HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 24, 21269-21277, June 14, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/24/21269    most recent M200550200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Conway, C. Articles by Barry, J. D. Search for Related Content PubMed PubMed Citation Articles by Conway, C. Articles by Barry, J. D. Social Bookmarking                      What's this?

Ku Is Important for Telomere Maintenance, but Not for Differential Expression of Telomeric VSG Genes, in African Trypanosomes^*

Colin Conway, Richard McCulloch, Michael L. Ginger^§, Nicholas P. Robinson, Alison Browitt, and J. David Barry^¶

From the Wellcome Centre for Molecular Parasitology, University of Glasgow, Anderson College, 56 Dumbarton Road, Glasgow, G11 6NU, Scotland, United Kingdom

Received for publication, January 17, 2002, and in revised form, March 25, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Trypanosome antigenic variation, involving differential expression of variant surface glycoprotein (VSG) genes, has a strong association with telomeres and with DNA recombination. All expressed VSGs are telomeric, and differential activation involves recombination into the telomeric environment or silencing/activation of subtelomeric promoters. A number of pathogen contingency gene systems associated with immune evasion involve telomeric loci, which has prompted speculation that chromosome ends provide conditions conducive for the operation of rapid gene switching mechanisms. Ku is a protein associated with eukaryotic telomeres that is directly involved in DNA recombination and in gene silencing. We have tested the hypothesis that Ku in trypanosomes is centrally involved in differential VSG expression. We show, via the generation of null mutants, that trypanosome Ku is closely involved in telomere length maintenance, more so for a transcriptionally active than an inactive telomere, but exhibits no detectable influence on DNA double strand break repair. The absence of Ku and the consequent great shortening of telomeres had no detectable influence either on the rate of VSG switching or on the silencing of the telomeric promoters of the VSG subset that is expressed in the tsetse fly.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The heterodimeric protein Ku, which consists of the subunits Ku70 and Ku80 (or Ku86), associates tightly in a sequence-independent fashion with free ends of double strand DNA and has been associated with a range of nuclear functions in different eukaryotes (reviewed in Refs. 1-3), including DNA repair, retrotransposition (4), gene silencing, transcriptional reinitiation (5), chromosome maintenance, and chromosome localization. Recently, homologues possibly associated with DNA repair have been discovered also in prokaryotes (6, 7). Ku is central to the non-homologous end joining (NHEJ)¹ pathway for DNA double strand break repair in which double strand breaks with dissimilar ends can be rejoined with minimal error (8). A main function of Ku is to bind to DNA and recruit proteins, such as the catalytic subunit of mammalian DNA-dependent protein kinase, that catalyze steps in the repair process, although a weak helicase activity has been ascribed by some to Ku itself (1). Ku also plays a major role in telomere length maintenance in yeasts such that the deletion of Ku genes causes shortening of the telomere tract (9-11). This function of Ku again is thought to operate mainly through its interaction with other molecules (12, 13). The NHEJ function of Ku is prevented from acting at telomeres by other telosome proteins such as Taz1 (14), and indeed the presence of Ku is required for the prevention of recombination at the free ends of telomeres (15, 16).

In the phenomenon known as telomere position effect (TPE), telomere-proximal genes in yeast become transcriptionally silent in a reversible manner (17). The deletion of KU genes in Saccharomyces cerevisiae prevents the silencing (18), although the removal of Ku from Schizosaccharomyces pombe does not have this effect (11). Although TPE has been demonstrated where reporter genes have been inserted experimentally into telomeres (17, 19), there is only one example of it occurring naturally. A screen of telomere-proximal genes on a number of S. cerevisiae chromosomes revealed that, although generally they are not subject to TPE, one does appear to be silenced in that way (20).

Pathogenic microorganisms commonly use contingency gene systems that, by undergoing random and rapid mutational events, create phenotypic diversity during infection and can enable evasion of host immune systems (21-23). Contingency genes often are members of large gene families of which only one is expressed at a time, and the mutational events can include a random switch between expression of individual members of the family. It is common for contingency genes, including the one that is expressed, to be located at telomeres (24-26). Just why telomeres are so popular for such genes is unknown, but it has been speculated that the high rates of recombination between telomeres contribute to diversification within the family. It has also been proposed that telomeric location is more directly involved in phenotype switching by using effects such as TPE to enable transcriptional switching between members of the family (25, 27-29). The sleeping sickness parasite Trypanosoma brucei has a variant surface glycoprotein (VSG) protective coat that undergoes extensive antigenic variation during evasion of host immunity (reviewed in Refs. 23, 24, and 30-32). When antibodies kill trypanosomes expressing a specific VSG, a minority of cells that have switched to expression of a distinct VSG survive and multiply. Each trypanosome has a family of probably hundreds of VSG genes, most of which are located in tandem arrays within chromosomes, but a sizeable minority of which are located at the many telomeres in this genome. To obtain exclusive expression of VSGs, trypanosomes transcribe them singly and only at telomeric sites known as bloodstream expression sites (BESs). Although there can be occasional transcriptional switches between BESs, the main route to VSG switching is the replacement of the VSG in the BES with a copy of a silent VSG (33), probably by homologous recombination (34). However, it is not known yet whether special, telomere-associated mechanisms enhance recombination into BESs, and a role for telomere-associated recombination-promoting proteins is a possibility. Ku, interacting with proteins other than those preventing recombination at the free end of the telomere, is a candidate.

It is also possible to invoke Ku, in its role as mediator of TPE, as a candidate for regulating differential expression and repression of the distinct set of VSGs employed when the VSG coat first appears in the metacyclic trypanosome stage in the salivary glands of the tsetse (Glossina) vector (reviewed in Refs. 29 and 35). In that stage, a subset of telomeric genes known as MVSGs becomes differentially activated at the transcriptional level, generating a population diverse for VSGs. As these are the only trypanosome protein-coding genes known to have their own promoters, and to be subject to absolute control by transcription initiation, it has been speculated that they have achieved such control through the operation of a TPE on the MVSG promoters, which are only ~5 kb from the telomere tract (29). Here, we examine the functions of Ku in trypanosomes and test the hypothesis that it is important for VSG switching in the bloodstream stage and that it is also important for the silencing of MVSG genes prior to the metacyclic stage.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Trypanosome Strains and Transformation-- Bloodstream form cells (T. brucei 221a trypanosomes (MITat 1.2a) of strain S427 (36)) were grown in vitro at 37 °C in HMI-9 medium (37). For study of MVSGs, we used the procyclic stage of T. brucei EATRO 795 (38) maintained in vitro at 27 °C in SDM-79 medium (39). For trypanosome transformations, 5 × 10⁷ cells were electroporated with ~5 µg of restriction-digested, phenol/chloroform-extracted, and ethanol-precipitated plasmid DNA. Electroporation was performed as described previously (34). Cells were allowed to recover for 18 h before drug selection. Bloodstream form transformants were selected on semisolid agarose plates. Procyclic transformants (10⁵ cells) were selected in 10 ml of liquid medium supplemented with ~10⁶ untransformed cells. Transformant populations were subsequently cloned using conditioned SDM-79 medium in 96-well plates.

Cloning and Sequencing T. brucei KU70 and KU80 Genes-- Using detailed searching of the Sanger and TIGR trypanosome genome databases, we obtained entries recognized as putative KU70 and KU80 homologue short fragments (see "Results"). From these, we designed the following oligonucleotides: KU705' CCGAATTCGGGGAGGGTACGTCAGCGGG; KU703' CCAAGCTTCAAGCTCTCGATTTGGATAGC; KU805' GAATTCTTCCTCTGCGTGCCGTTGAC; KU803' GAATTCGCACCTCTTCACCTACCGTC (EcoRI underlined, HindIII in bold). PCR was carried out with ~3 pmol of each primer with an initial 10-min denaturation at 95 °C followed by 30 cycles of 95 °C for 1 min, 65 °C for 1 min, and 72 °C for 1 min. Products of 248 bp (KU70) and 214 bp (KU80) were cloned into pBluescript (Stratagene). The sequence was determined on both strands using ABI-PRISM automated sequencing with custom-designed primers. An insert sequence was subsequently used to probe a T. brucei ILTat 1.2 genomic library (Sau3A partial digests in -GEM-12; gift of Nils Burman). This initially allowed the isolation of two DNA fragments for each gene believed to contain putative KU70 and KU80 sequence. Once again, these clones were sequenced on both strands by ABI-PRISM automated sequencing, yielding the open reading frames (ORFs) described under "Results."

Generation and Analysis of T. brucei KU70 and KU80 Knockouts-- Two constructs were used to delete each gene, using two rounds of transformation. Each construct contained ~400 bp of targeting sequence derived from sequences immediately upstream and downstream of either ORF, meaning that transformants delete the entire ORF. Targeting flanks for each gene were amplified by PCR using genomic DNA and Pfu DNA polymerase (Stratagene). KU70 5' flank primers: 5'-CCTCTAGAGAGGCGCTTCTCAATCTAAT-3'; 5'-CCTCTAGATATCACGCGGTACCCAGGTT-3'. KU70 3' flank primers: 5'-CCTTGGGCCCAACCATTGCGAGTGCGCGTT-3'; 5'-CCTTGGGCCCAGAACTCGAGCCTTGCAGTGGGATTCTCTA-3'. KU80 5' flank primers: 5'-CCTCTAGACAGCCAGCAGCGCTTCAATA-3'; 5'-CCTCTAGAACGGAAAGCCATATTGGAG-3'. KU80 3' flank primers: 5'-CCTTGGGCCCGAGAAACAAAGTCACATATAAATA-3'; 5'-CCTTGGGCCCAGAACTCGAGTGAGATGTGGCGAACAGAGGAGTA-3' (ApaI underlined, XhoI in bold, and XbaI italicized). Each 5' flank product was digested with XbaI and cloned independently into both pTBT and pTPT (gifts of M. Cross and P. Borst, the Netherlands Cancer Institute). pTBT contains the 400-bp blasticidin S deaminase ORF (BSR) flanked by 240 bp of 5' and 330 bp of 3' processing signals derived from the 5' and 3' flanks of T. brucei -tubulin ORF. pTPT contains identical processing signals flanking the 600-bp puromycin N-acetyltransferase (PAC) ORF . Amplified 3'-targeting flanks for each gene were independently digested with ApaI and cloned into both pTBT and pTPT already containing the respective 5'-targeting flank. The final transformation constructs were digested with NotI and XhoI prior to being transformed into T. brucei, and transformants were selected with 10 µg·ml¹ blasticidin or 1 µg·ml¹ puromycin.

Correct integration of cassettes into both KU loci was determined by Southern blot analysis. Genomic DNA from KU wild type and mutant cell lines was digested with EcoRI and separated on a 0.6% agarose gel. The gel was subsequently Southern-blotted onto Hybond XL (Amersham Biosciences) and probed with the same KU70 and KU80 ORF-derived sequences used to probe the genomic library. Following hybridization, the blots were washed to a final stringency of 0.2× SSC, 0.1% SDS at 65 °C. A 12-kb fragment corresponding to intact KU70 was detected in both wild type and heterozygous cell lanes but was absent in the homozygous mutants. Two bands were present in KU80 wild type lanes due to allelic differences (~9 and 15 kb). One of these bands was lost upon disruption of the first allele, whereas both were lost in ku80 homozygous mutants. Probing the blots with KU70 and KU80 5'-flanking sequence confirmed the correct integration of the BSR and PAC resistance cassettes. Again, the blots were washed to a final stringency of 0.2× SSC, 0.1% SDS.

Re-expressing KU70 in the Homozygous Knockouts-- Construct pCC101 was used to reintroduce KU70 to its original locus. The entire KU70 ORF, along with 620 bp of 5'-flanking sequence, was isolated as a 2.9-kb PCR-amplified fragment using the following primers: KU70RE-EXPFOR, 5'-GGCCAAGTTAACGCTTCAGCTGATGGTCGCC-3', KU70RE-EXPREV; 5'-GGATCGGTTAACGCGCAACCGAGGAGGAAACC-3' (ApaI underlined). The fragment was amplified using a 10-min denaturation step followed by 30 cycles of 1 min at 95 °C, 1 min at 55 °C, and 6 min at 72 °C. This was followed by 10 min at 72 °C. This reaction was carried out using Pfu DNA polymerase, and the fragment was cloned into a unique HpaI restriction enzyme site in pNR101. This placed the KU70 sequence upstream of a construct with ~400 bp of actin intergenic sequence at the 5' flank of the bleomycin resistance gene and 330 bp of an --tubulin intergenic region at the 3'end. In the homozygous mutants, the 620 bp of KU70 5' flank and - intergenic region act as targeting flanks, allowing KU70 to be reintroduced into the disrupted locus. The only potential difference in expression is that 3' processing is provided by the actin intergenic region rather than the natural KU70 3' signals. The pCC101 was linearized with NotI prior to electroporation, and transformants were selected on semisolid agarose plates containing 2.0 µg·ml¹ bleomycin (Invitrogen). Integration of re-expression cassettes was tested by Southern blot analysis; genomic DNA was digested with EcoRI, separated on a 0.6% agarose gel, Southern-blotted, and probed with the KU70 ORF sequence. Each transformant had integrated the KU70 re-expression cassette, as expected. The control construct used in this analysis (pRM450) contains the bleomycin-resistant gene (BLE) surrounded by the same processing signals as in pTBT/pTPT and targets the tubulin array. This was cut with NotI and XhoI for transformation and targets the tubulin locus.

Generation and Analysis of Trypanosome VSG Switchers-- The method used to measure frequencies at which the various cell lines switch their VSG coat has been described previously (34). Mice immunized against the VSG221 coat were injected with 5 × 10⁷ trypanosomes of the clones 3174.2 wild type (wt), 70Pac3.1+/, 70Pac4.2+/, 70Pac3.1B/, or 70Pac4.2B/. The mice were sacrificed by cardiac puncture 24 h later, and trypanosomes were isolated and cloned in 96-well plates as described previously (40). The number of switched clones that grew through was used to calculate the frequency of switching events and assumed an in vivo doubling time of 8 h.

Viability and Growth of ku70 Mutants in the Presence of DNA Damaging Agents-- To test the ability of ku70 mutants to grow and divide in the presence of the DNA damaging agents methyl methanesulfonate (MMS; Sigma) or phleomycin (Cayla), a subclonal viability assay was adopted. Cell lines were grown to a maximum density of 2 × 10⁶ cells·ml¹ but more typically from 5 × 10⁵ to 1 × 10⁶ cells·ml¹. Each cell line was then diluted to a concentration of 25 cells·ml¹ in HMI-9 with or without MMS or 50 cells·ml¹ for phleomycin. Each mutagen was titrated against wild type trypanosomes to determine the sublethal range. To assess the effect of MMS on growth, the diluted cells were spread over a 96-well culture dish (5 cells/well for MMS, 2 cells/well for phleomycin, minimum densities giving reproducible growth data), and the number of wells with growing trypanosome populations were counted after 7-9 days. In vitro growth rates were measured by diluting mid-log bloodstream trypanosomes to a concentration of 1 × 10⁵·ml¹ in 1.5 ml of HMI-9 medium in 24-well culture dishes. Cell concentrations were measured using a hemocytometer (Sigma).

Telomere Length Maintenance Assay-- Wild type, heterozygotic, and homozygotic KU70 and KU80 cell lines were subcloned on semisolid agarose HMI-9 plates. Multiple clones for each were then grown to a density of 2 × 10⁶ trypanosomes·ml¹, and genomic DNA was prepared and digested with EcoRI or AgeI depending on the expression site under analysis. EcoRI cuts 3 kb upstream of VSG221, which is located in the active expression site. AgeI cuts just within the 5' end of the coding sequence of the VO2 gene in the transcriptionally inactive expression site analyzed. Genomic DNA digests were separated on a 0.6% agarose gel, Southern-blotted onto Hybond XL (Amersham Biosciences), and probed with the amino terminus region of either VO2 or VSG221.

Analysis of Transcriptional Status of Metacyclic VSGs-- Three previously characterized metacyclic VSG loci were used to analyze the transcriptional status of MVSGs in the procyclic stage. Total RNA from KU70 wild type, heterozygous, and homozygous mutant cell lines was prepared using TRIzol. cDNA was generated using random hexamers and Superscript II reverse transcriptase (following protocols from Invitrogen). Integrity of cDNA was tested using a control PCR on cDNA to amplify RNA polymerase I mRNA as described previously (41). Three characterized MVSG loci, MVSG1.22, 1.61, and 1.63, were examined by PCR for the presence of transcripts both proximal to the promoter and around the VSG. PCR was carried out on the cDNAs with ~3 pmol of upstream and downstream primers with an initial 10-min denaturation at 95 °C followed by 30 cycles of 95 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min. These reactions were carried out using TaqDNA polymerase (Abgene Ltd.) for each locus except the MVSG1.61 promoter proximal region, where Pfu DNA polymerase was used with 2 mM MgSO₄ and a lower annealing temperature of 50 °C. The PCR primers were designed as follows: MVSG1.22 promoter proximal, primer 5' ends were +29 and +214 from the transcription start site defined from metacyclic nascent transcripts,² and VSG coding sequence primer 5' ends were +426 and +666 from the ATG start codon, which is 2934 bp from the transcription start; MVSG1.61 proximal promoter ends were +28 and +287 from transcription start, and coding sequence ends were 5 and +305 from ATG, which is 2783 bp from the transcription start; MVSG1.63 proximal promoter ends were +59 and +230 from transcription start, and coding sequence ends were +621 and +837 from ATG, which is 2988 bp from the transcription start.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Trypanosome Ku Homologues Are Not Colinear-- As neither Ku70 nor Ku80 has a high degree of interspecies similarity even at the polypeptide level (42), the T. brucei genome sequence databases were blast-searched individually with all known homologues. Although most hits were unique to each query sequence, some were shared by more than one. Detailed searching of databases, using Smith-Waterman algorithms, supported the view that these common hits did indeed correspond to Ku homologues. Using PCR-amplified fragments based on these sequences as probes, full-length trypanosome sequences were obtained by the isolation of overlapping genomic clones from our existing genomic library. Sequence analysis revealed complete open reading frames (trypanosomes are almost fully intronless) potentially encoding polypeptides of 81 kDa for the Ku70 homologue and 69 kDa for the Ku80 homologue. It was possible to align parts of those sequences with the primary homology regions (PHRs) of other Ku homologues by Clustal W analysis (Fig. 1). The predicted sizes of the trypanosome Ku proteins are the inverse of what occurs in other organisms, and their designation is complicated further by the general relatedness of Ku70 and Ku80 and the dispersion of homologous sequences throughout the proteins. Our belief that the larger protein corresponds to Ku70 relies on the outcome of blastp and PSI-blast searching, which routinely place it closer to Ku70 than Ku80 proteins, and the presence at its carboxyl-terminal of a partial putative DNA binding SAP domain (6, 43) that has the secondary structure potential of other SAP sequences. Trypanosome Ku80 likewise detects mainly Ku80 sequences in blast searching. It does not have a recognizable DNA-dependent protein kinase binding sequence found at the end of vertebrate Ku80 proteins, but neither do the yeast Ku80 proteins.

View larger version (120K): [in this window] [in a new window]   Fig. 1.   Alignment of the amino acid sequences of eukaryotic Ku proteins. Amino acid residues are shown in single letter code, and the predicted T. brucei polypeptides are compared with Ku70 and Ku80 polypeptide sequences from Homo sapiens, Xenopus laevis, Rhipicephalus appendiculatus, Arabidopsis thaliana, Drosophila melanogaster, S. pombe, and S. cerevisiae. Residues that are identical for either set of polypeptides are shown in a black background with conserved residues represented in a gray background. These alignments depict only the predicted PHRs as defined by Gell and Jackson (42); PHR1 to 5 are residues 49-61, 94-128, 444-518, 539-551, and 584-611, respectively, for T. brucei Ku70, and 6-18, 18-53, 327-399, 408-420, and 462-489 for T. brucei Ku80.

Homology-based modeling using JPRED (jura.ebi.ac.uk:8888/) reinforced the similarity of the trypanosome sequences to known Ku proteins of other organisms and also suggested a likely reason for most of the extra length of the trypanosome Ku70. Essentially all  helices and  strands in the crystal structure of the human protein (44) are present in the predicted trypanosome Ku70 structure, except in the region of the ring that encircles DNA. Although in other species there are about 50 residues between the G and M strands, the trypanosome has about 120 amino acids. It is intriguing that trypanosome Ku80 has a typical 75 residues in the corresponding region, revealing an asymmetry between the two monomers in the ring region.

Null Mutants Have Normal Growth-- To analyze the function of Ku, initially looking for general phenotypes described previously in other organisms and then questioning possible specific roles in VSG switching, we adopted the approach of deleting both alleles of either KU to generate null mutants. Genomic Southern analysis revealed that both KU70 and KU80 probably are single copy genes (data not shown), an interpretation subsequently confirmed during gene knockouts. Initially, we deleted genes in bloodstream stages of T. brucei S427 grown in vitro. In the 3174.2 strain, which is marked with the HYG and NEO antibiotic resistance genes in its transcriptionally active telomere, we deleted the first KU70 copy using the puromycin resistance cassette (PAC), obtaining the independent clones, 70P3.1(+/) and 70P4.2(+/). Both then had the second allele deleted with the blasticidin resistance cassette (BSR), generating the clones 70P3.1B(/) and 70P4.2B(/). A number of subclones of each of these were derived, enabling the study of events in individual sublineages. A similar approach was used for KU80, except that blasticidin resistance was used first, followed by puromycin. This generated the independent heterozygotic clones 80B1.1(+/) and 80B1.3(+/), from which were derived the homozygous mutant clones 80B1.1P(/) and 80B1.3P(/), respectively.

The first phenotype examined was growth. The population doubling time of wild type 3174 trypanosomes (9.35 and 9.75 h in two experiments) compared well with those of the heterozygous mutants 70P3.1(+/) (10.25 h), 70P4.2(+/) (10.25 h), 80B1.1(+/) (10 h), and 80B1.3(+/) (9.12 h), as well as those of the null mutants 70P3.1B(/) (9.75 h), 70P4.2B(/) (10 h), 80B1.1P(/) (9 h), and 80B1.3P(/) (9.25 h). Ku therefore is not essential for bloodstream trypanosome growth, and its absence causes no detectable increase in population doubling time, indicating that there is neither a general delay in the cell cycle nor chronical death of some of the population.

Ku Is Essential for Maintenance of a Transcriptionally Active Telomere-- Telomere length maintenance depends on Ku. In T. brucei, it is possible to monitor the length of individual telomeres because of the subtelomeric location of individual VSG genes. By digesting DNA with a restriction enzyme with a site upstream, but not downstream, of a VSG and then probing for that gene, a fragment containing the entire telomere tract can be detected. We have studied two distinct VSGs. The 221 gene is in the transcriptionally active telomere in the bloodstream trypanosomes under study. The VO2 gene has one copy in a silent telomere and a second copy that, being within a chromosome, is flanked on both sides by restriction sites. For KU70, the clones 70P3.1(+/) and 70P4.2(+/), as well as a number of subclones of 70P3.1B(/) and 70P4.2B(/), were examined. Similarly, for KU80, we studied the clones 80B1.1(+/) and 80B1.3(+/) and the homozygous deletion clones 80B1.1P(/) and 80B1.3P(/).

We initially looked at the effect the absence of Ku had on the telomere immediately downstream of the transcriptionally active expression site, 221 (Fig. 2A). Subclones were derived for each independent homozygous and heterozygous KU mutant. One subclone from each independent KU80 mutant was used (Fig. 2C), whereas a more extensive analysis was carried out for KU70 (Fig. 2B). In this, five subclones were derived from each independent homozygous mutant and the progenitor wild type cell line, and a total of five heterozygous subclones were also analyzed. Terminal restriction fragment sizes were measured by digestion with EcoRI and Southern blot analysis. For homozygous mutants, these were generally smaller than those seen for heterozygous or wild type cell lines (Fig. 2), indicating an impairment of telomere maintenance or an increase in telomere degradation.

View larger version (70K): [in this window] [in a new window]   Fig. 2.   Telomere length maintenance in KU mutants. A, a map of the end of the active expression site with the telomere tract represented by a series of arrows, and an EcoRI restriction enzyme site upstream of VSG221 gene (gray box) and the DNA sequence encoding the amino-terminal region of VSG221 used as a probe. The 70-bp repeats are represented by a black box. B, genomic DNA for 20 subclones from wt, heterozygotic (+/), and homozygotic (/) KU70 mutants digested with EcoRI, Southern-blotted, and probed with VSG221 sequence. Lanes 1-5, 3174.2 wt subclones 1-5; lanes 6-8, 70Pac4.2+/ subclones 1, 2, and 3; lanes 9 and 10, 70Pac3.1+/ subclones 1 and 2; lanes 11-15, 70Pac4.2B/ subclones 1-5; lanes 16-20, 70Pac3.1B/ subclones 1-5. C, genomic DNA from wt KU80 heterozygotes (80B1.1+/, 80B1.3+/) and homozygotic mutants (80B1.1P/, 80B1.3P/) digested with EcoRI, Southern-blotted, and probed for VSG221.

To quantify the extent of telomere loss in KU mutants, and to be certain that this phenotype was due to the loss of Ku, we reintroduced wild type Ku into its own locus using a co-transcribed bleomycin (BLE) resistance cassette (pCC101) and, as a control, we targeted BLE to the tubulin locus (pRM450). Four null mutant subclones (70P3.1B/5, 70P3.1B/4, 70P4.2B/3, 70P4.2B/5; Fig. 2B, lanes 20, 19, 13, and 15) were chosen for this experiment. Analysis of the active expression site (once again using EcoRI to release terminal restriction fragments) showed that in each case, re-expressors harbored longer telomere tracts than did the null mutants (Fig. 3). These were grown for an estimated 18 generations during selection for transformants and then 12 more generations in the absence of phleomycin, at which time they were analyzed for telomere tract length. Taking the fragment sizes for all these KU70 experiments, the transcriptionally active 221-telomere fragment was a mean 7.2 kb long (range 3-10 kb) in homozygous mutant trypanosomes and 10.3 kb long (range 9-15 kb) in the re-expressor trypanosomes. This fragment contains about 3 kb of non-telomere tract sequence.

View larger version (57K): [in this window] [in a new window]   Fig. 3.   Re-expression of KU70 in homozygous mutants increases telomere length in the active VSG221 expression site. Trypanosome homozygous mutant clones transformed with construct pCC101 and re-expressing Ku70 are indicated by //+, whereas controls transformed with the construct pRM450 are depicted by /. Genomic DNA was digested with EcoRI, separated by gel electrophoresis, Southern-blotted, and probed for VSG221. Molecular size markers are indicated to the left.

A Transcriptionally Inactive Telomere Is Less Prone to Length Changes in Ku Null Mutants-- We next looked at the effect disrupting Ku had on a transcriptionally inactive telomere (Fig. 4). This was carried out using restriction digestion with AgeI and Southern blot analysis. In this instance, three of the four subclones used in the 221 experiment were analyzed. The VO2 gene has one copy in a silent telomere and a second copy that, being within a chromosome, is flanked on both sides by restriction sites. Fragment sizes for the telomere downstream of VO2, measured on the same DNA samples and therefore identical lineages as for the 221 analysis, are 9.4 kb (9.1-10 kb) in homozygous mutants and 9.8 kb (9.5-10.5 kb) in re-expressors. The telomere immediately downstream of the VO2 gene has not been characterized, so we cannot say how much non-telomere sequence is present in the AgeI terminal restriction fragments.

View larger version (53K): [in this window] [in a new window]   Fig. 4.   Telomere length maintenance of an inactive expression site in Ku70 re-expressors. KU70 homozygous mutant clones re-expressing Ku70 are indicated by //+, whereas clones depicted by / were transformed with the control plasmid pRM450. Schematics to the right of the panel depict the VO2 VSG loci under investigation. The upper schematic shows the telomeric VO2 expression site with telomere repeats depicted as arrows, VSGVO2 gene depicted as a gray box, and 70-bp repeats depicted as a black box. An AgeI restriction site present upstream of the telomeric VO2 gene is shown, and the probe used for hybridization is depicted. The lower schematic shows the chromosomal internal VO2 gene and national flanking AgeI sites. Genomic DNA from each transformed KU70 subclone was digested with AgeI, Southern-blotted, and probed for VSGVO2. Molecular size markers are indicated to the left of the panel.

Ku Null Mutants Do Not Have a Detectable Deficiency in DNA Double Strand Break Repair-- The third general phenotype examined was sensitivity to MMS, which causes both single and double strand breaks (45), and to phleomycin (bleomycin family), which causes double strand breaks directly. The same clones as used for the initial growth analysis were grown in the continuous presence of MMS. Standard growth curves revealed a dose-response effect on the growth of wild type trypanosomes over the range 0.0003-0.0005% MMS. The wild type 3174.2 trypanosomes displayed population doubling times of 9.35 h in the absence of MMS, 13 h at 0.0003% MMS, 16.5 h at 0.0004%, and 28 h at 0.0005%. This compared well with those of the heterozygous mutants where population doubling times were 9.56 h in the absence of MMS, 12.4 h at 0.0003%, 16.6 h at 0.0004%, and 27.5 h at 0.0005%. Homozygous mutants displayed similar population doubling times: 9.13 h in the absence of MMS, 11.75 h at 0.0003%, 15 h at 0.0004%, and 25.25 h at 0.0005%. These results represent an average of two independently obtained data sets. Thus, for both heterozygous and homozygous mutants of both KU70 and KU80, the same dose-response effect occurred, indicating no increase in mutagen sensitivity in the mutants. Confirmation of the apparent lack of increased sensitivity in the mutants came from a clonal growth assay in which five trypanosomes were plated in each well of a 96-well plate and the percentage of wells displaying growth after 96 h was scored. This test is more sensitive but also more variable due to trypanosome founder effects. The assay showed, again, no increased sensitivity to MMS or to phleomycin, which we tested at two trypanosomes per well (Fig. 5).

View larger version (22K): [in this window] [in a new window]   Fig. 5.   Viability of KU70 mutants in the presence of mutagens. 3174.2 bloodstream form trypanosomes that had been unaltered in their KU70 gene (wt), had one allele disrupted (KU70+/), or had both alleles disrupted (ku70/) were plated in culture dishes containing increasing concentrations of MMS. The same heterozygous and homozygous mutant lines were tested also in phleomycin, as shown in the lower panel. Surviving populations were counted after 6-9 days and are expressed as a percentage of the total number of wells. The data are means of four readings (duplicate growth experiments of two independent lines). Error bars represent standard deviations.

Ku Null Mutants Are Not Impaired in Bloodstream VSG Switching-- Having established some of the general phenotypes predicted for KU genes, we next asked whether there is a specific role in the differential expression of VSG genes. In the bloodstream stage of T. brucei S427, switching occurs at a background rate and is achieved by a number of routes, including transcriptional switching between telomeres and gene duplication into telomeres. The marked strain we have used allows most of these activation mechanisms to be detected (40), providing a convenient means of testing for alteration in switch rate. This assay was applied to the KU70 mutant lines 70P3.1(+/), 70P4.2(+/), 70P3.1B(/), and 70P4.2B(/). All gave the rate of 0.1-0.6 × 10⁶ switch/cell/generation (Fig. 6), which is typical of wild type cells, there being no evidence for a significant decrease in switch rate in the absence of Ku70. Examination of the switching events from a selection of the switched variants recovered indicated further that there was no change in the relative levels of transcriptional versus recombinational VSG switching (data not shown).

View larger version (16K): [in this window] [in a new window]   Fig. 6.   VSG switching frequencies in KU70 mutants. Wild type cells (3174.2 wt) were compared with two KU70 heterozygous mutants (70P3.1+/, 70P4.2+/) and two homozygous mutants (70P3.1B/, 70P4.2B/). Each bar in this graph represents an independent experiment.

Ku Is Not Essential for Silencing of the Naturally Telomeric MVSG Genes-- VSG genes are first expressed in the metacyclic stage of the trypanosome life cycle, in the tsetse. Differential expression of the subset of telomeric genes used there, known as MVSG genes, occurs by transcriptional activation. In most life cycle stages, MVSGs are not expressed, but individual ones are activated in individual metacyclic trypanosomes. Here, we tested the hypothesis that the silencing of MVSGs in the procyclic (tsetse midgut) stage is exerted by a Ku-mediated telomere position effect. We have tried repeatedly to transmit T. brucei S427 through tsetse, to no avail (data not shown), so we have been unable to identify MVSGs in this strain. Therefore, we instead used T. brucei EATRO 795, which routinely develops to the metacyclic stage, permitting characterization of the MVSGs encoding the ILTat 1.22, 1.61, and 1.63 VSGs. We deleted both KU70 alleles in procyclic stage T. brucei EATRO 795 grown in vitro, creating the independent heterozygous, puromycin-resistant knockout cloned lines 70+/1 and 70+/2 and then their homozygous, blasticidin-resistant doubly deleted clonal descendants called, respectively, 70/1.1 and 70/2.1. RT-PCR was used to search for transcripts from two regions of each MVSG locus. The first, downstream of the transcription start sites (Fig. 7), would detect primary transcripts. The second, including the amino-terminal VSG coding sequence, would detect primary transcripts and stable RNA. The scant availability of metacyclic stage RNA prevented its use as a positive control, so instead of metacyclic cDNA, we used the corresponding trypanosome genomic DNA. Although this control (Fig. 7, A and B, lane 11) and an RNA POLI positive control for integrity of cDNA were both positive (Fig. 7C), no RT-PCR products were detected in wild type, heterozygous, or homozygous mutants for any of the three MVSG loci immediately downstream of their promoters (Fig. 7A). Similarly, nothing was detected for the coding region (Fig. 7B).

View larger version (62K): [in this window] [in a new window]   Fig. 7.   Transcriptional status of telomeric MVSGs in procyclic form KU70 mutants. RT-PCR analysis was undertaken with RNA from wild type and mutant lines. The telomeric environment of the three MVSGs (1.22, 1.61, and 1.63) examined is depicted in the top diagram; the promoter is shown as a black flag, the small number of 70-bp repeats is shown as a white box, and the VSG gene is shown as a white arrow. Converging arrows below the expression site show the positions of oligonucleotides used for PCR. A, PCR of the cDNA and mock cDNA for each MVSG proximal to the promoter. B, PCR of the three MVSG sequences. Lanes 1 (RT+) and 2 (RT) shown are for wild type cDNAs, lanes 3 (RT+) and 4 (RT) are from 70+/1.1, lanes 5 (RT+) and 6 (RT) are from 70+/1.2, lanes 7 (RT+) and 8 (RT) are from 70/1.1 (6), lanes 9 and 10 are from 70/1.2 (1), and lane 11 is a control PCR using the respective primers on EATRO 795 procyclic genomic DNA. C, RT-PCR amplification of the RNA polymerase I large subunit as a control for cDNA integrity. Lane order is identical to panels A and B, although no genomic DNA control was undertaken. Pol I, polymerase I.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We have cloned and characterized, by gene deletion, the trypanosome homologues of Ku70 and Ku80. Our analysis of telomere lengths revealed the telomere shortening phenotype that occurs in other eukaryotes, but the classical role in DNA damage repair by NHEJ was not detected. Our hypothesis that Ku is important in VSG recombinational or transcriptional control was not supported, revealing at least that the Ku-mediated TPE described for S. cerevisiae is not necessary for regulation of antigenic variation.

Due to the limitation that low sequence homology between Ku proteins from different species prevents construction of homology models based on the human Ku structure (44), our identification of these trypanosome sequences has relied on the five primary homology regions (42) and on our observation that most of the determined human  helices and  strands have counterparts, with corresponding spacing, in the trypanosome sequences. In this way, it became apparent that trypanosome Ku70 has an extra, ~70 residues in the ring that encircles DNA, immediately upstream of PHR3. This correlates well with the observed gaps between PHR2 and PHR3: 250 amino acids in human Ku70 (42) as compared with 315 residues in trypanosome Ku70. Although the human Ku80 PHR2-PHR3 gap (274 residues) is colinear with Ku70, that of trypanosome Ku80 is considerably shorter (273 residues) than in its presumed heterodimeric partner; perhaps trypanosome Ku70 has an extra loop available for interaction with other proteins. In common with other simple eukaryotes, trypanosome Ku80 lacks the carboxyl-terminal motif of higher eukaryotes for binding to the DNA-PK catalytic subunit (42), and we cannot find evidence for the catalytic subunit sequence in the (incomplete) trypanosome genome database. The trypanosome Ku70 contains what might be a SAP domain, in common with Ku70 from other species (6, 43).

Our data show that Ku is central to telomere length maintenance in trypanosomes and reveal that, in the presence of Ku, there are marked differences between short and long telomeres and between the transcriptionally active and inactive telomeres examined in the kinetics of telomere lengthening. Although quantification of the extent of telomere loss was complicated by the large terminal restriction fragment sizes involved, regrowth of short, more accurately sized telomeres could be monitored following reintroduction of KU70. The EcoRI terminal fragments liberated from the active telomeric 221 locus in null mutants were, on average, 3.1 kb shorter than in the Ku70 re-expressors after 30 population doublings. This difference was substantially lower for the transcriptionally inactive VO2 telomere, where reintroduction of Ku70 caused an average increase of only 400 bp. Transcriptionally active trypanosome telomeres have previously been demonstrated to grow faster than inactive telomeres (46). There was also a growth difference between particularly short (~1 kb) and much longer (>7 kb) telomeres upon re-expression of Ku70; the short telomeres extended by ~170 bp/population doubling, as compared with 103 bp/population doubling for the longer telomeres. Such rapid expansion resembles the growth of newly formed trypanosome telomeres (47). Our findings presumably reflect that telomere capping is less pronounced in transcriptionally active, or new, telomeres. Despite the great decrease in telomere length, no trypanosome clone analyzed appeared to have lost all telomeric sequence, and null mutant clones with terminal restriction fragments as short as 4 kb multiplied at the same rate as wild type cells even after 150 generations (data not shown). A length equilibrium was reached within such periods, indicating that the trypanosome has at least one alternative pathway for telomere maintenance, as has been observed in other organisms (reviewed in Ref. 48).

The main DNA repair role for Ku is in NHEJ reactions (49, 50). We found no difference between wild type, heterozygotic, or homozygotic KU mutants in their sensitivity to MMS, in contrast to rad51 mutants, which display increased MMS sensitivity in the same range of drug concentrations (34). We see also that there is not an increased sensitivity to phleomycin. It appears, therefore, that if Ku plays a role in the repair of trypanosome DNA damage, it would be masked by the greater prevalence of homologous recombination. To some extent, this is what happens in yeast KU mutants, where no increased MMS sensitivity is detectable in diploids, and the background role played by Ku is seen only when the more central homologous recombination gene RAD52 is also inactivated (9, 11, 18, 51), although there is a significant increase in sensitivity to bleomycin in both haploid and diploid stages (52). Indeed, wild type trypanosomes and S. cerevisiae nearly exclusively use homologous recombination when transfected, linearized DNA is integrated into the genome. Nevertheless, the trypanosome appears to have more capacity for alternative repair, such as is seen in the persistent resistance to phleomycin, and there is evidence for at least one Rad51-independent homologous recombination pathway (34). We have been unable to find NHEJ in wild type trypanosomes using an assay for recircularization of electroporated, restriction-digested plasmids,³ although chromosomal integration of linear DNA constructs with non-homologous flanking sequence gives some success.⁴ It remains possible that Ku-dependent NHEJ exists in trypanosomes but is not observed in these transformation experiments because DNA integration operates at only the S to M cell cycle phase, where homologous recombination may dominate in higher eukaryotes (53). Perhaps NHEJ is limited to the G₁ phase or to non-dividing trypanosome life cycle stages, when limited DNA replication occurs.

There has been much speculation as to why parasite contingency genes are found at telomeres. Besides the trypanosome VSGs, which are transcribed only from telomeric loci in the distinct metacyclic and bloodstream populations and have a large subset of silent genes at minichromosomal telomeres, there are examples in protozoa (25, 54), the fungus Pneumocystis (26), and even on linear plasmids in the bacterium Borrelia hermsii (55). These systems rely on the existence of a wide set of silent genes (or segments) and the expression of only one gene at a time. There is a constant pressure for expansion of the silent information, which probably is best served by DNA recombination, generating novel sequence combinations. Telomeres may enhance this process as they have high recombination rates and are able to recombine with each other promiscuously, independent of homology elsewhere on the chromosome (56). Whether telomeric location is directly associated also with singular contingency gene expression is unclear. Where the switch between different genes proceeds by promoter activation and deactivation, such as in Plasmodium or in trypanosome transcriptional switches, TPE has been invoked (25, 27, 28). However, early hopes that bloodstream VSG transcriptional switching was controlled by a TPE were not well supported by further experimental analysis (57), although a modified TPE was not ruled out. A degree of TPE of a reporter gene in T. brucei has been described (58), although the effect extended only some of the way toward the VSG promoter, which can be more than 45 kb from the telomere tract. A case for TPE controlling the MVSGs was more compelling because their promoters are only about 5 kb from the telomere tract and because the trypanosome is committed globally to post-transcriptional control of gene expression, raising the possibility that exploitation of TPE might have been an easy way for the trypanosome to achieve the transcriptional control that operates on MVSGs. Within the same type of genomic environment, most bloodstream VSG switching occurs by the non-reciprocal duplication of silent VSGs into the final 5 kb of chromosomes. Given this involvement of MVSG transcriptional silencing and telomere recombination, we have asked whether Ku is involved as a global regulator in the VSG system.

It is clear from the bloodstream switching assay, which we have used previously to demonstrate an important role for Rad51, that the absence of Ku has no influence on either recombinational or transcriptional switch mechanisms. Of technical necessity, this high throughput assay is performed with the S427 strain, which switches at background rates and with a bias against the recombinational mechanism(s); study of more rapidly switching trypanosomes is being developed. Although we find no evidence for Ku function in MVSG repression in the procyclic stage, it is not ruled out that Ku does have a necessary role in the differential expression of MVSGs in the metacyclic stage, when global silencing is lifted, but experiments to test that are very difficult, involving tsetse transmissions. Taking our findings together, we believe that Ku in trypanosomes does not have a necessary role in the VSG system. Furthermore, the great shortening of telomeres also did not alter VSG regulation, which would be consistent with the telomere not playing a major regulatory role in antigenic variation. Functionally, Ku in trypanosomes may act as in S. pombe, where it is involved in telomere maintenance but is not involved in TPE (11), rather than as in S. cerevisiae, where it plays both roles. Two possible reasons for Ku not being involved in VSG regulation are that it is not localized preferentially to telomeres, as in S. pombe, or that the structure of the chromosome end in trypanosomes differs qualitatively from that in other organisms, keeping Ku physically separate from the VSG genes. There is evidence in favor of the latter possibility. In S. cerevisiae, the telomere is thought to fold back, creating the capped structure that results in the TPE. In organisms with longer telomere tracts, a t-loop is formed in which it is believed the end of the telomere tract base-pairs within the DNA duplex further up the tract. In human cells and the protozoan Oxytricha, t-loops are long (59, 60), but recently it has been shown that, in T. brucei, they are shorter, being only ~1 kb long (61). We believe a consequence of this is that the complex of proteins associated with the chromosome end is held well away from VSGs, preventing the possibility of TPE. It may even be that evolution of the brief t-loop in trypanosomes has occurred as a means of divorcing telomere effects from the more exacting requirements of the VSG system.

	ACKNOWLEDGEMENTS

We are grateful to Steve Jackson and Steve Bell (Wellcome/Cancer Research Campaign Institute, Cambridge) for discussions about Ku and in particular for opinions on the trypanosome sequences. We thank Piet Borst and Mike Cross (Netherlands Cancer Institute) for the gift of plasmids.

	FOOTNOTES

^* This work was supported by the Wellcome Trust and the Royal Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AJ307890, AJ311845.

A Royal Society University Research Fellow.

^§ Present address: School of Biological Sciences, University of Manchester, 2.205 Stopford Building, Oxford Road, Manchester M13 9PT, UK.

^¶ A Wellcome Trust Principal Research Fellow. To whom correspondence should be addressed. Tel.: 0044141-330-4875; Fax: 0044141-330-5422; E-mail: j.d.barry@bio.gla.ac.uk.

Published, JBC Papers in Press, March 27, 2002, DOI 10.1074/jbc.M200550200

² M. L. Ginger, P. A. Blundell, and J. D. Barry, unpublished results.

³ C. Conway, J. D. Barry, and R. McCulloch, unpublished results.

⁴ C. Conway, R. McCulloch, and J. D. Barry, in preparation.

	ABBREVIATIONS

The abbreviations used are: NHEJ, non-homologous end joining; TPE, telomere position effect; VSG, variant surface glycoprotein; BES, bloodstream expression sites; ORF, open reading frame; RT, reverse transcription; MMS, methyl methanesulfonate; PHR, primary homology regions; wt, wild type.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES