VSV, vesicular stomatitis virus;
DMEM, Dulbecco's modified Eagle's medium;
Ni-NTA, nickel-nitrilotriacetic acid.
 |
REFERENCES |
| 1.
|
Hamer, D. H.
(1986)
Annu. Rev. Biochem.
55,
913-951[Medline]
[Order article via Infotrieve]
|
| 2.
|
Kagi, J. H.,
and Schaffer, A.
(1988)
Biochemistry
27,
8509-8515[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Freedman, J. H.,
and Peisach, J.
(1989)
Biochem. Biophys. Res. Commun.
164,
134-140[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Thornalley, P. J.,
and Vasak, M.
(1985)
Biochim. Biophys. Acta
827,
36-44[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Kelly, E. J.,
Sandgren, E. P.,
Brinster, R. L.,
and Palmiter, R. D.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
10045-10050[Abstract/Free Full Text]
|
| 6.
|
Durnam, D. M.,
and Palmiter, R. D.
(1984)
Mol. Cell. Biol.
4,
484-491[Abstract/Free Full Text]
|
| 7.
|
Garrett, S. H.,
Xiong, X.,
Arizono, K.,
and Brady, F. O.
(1992)
Int. J. Biochem.
24,
1669-1676[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Rimoldi, D.,
Flessate, D. M.,
and Samid, D.
(1992)
Radiat. Res.
131,
325-331[Medline]
[Order article via Infotrieve]
|
| 9.
|
Sato, M.,
and Bremner, I.
(1993)
Free Radic. Biol. Med.
14,
325-337[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Tamai, K. T.,
Liu, X.,
Silar, P.,
Sosinowski, T.,
and Thiele, D. J.
(1994)
Mol. Cell. Biol.
14,
8155-8165[Abstract/Free Full Text]
|
| 11.
|
Murphy, B. J.,
Andrews, G. K.,
Bittel, D.,
Discher, D. J.,
McCue, J.,
Green, C. J.,
Yanovsky, M.,
Giaccia, A.,
Sutherland, R. M.,
Laderoute, K. R.,
and Webster, K. A.
(1999)
Cancer Res.
59,
1315-1322[Abstract/Free Full Text]
|
| 12.
|
Nebes, V. L.,
DeFranco, D.,
and Morris, S. M., Jr.
(1988)
Biochem. J.
255,
741-743[Medline]
[Order article via Infotrieve]
|
| 13.
|
Searle, P. F.,
Stuart, G. W.,
and Palmiter, R. D.
(1985)
Mol. Cell. Biol.
5,
1480-1489[Abstract/Free Full Text]
|
| 14.
|
Culotta, V. C.,
and Hamer, D. H.
(1989)
Mol. Cell. Biol.
9,
1376-1380[Abstract/Free Full Text]
|
| 15.
|
Yu, C. W.,
and Lin, L. Y.
(1995)
Biochim. Biophys. Acta
1262,
150-154[Medline]
[Order article via Infotrieve]
|
| 16.
|
Viarengo, A.,
Burlando, B.,
Ceratto, N.,
and Panfoli, I.
(2000)
Cell. Mol. Biol.
46,
407-417[Medline]
[Order article via Infotrieve]
|
| 17.
|
Radtke, F.,
Heuchel, R.,
Georgiev, O.,
Hergersberg, M.,
Gariglio, M.,
Dembic, Z.,
and Schaffner, W.
(1993)
EMBO J.
12,
1355-1362[Medline]
[Order article via Infotrieve]
|
| 18.
|
Heuchel, R.,
Radtke, F.,
Georgiev, O.,
Stark, G.,
Aguet, M.,
and Schaffner, W.
(1994)
EMBO J.
13,
2870-2875[Medline]
[Order article via Infotrieve]
|
| 19.
|
Brugnera, E.,
Georgiev, O.,
Radtke, F.,
Heuchel, R.,
Baker, E.,
Sutherland, G. R.,
and Schaffner, W.
(1994)
Nucleic Acids Res.
22,
3167-3173[Abstract/Free Full Text]
|
| 20.
|
Dalton, T. P.,
Solis, W. A.,
Nebert, D. W.,
and Carvan, M. J., 3rd.
(2000)
Comp. Biochem. Physiol. B Biochem. Mol. Biol.
126,
325-335[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Auf der Maur, A.,
Belser, T.,
Elgar, G.,
Georgiev, O.,
and Schaffner, W.
(1999)
Biol. Chem.
380,
175-185[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Zhang, B.,
Egli, D.,
Georgiev, O.,
and Schaffner, W.
(2001)
Mol. Cell. Biol.
21,
4505-4514[Abstract/Free Full Text]
|
| 23.
|
Radtke, F.,
Georgiev, O.,
Muller, H. P.,
Brugnera, E.,
and Schaffner, W.
(1995)
Nucleic Acids Res.
23,
2277-2286[Abstract/Free Full Text]
|
| 24.
|
Bittel, D. C.,
Smirnova, I. V.,
and Andrews, G. K.
(2000)
J. Biol. Chem.
275,
37194-37201[Abstract/Free Full Text]
|
| 25.
|
Andrews, G. K.
(2000)
Biochem. Pharmacol.
59,
95-104[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Chen, X.,
Chu, M.,
and Giedroc, D. P.
(1999)
Biochemistry
38,
12915-12925[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Chen, X.,
Agarwal, A.,
and Giedroc, D. P.
(1998)
Biochemistry
37,
11152-11161[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Palmiter, R. D.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
1219-1223[Abstract/Free Full Text]
|
| 29.
|
Datta, P. K.,
and Jacob, S. T.
(1997)
Biochem. Biophys. Res. Commun.
230,
159-163[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Dalton, T. P., Li, Q.,
Bittel, D.,
Liang, L.,
and Andrews, G. K.
(1996)
J. Biol. Chem.
271,
26233-26241[Abstract/Free Full Text]
|
| 31.
|
Adams, T. K.,
and Freedman, J. H.
(2000)
in
Metal Ions in Biology and Medicine
(Centeno, J. A.
, Collery, P.
, Vermet, G.
, Finkelman, R. B.
, Gibb, H.
, and Etienne, J.-C., eds), Vol. 6
, pp. 694-697, John Libbey Eurotext, Montrouge, France
|
| 32.
|
LaRochelle, O.,
Gagné, V.,
Charron, J.,
Soh, J.-W.,
and Séguin, C.
(2001)
J. Biol. Chem.
276,
41879-41888[Abstract/Free Full Text]
|
| 33.
|
Hofmann, K.,
Bucher, P.,
Falquet, L.,
and Bairoch, A.
(1999)
Nucleic Acids Res.
27,
215-219[Abstract/Free Full Text]
|
| 34.
|
Laychock, S. G.,
Duzen, J.,
and Simpkins, C. O.
(2000)
Mol. Cell. Endocrinol.
165,
179-187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Yu, C. W.,
Chen, J. H.,
and Lin, L. Y.
(1997)
FEBS Lett.
420,
69-73[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Beyersmann, D.,
and Hechtenberg, S.
(1997)
Toxicol. Appl. Pharmacol.
144,
247-261[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Stohs, S. J.,
Bagchi, D.,
Hassoun, E.,
and Bagchi, M.
(2000)
J. Environ. Pathol. Toxicol. Oncol.
19,
201-213[Medline]
[Order article via Infotrieve]
|
| 38.
|
Whisler, R. L.,
Goyette, M. A.,
Grants, I. S.,
and Newhouse, Y. G.
(1995)
Arch. Biochem. Biophys.
319,
23-35[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Karin, M.
(1998)
Ann. N. Y. Acad. Sci.
851,
139-146[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Ausubel, F. M.
(1998)
Current Protocols in Molecular Biology on CD-ROM
, John Wiley & Sons, New York
|
| 41.
|
Graham, F. L.,
and van der Eb, A. J.
(1973)
Virology
52,
456[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Saydam, N.,
Georgiev, O.,
Nakano, M. Y.,
Greber, U. F.,
and Schaffner, W.
(2001)
J. Biol. Chem.
276,
25487-25495[Abstract/Free Full Text]
|
| 43.
|
Dalton, T.,
Palmiter, R. D.,
and Andrews, G. K.
(1994)
Nucleic Acids Res.
22,
5016-5023[Abstract/Free Full Text]
|
| 44.
|
Searle, P. F.
(1990)
Nucleic Acids Res.
18,
4683-4690[Abstract/Free Full Text]
|
| 45.
| Deleted in proof
|
| 46.
|
Winge, D. R.
(1998)
Prog. Nucleic Acids Res. Mol. Biol.
58,
165-195[Medline]
[Order article via Infotrieve]
|
| 47.
|
Bittel, D.,
Dalton, T.,
Samson, S. L.,
Gedamu, L.,
and Andrews, G. K.
(1998)
J. Biol. Chem.
273,
7127-7133[Abstract/Free Full Text]
|
| 48.
|
Smirnova, I. V.,
Bittel, D. C.,
Ravindra, R.,
Jiang, H.,
and Andrews, G. K.
(2000)
J. Biol. Chem.
275,
9377-9384[Abstract/Free Full Text]
|
| 49.
|
Athie, M. V.,
Flotow, H.,
Hilyard, K. L.,
and Cantrell, D. A.
(2000)
Eur. J. Immun.
30,
1425-1434[CrossRef]
|
| 50.
|
Boyle, W. J.,
Smeal, T.,
Defize, L. H. K.,
Angel, P.,
Woodgett, J. R.,
Karin, M.,
and Hunter, T.
(1991)
Cell
64,
537-584
|
| 51.
|
Kallunki, T., Su, B.,
Tsigelny, I.,
Sluss, H. K.,
Derijard, B.,
Moore, G.,
Davis, R.,
and Karin, M.
(1994)
Genes Dev.
8,
2996-3007[Abstract/Free Full Text]
|
| 52.
|
Pulverer, B. J.,
Kyriakis, J. M.,
Avruch, J.,
Nikolakaki, E.,
and Woodgett, J. R.
(1991)
Nature
353,
670-674[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Pfundt, R.,
van Vlijmen-Willems, I.,
Bergers, M.,
Wingens, M.,
Cloin, W.,
and Schalkwijk, J.
(2001)
J. Pathol.
193,
248-255[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Sayed, M.,
Kim, S. O.,
Salh, B. S.,
Issinger, O. G.,
and Pelech, S. L.
(1656)
J. Biol. Chem.
275,
16569-16573[CrossRef]
|
| 55.
|
Gerber, D. A.,
Souquere-Besse, S.,
Puvion, F.,
Dubois, M. F.,
Bensaude, O.,
and Cochet, C.
(2000)
J. Biol. Chem.
275,
23919-23926[Abstract/Free Full Text]
|
| 56.
|
Masuya, Y.,
Hioki, K.,
Tokunaga, R.,
and Taketani, S.
(1998)
J. Biochem. (Tokyo)
124,
628-633[Abstract/Free Full Text]
|
| 57.
|
Stohs, S. J.,
Bagchi, D.,
Hassoun, E.,
and Bagchi, M.
(2001)
J. Environ. Pathol. Toxicol. Oncol.
20,
77-88[Medline]
[Order article via Infotrieve]
|
| 58.
|
Ding, W.,
and Templeton, D. M.
(2000)
Biochem. Biophys. Res. Commun.
273,
718-722[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Arizono, K.,
Peterson, K. L.,
and Brady, F. O.
(1993)
Life Sci.
53,
1031-1037[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Hermesz, E.,
Abraham, M.,
and Nemcsok, J.
(2001)
Comp. Biochem. Physiol. C Toxicol. Pharmacol.
128,
457-465[CrossRef][Medline]
[Order article via Infotrieve]
|
| 61.
|
Karin, M.,
Andersen, R. D.,
Slater, E.,
Smith, K.,
and Herschman, H. R.
(1980)
Nature
286,
295-297[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Imbra, R. J.,
and Karin, M.
(1987)
Mol. Cell. Biol.
7,
1358-1363[Abstract/Free Full Text]
|
| 63.
|
Samson, S. L.,
and Gedamu, L.
(1998)
Prog. Nucleic Acids Res. Mol. Biol.
59,
257-288[Medline]
[Order article via Infotrieve]
|
| 64.
|
Gunes, C.,
Heuchel, R.,
Georgiev, O.,
Muller, K. H.,
Lichtlen, P.,
Bluthmann, H.,
Marino, S.,
Aguzzi, A.,
and Schaffner, W.
(1998)
EMBO J.
17,
2846-2854[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
Lichtlen, P.,
Wang, Y.,
Belser, T.,
Georgiev, O.,
Certa, U.,
Sack, R.,
and Schaffner, W.
(2001)
Nucleic Acids Res.
29,
1514-1523[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
X. He and Q. Ma
Induction of Metallothionein I by Arsenic via Metal-activated Transcription Factor 1: CRITICAL ROLE OF C-TERMINAL CYSTEINE RESIDUES IN ARSENIC SENSING
J. Biol. Chem.,
May 8, 2009;
284(19):
12609 - 12621.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Xue, X. Li, W. Zhu, C. Wu, G. Yang, and C. Zheng
Cotton metallothionein GhMT3a, a reactive oxygen species scavenger, increased tolerance against abiotic stress in transgenic tobacco and yeast
J. Exp. Bot.,
January 1, 2009;
60(1):
339 - 349.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Chen, H. Hua, K. Balamurugan, X. Kong, L. Zhang, G. N. George, O. Georgiev, W. Schaffner, and D. P. Giedroc
Copper sensing function of Drosophila metal-responsive transcription factor-1 is mediated by a tetranuclear Cu(I) cluster
Nucleic Acids Res.,
May 1, 2008;
36(9):
3128 - 3138.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Yan, Y. Song, C. P. Wong, K. Hardin, and E. Ho
Zinc Deficiency Alters DNA Damage Response Genes in Normal Human Prostate Epithelial Cells
J. Nutr.,
April 1, 2008;
138(4):
667 - 673.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Murphy, T. Kimura, B. G. Sato, Y. Shi, and G. K. Andrews
Metallothionein Induction by Hypoxia Involves Cooperative Interactions between Metal-Responsive Transcription Factor-1 and Hypoxia-Inducible Transcription Factor-1{alpha}
Mol. Cancer Res.,
March 1, 2008;
6(3):
483 - 490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Miller, S. Hanke, A. M. Hinsby, C. Friis, S. Brunak, M. Mann, and N. Blom
Motif Decomposition of the Phosphotyrosine Proteome Reveals a New N-terminal Binding Motif for SHIP2
Mol. Cell. Proteomics,
January 1, 2008;
7(1):
181 - 192.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Gulati, S. A. Ochsner, and S. J. Henning
Molecular properties of side population-sorted cells from mouse small intestine
Am J Physiol Gastrointest Liver Physiol,
January 1, 2008;
294(1):
G286 - G294.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Koizumi, P. Gong, K. Suzuki, and M. Murata
Cadmium-responsive Element of the Human Heme Oxygenase-1 Gene Mediates Heat Shock Factor 1-dependent Transcriptional Activation
J. Biol. Chem.,
March 23, 2007;
282(12):
8715 - 8723.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. M. Roos, O. Vesterberg, and M. Nordberg
Metals in motor neuron diseases.
Experimental Biology and Medicine,
October 1, 2006;
231(9):
1481 - 1487.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Egli, H. Yepiskoposyan, A. Selvaraj, K. Balamurugan, R. Rajaram, A. Simons, G. Multhaup, S. Mettler, A. Vardanyan, O. Georgiev, et al.
A family knockout of all four Drosophila metallothioneins reveals a central role in copper homeostasis and detoxification.
Mol. Cell. Biol.,
March 1, 2006;
26(6):
2286 - 2296.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Othumpangat, M. Kashon, and P. Joseph
Eukaryotic Translation Initiation Factor 4E Is a Cellular Target for Toxicity and Death Due to Exposure to Cadmium Chloride
J. Biol. Chem.,
July 1, 2005;
280(26):
25162 - 25169.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. J. Serajee, R. Nabi, Hailang Zhong, and A.H.M. Mahbubul Huq
Polymorphisms in Xenobiotic Metabolism Genes and Autism
J Child Neurol,
June 1, 2004;
19(6):
413 - 417.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Chen, B. Zhang, P. M. Harmon, W. Schaffner, D. O. Peterson, and D. P. Giedroc
A Novel Cysteine Cluster in Human Metal-responsive Transcription Factor 1 Is Required for Heavy Metal-induced Transcriptional Activation in Vivo
J. Biol. Chem.,
February 6, 2004;
279(6):
4515 - 4522.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. C. Rutherford and A. J. Bird
Metal-Responsive Transcription Factors That Regulate Iron, Zinc, and Copper Homeostasis in Eukaryotic Cells
Eukaryot. Cell,
February 1, 2004;
3(1):
1 - 13.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Mattie and J. H. Freedman
Copper-inducible transcription: regulation by metal- and oxidative stressresponsive pathways
Am J Physiol Cell Physiol,
February 1, 2004;
286(2):
C293 - C301.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
B. Zhang, O. Georgiev, M. Hagmann, C. Gunes, M. Cramer, P. Faller, M. Vasak, and W. Schaffner
Activity of Metal-Responsive Transcription Factor 1 by Toxic Heavy Metals and H2O2 In Vitro Is Modulated by Metallothionein
Mol. Cell. Biol.,
December 1, 2003;
23(23):
8471 - 8485.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Saydam, F. Steiner, O. Georgiev, and W. Schaffner
Heat and Heavy Metal Stress Synergize to Mediate Transcriptional Hyperactivation by Metal-responsive Transcription Factor MTF-1
J. Biol. Chem.,
August 22, 2003;
278(34):
31879 - 31883.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jiang, P. J. Daniels, and G. K. Andrews
Putative Zinc-sensing Zinc Fingers of Metal-response Element-binding Transcription Factor-1 Stabilize a Metal-dependent Chromatin Complex on the Endogenous Metallothionein-I Promoter
J. Biol. Chem.,
August 8, 2003;
278(32):
30394 - 30402.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Majumder, K. Ghoshal, D. Summers, S. Bai, J. Datta, and S. T. Jacob
Chromium(VI) Down-regulates Heavy Metal-induced Metallothionein Gene Transcription by Modifying Transactivation Potential of the Key Transcription Factor, Metal-responsive Transcription Factor 1
J. Biol. Chem.,
July 3, 2003;
278(28):
26216 - 26226.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Daniels, D. Bittel, I. V. Smirnova, D. R. Winge, and G. K. Andrews
Mammalian metal response element-binding transcription factor-1 functions as a zinc sensor in yeast, but not as a sensor of cadmium or oxidative stress
Nucleic Acids Res.,
July 15, 2002;
30(14):
3130 - 3140.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|