HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 24, 22073-22084, June 14, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/24/22073    most recent M111644200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Besson, A. Articles by Yong, V. W. Search for Related Content PubMed PubMed Citation Articles by Besson, A. Articles by Yong, V. W. Social Bookmarking                      What's this?

The Anchoring Protein RACK1 Links Protein Kinase C to Integrin  Chains

REQUIREMENT FOR ADHESION AND MOTILITY^*

Arnaud Besson^§, Tammy L. Wilson, and V. Wee Yong^¶

From the Departments of  Oncology and ^¶ Clinical Neurosciences, University of Calgary, Calgary, Alberta T2N 4N1, Canada

Received for publication, December 6, 2001, and in revised form, March 25, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Integrin affinity is modulated by intracellular signaling cascades, in a process known as "inside-out" signaling, leading to changes in cell adhesion and motility. Protein kinase C (PKC) plays a critical role in integrin-mediated events; however, the mechanism that links PKC to integrins remains unclear. Here, we report that PKC positively regulates integrin-dependent adhesion, spreading, and motility of human glioma cells. PKC activation was associated with increased focal adhesion and lamellipodia formation as well as clustering of select integrins, and it is required for phorbol 12-myristate 13-acetate-induced adhesion and motility. We provide novel evidence that the scaffolding protein RACK1 mediates the interaction between integrin  chain and activated PKC. Both depletion of RACK1 by antisense strategy and overexpression of a truncated form of RACK1 which lacks the integrin binding region resulted in decreased PKC-induced adhesion and migration, suggesting that RACK1 links PKC to integrin  chains. Altogether, these results provide a novel mechanistic link between PKC activation and integrin-mediated adhesion and motility.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The tight control of cell adhesion and motility is crucial for a wide variety of physiological and pathological processes such as embryogenesis, inflammation, angiogenesis, wound healing, and tumor metastasis. Integrins are heterodimeric cell surface receptors that mediate cell-cell and cell-extracellular matrix (ECM)¹ interactions and have been involved in the regulation of cell growth, migration, survival, and metastasis (1-3). Eight integrin  subunits and 17  subunits have been identified to date, and these can form more than 20 distinct heterodimers (4). Integrin affinity and avidity are modulated by intracellular signaling cascades ("inside-out" signaling), leading to changes in adhesion and motility. Conversely, binding of integrins to ECM proteins elicits signals that are transduced into the cell ("outside-in" signaling) to regulate cell growth, migration, and survival. Integrins are central components of focal adhesions, in which they associate with cytoskeleton-associated proteins such as vinculin, talin, and paxillin, and signaling molecules such as focal adhesion kinase and integrin-linked kinase (3, 5). A number of intracellular signaling pathways have been involved in the regulation of integrin adhesive functions, including phosphatidylinositol 3-kinase, and the small GTP-binding proteins of the Ras and Rho families (1, 6). Among the proteins implicated in inside-out signaling, protein kinase C (PKC) has been found in many instances to play a crucial role in modulating integrin-mediated cell adhesion, spreading, and migration. However, the mechanism of action of PKC in these events remains elusive.

PKC is a family of cofactor-dependent serine/threonine kinases involved in the transduction of various biological signals such as proliferation, differentiation, apoptosis, and migration (7-9). Twelve PKC isoforms have been identified so far. They have been divided into three subfamilies based on their cofactor requirements for full activation. Conventional PKCs, , ₁, ₂, and , require Ca²⁺, diacylglycerol, and phospholipids such as phosphatidylserine for full activation. Novel PKCs, , , , , , and µ, are Ca²⁺-independent. Atypical PKCs,  and , are both Ca²⁺- and diacylglycerol-independent. Several lines of evidence indicate a critical role for PKC in integrin-mediated events. PKC activity is required for adhesion, spreading, migration, and focal adhesion and actin stress fiber assembly on various ECM substrates (10-13). In addition to its role in focal adhesion formation, PKC activation induces the translocation of focal adhesion kinase and proline-rich tyrosine kinase 2 to focal adhesions and their tyrosine phosphorylation in various cell systems (11-15). In some reports, the identity of the PKC isoform involved in integrin-mediated processes has been investigated. It appears that depending on the cell type, different PKC isoforms are involved in the regulation of integrin function (16-20). For example, in breast carcinoma cells, an interaction between integrin ₁ and PKC was demonstrated, and overexpression of PKC stimulated ₁-dependent migration by facilitating integrin ₁ endocytosis and recycling to the plasma membrane (20). Few studies have focused on the events upstream of PKC in the regulation of integrins (21-23). For instance, epidermal growth factor-induced integrin-mediated migration was dependent on PKC activity (22, 23), illustrating the role of PKC in inside-out signaling cascades. However, despite considerable evidence describing the importance of PKC in integrin-mediated events, the mechanism by which PKC regulates these processes remains poorly understood.

A means of PKC regulation is through their association with targeting proteins, providing a tight control of PKC subcellular localization and substrate specificity (8, 9). One such protein, RACK1 (Receptor for Activated C-Kinase 1), specifically binds to activated PKC (24, 25). RACK1 is a 36-kDa protein formed of seven WD-40 repeats; these repeats are usually involved in protein-protein interactions. RACK1 associates with other signaling proteins such as phospholipase C₁ (26) and the cAMP-specific phosphodiesterase PDE4D5 (27). RACK1 binding to the type I interferon receptor was required for the recruitment and activation of STAT1 by the receptor (28, 29). RACK1 was found to interact with Src family kinases and to inhibit their kinase activity; and RACK1 overexpression inhibited Src activity and cell proliferation (30, 31). RACK1 was constitutively bound to the common  chain of the interleukin-5/interleukin-3/granulocyte-macrophage colony-stimulating factor receptors and allowed the recruitment of PKC to the receptor after interleukin-5 or PMA stimulation (32). Thus, RACK1 may act as a scaffold or anchoring protein that regulates the localization of various signaling enzymes to specific subcellular compartments, to allow the formation of signaling complexes. Recently, RACK1 was found to interact with the membrane proximal region of the cytoplasmic tail of integrins ₁, ₂, ₃, and ₅, and RACK1-integrin binding was found to be dependent on the presence of PMA, suggesting the involvement of PKC in this interaction (33, 34). However, the functional significance of the interaction between RACK1 and integrins and the possible involvement of PKC in this interaction have not been investigated.

Migration and invasion of glioma cells, leading to tumor recurrence, are a major cause of mortality in glioma patients (35); however, the mechanism that these cells utilize to migrate is poorly understood. We have shown previously that U251N glioma cells express the PKC isoforms , , , , µ, and , and that PKC controls cell cycle progression and proliferation (36). In the present study, we report that PKC positively regulates integrin-dependent adhesion and motility in glioma cells. PKC activation induces focal adhesion, lamellipodia formation, and integrin clustering. Moreover, we provide novel evidence of an interaction between PKC and integrin  chains through the scaffolding protein RACK1 to regulate integrin-mediated adhesion and motility.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Constructs, Antibodies, and Reagents-- The cDNA for human PKC was from ATCC (80050); cDNAs for human PKC and human RACK1 were obtained from Dr. G. Finkenzeller (Institut für Molekulare Medizin, Freiburg, Germany) and Dr. D. Chang (UCLA, Los Angeles), respectively. PMA, bisindolylmaleimide I, calphostin C, rabbit anti-PKC antibodies (662-672), poly-L-lysine, laminin, vitronectin, and fibronectin were from Calbiochem. Rabbit anti-PKC antibodies were from Invitrogen. Monoclonal antibodies to integrin ₂ (mAb 1950Z), ₅ (mAb1956Z), _v (mAb1953Z), ₁ (mAb1951Z), and polyclonal antibodies to integrin b₅ (Ab1926), and b₁ (Ab1952) were from Chemicon. Rabbit anti-PKC (C-15),  (C-15), and µ (D-20) were from Santa Cruz Biotechnology. Rabbit anti-PKC antibodies were a gift from N. Groome (Oxford, UK). The monoclonal antibody to vinculin (hVIN-1) and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide thiazolyl blue (MTT) were from Sigma. Monoclonal antibodies to PKC (clone 3), PKC (clone 21), focal adhesion kinase (clone 77), RACK1 (clone 20, IgM), and integrin ₁ (clone 18) were from BD Transduction Laboratories. Secondary antibodies used in this study were from Jackson ImmunoResearch Laboratories with the exception of goat anti-mouse Alexa 488 and goat anti-rabbit Alexa 488 antibodies, which were from Molecular Probes.

Tissue Culture and Transfections-- The U251N human glioma cell line and culture conditions have been described previously (36). Stable transfections were performed using the calcium phosphate method; after selection, clones were isolated with cloning rings. Stably transfected cells were kept at all times in the presence of 400 µg/ml G418 (Calbiochem). As20 and As27, and Es1 and Es10 are clones stably overexpressing PKC and PKC, respectively. The PKC cDNAs were inserted in the pBKRSV vector (Invitrogen), in which the lac promoter has been deleted, as recommended by the manufacturer, to allow high expression levels under the control of the RSV promoter. For antisense studies, the PKC cDNA was cloned in antisense orientation in a pREP9 episomal vector (Invitrogen), and the RACK1 cDNA was inserted in antisense orientation in a pcDNA3.1 vector (Invitrogen). The truncated form of RACK1 (amino acids 204-317) was obtained by PCR from the full-length cDNA using the following primers: sense, ATTATGGGATCCCTCTGTGCTTCTGGA; antisense, GCGGCCGCCAGAGAGATGGAT. The PCR product was cloned into the pTARGET vector (Promega). Transient transfections were performed using the FuGENE 6 reagent (Roche Molecular Biochemicals) as described by the manufacturer, for 24 h before the experiment. The plasmid pTracer (Invitrogen), encoding the green fluorescent protein, was used to monitor transient transfection efficiency. The appropriate empty vector-transfected cells were used as control cells in each experiment.

Migration Assays-- Cells were seeded at 80% confluence in 60-mm dishes and grown for an additional 24 h. A linear scratch, ~1 cm wide, was performed using a rubber policeman across the diameter of the plate. The plate was then rinsed with phosphate-buffered saline (PBS) and refed with growth medium supplemented (or not) with the appropriate activator or inhibitor. Cells were incubated for a given time, rinsed with PBS, and fixed 10 min in 95% ethanol and 5% acetic acid at room temperature. Fixed dishes were then stained with hematoxylin overnight and rinsed with dideoxy H₂O. For each plate, pictures were taken on an inverted microscope (Olympus) at a magnification of ×50. The distance migrated from the scratch line by the cells at each time point was then measured (in mm) on the prints.

The migratory capacity of cells was also evaluated using Boyden chambers. 15,000 cells were plated into 8-µm pore size modified Boyden chambers. Cells were allowed to migrate for 16 h, fixed, and stained as described above. The cells that migrated to the bottom chambers were counted under the microscope, and the numbers displayed in the text represent an average from six different fields.

Subcellular Fractionation and Western Blotting-- The subcellular fractionation was performed as described previously (36). All other cell lysates were prepared in immunoprecipitation buffer (50 mM HEPES (pH 7.5), 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% glycerol, 0.1% Tween 20, 1% Nonidet P-40; complemented with 1 mM dithiothreitol, 10 mM -glycerophosphate, 10 mM NaF, 1 mM sodium orthovanadate, 10 µg/ml leupeptin, 10 µg/ml aprotinin, 10 µg/ml pepstatin A, and 1 mM phenylmethylsulfonyl fluoride). Cells were scraped from the plates, lysed on ice for 30 min, and homogenized. Cellular debris were eliminated by centrifugation for 10 min at 10,000 rpm. The protein concentration was determined using the Bio-Rad protein assay, and the indicated amount of protein was loaded for SDS-PAGE on 12% gels. Proteins were transferred onto polyvinylidene difluoride membranes (Immobilon; Millipore) for 3 h at 250 mA at 4 °C. Membranes were blocked in PBS containing 0.1% Tween 20 and 10% milk for 1 h. Membranes were incubated with primary antibodies overnight at 4 °C, and with secondary antibodies for 1 h at room temperature. All antibodies were diluted in PBS containing 0.1% Tween 20 and 3% milk, except for the 4G10 antibody, which was diluted in PBS containing 0.1% Tween 20 and 5% bovine serum albumin. ECL (Amersham Biosciences) was used for immunodetection.

Coimmunoprecipitations-- Cell lysates were prepared as described above for Western blotting. For each immunoprecipitation, 4 µg of the appropriate antibody, 300 µg of proteins, and 30 µl of protein A/G-agarose beads (Santa Cruz Biotechnology) were incubated for 3 h at 4 °C. For control immunoprecipitations, the primary antibody was replaced by a goat anti-mouse IgG + IgM (H+L). In the case of mouse IgM anti-RACK1 antibodies, 5 µg of goat anti-mouse IgG + IgM (H+L) was added to allow binding of the IgM to the beads. Immunoprecipitates were rinsed three times in immunoprecipitation buffer. The immunoprecipitates were subjected to Western blotting as described above.

Immunofluorescence-- Cells were grown on glass coverslips for 24 h before treatment. After the appropriate treatment, cells were rinsed in PBS and fixed in 1% paraformaldehyde at 37 °C for 20 min. Coverslips were stored in PBS at 4 °C until stained. Cells were permeabilized for 3 min in 0.2% Triton-X100, rinsed three times in PBS, and incubated for 1 h with primary antibodies diluted in antibody dilution buffer (PBS complemented with 3% bovine serum albumin, 0.05% Tween 20, and 0.08% sodium azide) at 37 °C. The coverslips were rinsed three times in PBS. Incubation with secondary antibodies (at a 1/500 dilution in antibody dilution buffer) was for 30 min at 37 °C. The coverslips were rinsed three times in PBS and mounted on glass slides. Images were obtained on a Leica DMRBE microscope with a 100× objective using a Spot charge coupled device camera. For focal adhesion counts, images were taken using a 40× objective, and counting was performed using the Image Pro image analysis software. A minimum of 160 cells was counted for each condition, and results are expressed as the number of focal adhesions/cell.

Adhesion Assays-- Plates were coated for 1 h at 37 °C with 10 µg/ml poly-L-lysine in PBS. Where needed, further coating with 10 µg/ml ECM proteins (laminin, vitronectin, or fibronectin) in PBS was performed overnight at 37 °C. Cells were trypsinized, counted, and diluted to a concentration of 5 × 10⁵ cells/ml in serum-free medium. When needed, aliquots of cells were incubated with the appropriate inhibitor at the indicated concentration for 15 min at 4 °C (with the exception of PMA, which was also added 12 h prior to the experiment and replenished at the time of the experiment). For the experiments in Fig. 5, 2.5 × 10⁵ cells were seeded in 24-well plates and incubated for 10 min at 37 °C. Plates were rinsed twice with PBS, and the remaining adhering cells were incubated for 90 min in medium containing 0.5 mg/ml MTT. After three rinses with PBS, the MTT stain was solubilized by incubation 10 min in dimethyl sulfoxide, and the absorbance was measured at 550 or 600 nm. Adhesion assays in Figs. 8 and 9 were performed in a similar manner but in 96-well plates, with only 2.5 × 10⁴ cells seeded per well.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PKC and  Play Opposite Roles in the Regulation of Glioma Cell Migration-- To determine whether PKC could play a role in glioma cell migration, we evaluated the motility of U251N glioma cells, in the presence or absence of PMA, a potent activator of conventional and novel PKC isoforms. PMA treatment increased the motility of cells over the 72-h period analyzed (Fig. 1, A and B). We have shown previously that U251N glioma cells express the PKC isoforms , , , , µ, and , but not ₁, ₂, , and  (36). To determine which isoform was responsible for increasing cell motility, we analyzed the translocation pattern, after PMA stimulation, of the six PKC isoforms expressed over a 72-h period. Translocation of PKC from the cytosol to the membrane is a hallmark of its activation (7). Upon PMA treatment, PKC and  were the only isoforms translocated from the cytosolic to the particulate fraction in these cells (Fig. 1C), as observed previously (36). PKC, , µ, and  remained unaffected by PMA (neither translocated nor down-regulated). PKC was totally down-regulated by 24 h of treatment and remained absent at 72 h. On the other hand, PKC was only partially down-regulated and remained translocated at 72 h.

View larger version (48K): [in this window] [in a new window]   Fig. 1.   PKC activation induces migration of human glioma cell. A, migration assays on U251N cells in the absence or presence of 100 nM PMA. Cells were fixed at the indicated times and stained with hematoxylin to measure the distance migrated. Results for this and all subsequent graphs are plotted as the mean ± S.E. These experiments were repeated five times. B, representative images of a migration experiment. Pictures were taken at a magnification of ×50. The point of origin of migration is indicated by arrows on both sides of this panel. C, PKC and  are translocated from the cytosolic (C) to the membrane fraction (particulate, P) after treatment with 100 nM PMA. PKC was totally down-regulated by 24 h and remained absent at 72 h. In contrast, PKC was only partially down-regulated and remained translocated at 72 h. PKC, , µ, and  were unaffected by PMA. PKC was 80 kDa,  was 90 kDa,  was 78 kDa,  was 78 kDa, µ was 115 kDa, and  was 72 kDa. 50 µg of protein was loaded per well.

To dissect the role of these two isoforms, we generated clones stably overexpressing either PKC or . Two representative clones for each isoform were used in this study; their respective expression levels are shown in Fig. 2A. The effect of PKC overexpression was compared with the wild type (U251N) and vector-transfected cells (pBK) in a motility assay (Fig. 2B). In the absence of PMA stimulation, the PKC-overexpressing clones (As20 and As27) migrated slightly slower than the wild type or control vector cells, and the PKC-overexpressing clones migrated slightly faster (Fig. 2B, left panel). However, when cells were incubated with 100 nM PMA, these differences were exacerbated, and it became clear that PKC overexpression increased motility, whereas PKC overexpression decreased cell motility (Fig. 2B, right panel). Together, these results suggest that PKC positively regulates glioma cell migration, whereas PKC plays an opposite role. To verify that the increased motility induced by PMA was caused by the activation of PKC, as PMA has been reported to activate other targets (37), we performed motility assays in the presence of two different PKC-specific inhibitors, calphostin C and bisindolylmaleimide I. The presence of either of these inhibitors substantially decreased the basal migration level (in the absence of PMA) of pBK and Es10 cells and completely abolished the increased motility induced by PMA in both cell lines (Fig. 2C), indicating that the effect of PMA on motility was indeed a consequence of PKC activation.

View larger version (39K): [in this window] [in a new window]   Fig. 2.   PKC positively regulates migration, whereas PKC has an opposite role. A, expression levels of PKC and  in wild type U251N cells, control vector-transfected cells (pBK), two clones overexpressing PKC (As20 and As27), and two clones overexpressing PKC (Es1 and Es10). Endogenous levels of PKC and  seem very low because of a short exposure to avoid saturating the signal in overexpressing clones. 50 µg of protein was loaded per well. B, migration assay on the different clones in the absence of PMA (left panel) or in presence of 100 nM PMA (right panel) over a 72-h period. PKC-overexpressing cells migrate faster than control cells; PKC-overexpressing cells have a reduced migration compared with control cells. C, inhibition of PMA-induced migration of pBK and Es10 cells by PKC inhibitors. 200 nM calphostin C (CalpC) or 5 µM bisindolylmaleimide I (Bis) was added at the beginning of the experiment or 1 h before PMA stimulation. Cells were allowed to migrate for 48 h. The results in B and C are representative of three independent experiments. D, migration data using the modified Boyden chamber assay and a 16-h experimental period.

A modified Boyden chamber assay was also used to evaluate glioma cell motility. The higher sensitivity also allowed a shorter time point of 16-h migration to be employed. Fig. 2D shows that the PKC-overexpressing clones had higher basal levels of migration compared with parent or pBK vector control cells and that PMA treatment further increased migration. In contrast, as observed in the scratch assay (Fig. 2B), PKC clones had low basal or PMA-stimulated motility.

A potential contributing factor to the increased migration of cells across a scratch line is the proliferation rate, whereby a faster proliferating clone produces more cells in a given time than a slower growing clone to fill in the scratch area. Thus, clones plated on coverslips at a fixed density (10,000 cells/12-mm coverslip) were pulsed 24 h after with 10 µM bromodeoxyuridine (BrdUrd), a thymidine analog. After a 1.5-h BrdUrd pulse, cells were fixed and stained for BrdUrd incorporation as described previously (38). Cells were counterstained with Hoescht dye to label all nuclei, and the proportion of BrdUrd-positive cells in each clone was obtained (between 200 and 300 cells/coverslip, four coverslips/group, were analyzed). No difference was found in the basal proliferation rates of the different clones (vector, 29.2 ± 3.7%; Es1, 32.5 ± 1.6%; Es10, 36.4 ± 2.9; As20, 31.4 ± 2.1%).

PKC Activation Increases Focal Adhesion Formation-- Focal adhesions are the sites of interaction between a cell and its extracellular environment and play a critical role in cell adhesion and migration. PKC has previously been reported to regulate focal adhesion formation in other cell types (10-13); we therefore addressed whether PKC activation in glioma cells was affecting focal adhesions. PMA stimulation seemed to increase the number of focal adhesions as seen by vinculin and focal adhesion kinase staining (Fig. 3, A and B), although the cellular amounts of these molecules did not change after PMA treatment in Western blot analyses (data not shown), indicating that cellular distribution and activation, rather than levels of these molecules, were altered. By 24 h, these focal adhesions were clustered at the lamellipodia. Counting of focal adhesions numbers on vinculin-stained U251N cells clearly indicated an increase in the number of focal adhesion at 2 h and 24 h after PMA stimulation (Fig. 3C).

View larger version (60K): [in this window] [in a new window]   Fig. 3.   PKC activation increases the number of focal adhesion. A, 1/500 mouse anti-vinculin stain at various times after PMA stimulation of U251N glioma cells. B, 1/200 mouse anti-focal adhesion kinase stain. C, count of the number of focal adhesions/cell, using the Image Pro image analysis program. A minimum of 180 cells was counted for each time point. * = p < 0.001 compared with control in a one-way ANOVA with Tukey-Kramer multiple comparisons test.

To address more specifically the role of individual PKC isoforms in focal adhesion formation, we counted the number of focal adhesions (visualized by vinculin staining) in control vector (pBK), As27, and Es10 cells. The slower migrating As27 cells, overexpressing PKC, had a reduced number of focal adhesions. In contrast, the faster migrating Es10 cells, which overexpress PKC, exhibited an increased number of focal adhesions compared with control vector-transfected (pBK) cells (Fig. 4). These differences were still apparent after PMA stimulation (Fig. 4). Taken together, the data indicate that PKC, which positively regulates glioma cell migration, facilitates focal adhesion assembly. On the other hand, PKC overexpression reduces both the migratory ability of these cells and the number of focal adhesions.

View larger version (13K): [in this window] [in a new window]   Fig. 4.   Opposite effects of PKC and  overexpression on the number of focal adhesions. Counts of the number of focal adhesions/cell, in control vector-transfected cells (pBK), PKC-overexpressing cells (As27), and PKC-overexpressing cells at various time points after treatment with 100 nM PMA using the Image Pro image analysis program are shown. A minimum of 160 cells was counted for each time point. * indicates p < 0.001 compared with pBK control; ** is p < 0.001 compared with pBK, PMA 2 h; *** is p < 0.001 compared with pBK, PMA 24 h, in a one-way ANOVA with Tukey-Kramer multiple comparisons test. The number of focal adhesions in As27 cells at PMA 2 h was not determined.

Opposite Roles for PKC and  in the Modulation of Integrin-mediated Adhesion-- Integrins are crucial components of focal adhesions and mediate cellular attachment to ECM proteins. Because PMA stimulation increases the number of focal adhesions, we investigated whether integrin-mediated adhesion was altered after PKC activation in glioma cells, and more particularly by overexpression of either PKC or . We performed adhesion assays on various integrin substrates (laminin, vitronectin, and fibronectin), and poly-L-lysine was used as a control for integrin-independent adhesion (Fig. 5). Adhesion on poly-L-lysine was not affected significantly by PMA treatment or by the overexpression of either PKC or  (Fig. 5A). However, adhesion on laminin, vitronectin, and fibronectin was increased after PMA stimulation (Fig. 5, B, C, and D, respectively). More importantly, Es1 and Es10 cells that overexpress PKC exhibited an increased adhesion on all substrates tested, and adhesion was enhanced further by PMA (Fig. 5, B-D). On the other hand, PKC-overexpressing cells, As20 and As27, exhibited a reduced adhesion on fibronectin (Fig. 5D), and to a lesser extent on vitronectin (Fig. 5C), after PMA stimulation.

View larger version (24K): [in this window] [in a new window]   Fig. 5.   Opposite roles for PKC and  in the regulation of integrin-mediated adhesion. Adhesion assays on various substrates in the absence (control) or presence of 100 nM PMA, on empty vector (pBK) cells, or PKC-overexpressing (As20, As27), or PKC-overexpressing (Es1, Es10) cells. A, poly-L-lysine, used as a control non-integrin substrate; B, laminin; C, vitronectin; D, fibronectin; E, PMA-induced integrin-mediated adhesion of Es10 cells is blocked by PKC inhibitors. 5 µM bisindolylmaleimide I or 200 nM calphostin C was added 15 min before the adhesion assay. These results are representative of five independent experiments.

To confirm that the PMA-induced increase in adhesion was indeed a consequence of PKC activation, adhesion assays were performed on Es10 cells in the presence of the PKC inhibitors calphostin C or bisindolylmaleimide I (Fig. 5E). Bisindolylmaleimide I did not affect the basal adhesion level, but it completely abolished the PMA-induced adhesion. In contrast, calphostin C decreased both the basal and PMA-induced adhesion. Interestingly, PMA stimulation also increased cell spreading on integrin substrates, and PKC-overexpressing cells could spread more rapidly than wild type or pBK cells; on the other hand, cells overexpressing PKC had an impaired spreading (data not shown). Collectively, the data indicate that PKC positively regulates integrin-mediated adhesion, whereas PKC seems to regulate adhesion negatively on specific integrin substrates, such as fibronectin.

PKC Activation Induces the Clustering of Specific Integrin Receptors-- We next attempted to identify which integrins were involved in this process. Immunofluorescence analyses revealed that PMA treatment induced the clustering of specific integrin chains (Fig. 6), namely ₂, ₅, _v, ₁, and ₅. Integrin clustering was either localized in the cell periphery and lamellipodia (in the case of ₂, ₅, ₁, and ₅ chains, Fig. 6, A and B, D and E), and/or to focal adhesions (in the case of _v and ₁, Fig. 6, C and D). Staining for _v3 integrin showed a clustering to focal adhesions after PMA treatment (data not shown), similar to that observed for _v, suggesting that ₃ is also localized in focal adhesion. PMA treatment did not affect the localization of other integrin chains expressed on glioma cells (₁, ₃, ₄, ₆, and ₄) (data not shown). Measurement of integrin expression levels by Western blot indicated that changes in adhesion and integrin localization were not because of differences in integrin expression following PMA stimulation (data not shown). To ascertain that the PKC-induced changes observed in adhesion and integrin clustering were not caused by changes in cell surface expression of integrin, live glioma cells were stained for ₁ integrin at various times after PMA treatment. Flow cytometry analysis revealed no significant change in the mean intensity fluorescence of ₁ integrin after 1.5 or 24 h of PMA treatment (mean intensity fluorescence values: U251N control, 113; U251N 1.5 h PMA, 124; U251N 24 h PMA, 97; Es1 control, 120; Es1 1.5 h, 147; Es1 24 h, 131), indicating that PKC stimulation did not affect the cell surface levels of ₁ integrin. Altogether, these results suggest that PKC activation regulates the clustering of specific integrins, leading to increased adhesion, spreading, and migration.

View larger version (83K): [in this window] [in a new window]   Fig. 6.   PKC activation induces the clustering of select integrins. Upon PMA stimulation, several integrin chains are relocated either to the lamellipodia, in the case of integrin 2, 5, 1, and 5, or to focal adhesions, in the case of v and 1. Cells plated on glass coverslips were treated with 100 nM PMA for 2 h (middle column) and 24 h (right column) or with dimethyl sulfoxide (control, left column), fixed, permeabilized, and stained for specific integrin chains at a 1/100 dilution: A, mouse anti-2; B, mouse anti-5; C, mouse anti-v; D, mouse anti-1; E, rabbit anti-5.

RACK1 Links Activated PKC to Integrin  Chains-- Despite considerable evidence showing the importance of PKC in integrin-mediated processes, the mechanism by which PKC modulates integrin activity remains unclear. Interestingly, the PKC anchoring protein RACK1 was recently shown to bind the cytoplasmic tail of several  integrins (33, 34). To test whether RACK1 was involved in the integrin-mediated events induced by PKC activation in glioma cells, we performed coimmunoprecipitation experiments using PKC, RACK1, or integrin antibodies at various times after PMA treatment. Upon PMA stimulation, a rapid and stable association between PKC and RACK1 was detected; ₁ and ₅ integrins were also part of this complex (Fig. 7A). These results suggest that upon activation, PKC associates with RACK1 and with integrin  chains. To confirm the formation of a complex between RACK1, PKC, and integrin  chains, reciprocal immunoprecipitations were carried out using either RACK1 or ₁ integrin antibodies (Fig. 7, B and C, respectively). After PMA treatment, PKC (but not PKC), integrins ₁ and ₅ could be coprecipitated with RACK1 (Fig. 7B) and appear to form a complex stable over the 24-h period studied. Similarly, after PMA stimulation integrin ₁ associated with RACK1, PKC, and vinculin (Fig. 7C). Further confirmation of the interaction between integrin and RACK1 was provided by colocalization analyses of cells stained for RACK1 and integrin ₅ (Fig. 7D) or ₁ (data not shown). In the absence of PMA, RACK1 is mostly cytosolic. It is translocated to the membrane after PMA treatment, mainly to the lamellipodia, as is the case for ₅ integrin (Fig. 7D). Taken together, these results indicate that activated PKC associates with RACK1, and with ₁ and ₅ integrins. This is accompanied by the incorporation of focal adhesion proteins such as focal adhesion kinase and vinculin in these complexes.

View larger version (50K): [in this window] [in a new window]   Fig. 7.   Formation of a PKC·RACK1·integrin  chain complex after PKC activation by PMA. A, PKC immunoprecipitation shows the association with RACK1 and integrin 1 and 5 after PMA treatment. B, RACK1 immunoprecipitation shows the formation of a PMA-induced complex among RACK1, PKC, and integrin 1 or 5. In contrast, no PKC could be detected associated with RACK1 in these experiments. C, 1 integrin immunoprecipitation shows the association among the integrin chain, RACK1, PKC, and vinculin. In all cases, Control refers to immunoprecipitations on extracts made from U251N cells treated for 6 h with 100 nM PMA in which 5 µg of goat anti-IgG + IgM (H+L) antibodies was used. The results shown in A-C are representative of three independent experiments. D, colocalization of RACK1 (green) and 5 (red) in lamellipodia after PMA stimulation.

Collectively, the data suggest that the formation of PKC·RACK1-integrin complexes correlates with integrin clustering and increased number of focal adhesions and subsequently leads to the increased adhesion and migration observed after PKC activation.

RACK1 and PKC Are Required for PMA-induced Integrin-mediated Adhesion and Motility-- To establish the role of RACK1 and PKC in PMA-induced adhesion and migration, we utilized an antisense strategy to deplete partially cells of their endogenous PKC or RACK1. The respective expression levels of the control vector-transfected cells or antisense-transfected cells are displayed in Fig. 8A. Transient transfection efficiency was ~50%, as evaluated by expression of the green fluorescent protein after transfection of the pTracer vector. Depletion of the endogenous PKC, either by transient (Fig. 8B) or stable (Fig. 8C) transfection, and RACK1 by transient transfection (Fig. 8D), markedly reduced both the basal and PMA-induced adhesion on all integrin substrates compared with the respective control vector-transfected cells. Similarly, in both antisense PKC and antisense RACK1-transfected cells, both PMA-induced and basal migration were considerably reduced compared with wild type and control vector-transfected cells (Fig. 8E). These results confirm the role of PKC and RACK1 in mediating the effects of PMA on integrin-mediated functions.

View larger version (32K): [in this window] [in a new window]   Fig. 8.   RACK1 and PKC are required for PMA-induced integrin mediated adhesion and migration. A, PKC levels in U251N (wild type), pREP (control, empty vector), and cells transiently (Eas) or stably (Eas30) transfected with an antisense PKC construct are shown in the top panel. RACK1 levels in U251N (wild type), pcDNA (control, empty vector), or cells transiently transfected with pcDNA3.1-RACKas (pcRACKas) are shown in the bottom panel. 100 µg of protein was loaded per well for the PKC Western blot and 10 µg of proteins/well for the RACK1 Western blot. B, adhesion assay on laminin, vitronectin, and fibronectin on U251N cells transiently transfected with empty vector (pREP) or antisense PKC (Eas). C, adhesion assay on U251N cells stably transfected with empty vector (pREP) or antisense PKC (Eas30). D, adhesion assay on U251N cells transiently transfected empty vector (pcDNA) or with a RACK1 antisense construct. E, migration assay on antisense RACK1 or PKC-transfected cells and the wild type (U251N) cells and the corresponding control (empty) vectors. These results are representative of three independent experiments.

To determine more clearly whether RACK1 was linking PKC to integrins, we generated a truncated form of RACK1 (containing part of the fifth WD-40 repeat and the sixth and seventh repeats; amino acids 204-317), called RACK-WD6/7 hereafter. This mutant RACK1 was shown to lack the ability to interact with integrin  chains (33) but still contains the site in the sixth WD-40 repeat of RACK1 which was shown to mediate PKC binding (25, 39, 40). Therefore, if a function of RACK1 in glioma cells is to mediate the interaction between PKC and integrin  chains, this truncated form of RACK1 should act as a dominant negative because it lacks the ability to interact with integrin. Overexpression of RACK-WD6/7 after transient transfection is shown in Fig. 9A. U251N or Es10 cells transfected with RACK-WD6/7 exhibited a slightly diminished adhesion on integrin substrates, and PMA completely failed to induce adhesion compared with control vector-transfected cells (pTARGET) (Fig. 9, B and C, respectively). Similar results were observed in migration assays (Fig. 9, D and E). These results indicate that overexpression of a truncated form of RACK1 which lacks the ability to interact with integrin prevents PKC-induced integrin-mediated adhesion and migration, suggesting that RACK1 mediates the interaction between  integrin and PKC. Thus, the role of RACK1 as a link between PKC and integrin  chains appears to be critical for PKC-induced integrin-mediated adhesion and migration.

View larger version (30K): [in this window] [in a new window]   Fig. 9.   A truncated form of RACK1 which lacks the integrin binding region but has the PKC binding site (RACK-WD6/7) abolishes the PKC-induced integrin-mediated adhesion and migration. A, Western blot of U251N cells transiently transfected with empty pTARGET vector (left lane) or the RACK-WD6/7 construct for 24 h. 50 µg of protein was loaded per well. B and C, adhesion assays on U251N and Es10 cells transiently transfected with empty pTARGET vector or the RACK-WD6/7 construct. D, migration assay on U251N cells transiently transfected with empty pTARGET vector or the RACK-WD6/7 construct. *, p < 0.05 compared with PMA-treated U251N or pTARGET cells using one-way ANOVA with Tukey-Kramer multiple comparisons test. E, migration assay on Es10 cells transiently transfected with empty pTARGET vector or the RACK-WD6/7 construct. The migration of the RACK-WD6/7 mutant was significantly lower from migration rates of Es10 or Es10 pTARGET cells in the absence of PMA (**, p < 0.01) and in the presence of PMA (***, p < 0.001) in a one-way ANOVA with Tukey-Kramer multiple comparisons test. Cells were allowed to migrate for 48 h before fixation.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PKC activity plays a critical role in integrin-mediated adhesion, spreading, migration, and focal adhesion assembly (10-13). However, the mechanism by which PKC regulates integrin functions, and more particularly, how PKC is targeted to the vicinity of integrin, remains unclear. In this report, we found that PKC is required for integrin-mediated adhesion, migration, and focal adhesion formation in human glioma cells. We found that the mechanism by which PKC regulates integrin function is through its association with the scaffold protein RACK1 and their association with integrin  chains. Accordingly, the reduction of endogenous RACK1 or PKC levels, or the overexpression of a dominant negative RACK1 that cannot bind to integrin, attenuated the PMA-induced integrin-mediated adhesion and motility in glioma cells. Overall, these results provide a novel mechanistic link between PKC activation and cell adhesion and motility events. An attractive possibility is that upon activation, PKC first binds to RACK1 and that in turn this complex associates with integrin  chains, leading to integrin clustering and increased adhesion and motility.

In human glioma cells, PKC and  appear to play opposite roles in the regulation of adhesion, migration, and focal adhesion formation. Similarly, in vascular endothelial cells, different PKC isoforms were found to exert different roles in adhesion or migration. PKC and  were found to increase cell migration, without an effect on adhesion, and PKC overexpression increased adhesion on vitronectin; furthermore, both PKC and  increased cell cycle progression, and PKC inhibited proliferation (16, 17). In our system, PKC acts as a positive regulator of integrin-mediated adhesion and migration of glioma cells, whereas PKC appears to inhibit these processes. It remains unclear at this point whether the apparent negative role of PKC in integrin-mediated events involves an active process that leads to focal adhesion disassembly or inhibition of integrin signaling. Another possibility is that PKC counteracts adhesion and migration by gearing the cell toward a proliferative pathway, likely to be incompatible with motility, as we have shown previously that PKC is required for cell cycle progression and proliferation in glioma cells (36). In contrast, PKC overexpression or depletion had no effect on cell proliferation. Also, biochemical fractionation of the cells into cytoplasmic and nuclear fractions revealed that both isoforms are targeted to different subcellular localization upon activation with PMA: PKC is translocated to the nucleus (nuclear envelope), whereas PKC is retained in the cytoplasmic fraction (plasma membrane), similar to RACK1, providing further evidence for the different roles played by these two isoforms (41). The finding that RACK1 possibly serves as an adaptor between PKC and select integrin  chains, thus bringing PKC to the close proximity of the focal adhesion machinery, which include several PKC targets, stresses the importance of such anchoring proteins in providing the proper subcellular localization and in regulating the substrate specificity of PKC. We found that the interaction between RACK1 and integrin was dependent on the association of PKC with RACK1. Liliental and Chang (33) also reported that the association of RACK1 with integrin _L2 in vivo was dependent on the presence of PMA. Others have shown a coordinated movement of RACK1 with activated PKC₂ (42), suggesting that RACK1 acts as a shuttling protein that regulates the movement of active PKC from one subcellular location to another.

Recently, Berrier et al. (43) reported that an activated form of PKC (Myr-PKC) could restore the spreading ability of Chinese hamster ovary cells overexpressing a mutant form of ₁ integrin in which the cytoplasmic domain of integrin is fused to the extracellular and transmembrane domains of the interleukin-2 receptor. The ability of Myr-PKC to rescue spreading was dependent upon an intact cytoplasmic domain of the integrin (43). Interestingly, the ability of Myr-PKC to restore ₁-mediated spreading required Rac1 activity, indicating that Rac1 is downstream of PKC in ₁ integrin-mediated cell spreading (43). Thus PKC appears to be an important mediator of  integrin functions in various cell systems.

Buensuceso et al. (34) reported recently that overexpression of RACK1 in Chinese hamster ovary cells resulted in a deficit in cell migration and that mutation of a putative PKC binding site in the third WD-40 repeat prevented this deficit. However, the involvement of PKC was not investigated in that study. These results contrast with ours because we found that RACK1, by mediating the association of PKC with integrin, plays a positive role in cell migration. One possible explanation is that in their study, overexpression of RACK1 acted in a dominant negative manner because  integrins and PKC were probably in limiting amounts. The excess of RACK1 could have sequestered PKC from a limited number of integrin sites. An alternative hypothesis is that another protein, possibly a PKC isoform, interacts with RACK1 at the third WD-40 repeat to regulate integrin functions negatively.

What activated PKC does in glioma cells once it is anchored to integrin  chains by RACK1 remains uncertain. One may expect that activated PKC phosphorylates a number of targets in focal adhesions, thus facilitating their assembly or increasing their stability and leading to integrin clustering and increased adhesion and migration. PKC has previously been reported to phosphorylate several integrin chains (23, 44), paxillin (45), talin (46), and vinculin (47). These phosphorylation events are thought to participate in integrin activation and clustering and focal adhesion assembly and stability. PKC could also participate in the activation of Rac1, leading to actin rearrangements, lamellipodia formation, and integrin clustering, as suggested by Berrier et al. (43).

In summary, we have found that the scaffolding protein RACK1 targets activated PKC to integrin  chains, leading to integrin clustering, focal adhesion formation, and increased adhesion and migration. These findings provide a novel mechanism by which PKC regulates integrin function.

	ACKNOWLEDGEMENTS

We thank Stephen Robbins, Alice Davy, and Michael Walsh for useful discussions and critical reading of this manuscript.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.This

work was supported in part by a grant from the Canadian Institutes for Health Research.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Research student of the National Cancer Institute of Canada supported by funds provided by the Terry Fox Run. Present address: Fred Hutchinson Cancer Research Center, Division of Basic Sciences, Seattle, WA 98109.

Canadian Institutes for Health Research scientist and a senior scholar of the Alberta Heritage Foundation for Medical Research. To whom correspondence should be addressed: University of Calgary, 3330 Hospital Dr. N.W., HMRB 191, Calgary, Alberta T2N 4N1, Canada. Tel.: 403-220-8965; Fax: 403-283-8731; E-mail: vyong@ucalgary.ca.

Published, JBC Papers in Press, April 4, 2002, DOI 10.1074/jbc.M111644200

	ABBREVIATIONS

The abbreviations used are: ECM, extracellular matrix; Ab, antibody; ANOVA, analysis of variance; BrdUrd, bromodeoxyuridine; mAb, monoclonal antibody; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PBS, phosphate-buffered saline; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; RACK1 receptor for activated C kinase 1, STAT1, signal transducers and activators of transcription 1.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES