![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 25, 22209-22214, June 21, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, March 27, 2002
H+-translocating
pyrophosphatase (H+-PPase) of the photosynthetic bacterium
Rhodospirillum rubrum was expressed in Escherichia coli C43(DE3) cells. Recombinant H+-PPase was
observed in inner membrane vesicles, where it catalyzed both
PPi hydrolysis coupled with H+ transport into
the vesicles and PPi synthesis. The hydrolytic activity of
H+-PPase in E. coli vesicles was eight times
greater than that in R. rubrum chromatophores but exhibited
similar sensitivity to the H+-PPase inhibitor,
aminomethylenediphosphonate, and insensitivity to the soluble PPase
inhibitor, fluoride. Using this expression system, we showed that
substitution of Cys185, Cys222, or
Cys573 with aliphatic residues had no effect on the
activity of H+-PPase but decreased its sensitivity to the
sulfhydryl modifying reagent, mersalyl. H+-PPase lacking
all three Cys residues was completely resistant to the effects of
mersalyl. Mg2+ and MgPPi protected
Cys185 and Cys573 from modification by this
agent but not Cys222. Phylogenetic analyses of 23 nonredundant H+-PPase sequences led to classification into
two subfamilies. One subfamily invariably contains Cys222
and includes all known K+-independent
H+-PPases, whereas the other incorporates a conserved
Cys573 but lacks Cys222 and includes all known
K+-dependent H+-PPases. These data
suggest a specific link between the incidence of Cys at positions 222 and 573 and the K+ dependence of
H+-PPase.
The proton pumping pyrophosphatase
(H+-PPase)1 is an
integral membrane protein that utilizes the energy released upon
hydrolysis of PPi to transport protons across the
membrane against the electrochemical gradient (1-3). PPi
is a by-product of various nucleoside
triphosphate-dependent reactions, and its hydrolysis makes
these reactions practically irreversible. Hydrolysis of PPi
in the majority of living species is accomplished by soluble
pyrophosphatase that dissipates released energy as heat.
H+-PPase conserves part of this energy in the form of the
proton electrochemical gradient.
H+-PPases represent a distinct class of ion translocases
with no sequence similarity to ubiquitous ATP-energized pumps such as
F-, V-, or P-type ATPases or ABC transporters (4). In prokaryotic species, H+-PPase resides in the cytoplasmic membrane and
pumps protons away from cytoplasm, whereas in eukaryotic species the
enzyme acidifies internal organelles such as vacuoles in plants (2, 3)
and acidocalcisomes in protozoa (5). The proton-motive force
( All H+-PPases display an obligate requirement for
Mg2+. H+-PPases from plant vacuoles,
acidocalcisomes of protozoa, and fermentative bacteria additionally
require millimolar concentrations of K+ for activity,
whereas those from respiratory and phototrophic bacteria and archaea
are relatively monovalent cation-insensitive (2, 3). Recently,
K+-independent H+-PPases were identified in
plant and protozoa; however, the subcellular localization of these
proteins remains to be determined (20-22). A K+
transporting function was proposed for
K+-dependent H+-PPases (23), but
this issue is still a matter of controversy (14, 24). Both
K+-dependent and K+-independent
H+-PPases are inactivated by sulfhydryl modifying reagents
(25-30).
Although the first H+-PPase discovered was of bacterial
origin (7, 8), the proteins from plant and protozoa have been characterized in greater detail by genetic engineering techniques (2,
3). Four of these protein orthologs have been heterologously expressed
in yeast Saccharomyces cerevisiae in forms capable of both
PPi hydrolysis and H+ translocation (15, 19,
20, 31). The interest in bacterial H+-PPases significantly
increased in 1998, when the gene for R-PPase was cloned and sequenced
(32). This was followed by the identification of several bacterial
H+-PPase genes as a result of genome sequencing projects. A
putative bacterial H+-PPase gene (from the hyperthermophile
Thermotoga maritima) has been expressed in the yeast system,
yielding a protein capable of PPi hydrolysis but not
H+ transporting activity (33). However, yeast appears to be
an unsuitable host for the expression of other bacterial
H+-PPases (including R-PPase) because of proteolytic
degradation of the recombinant protein (33).
Here we report the high yield expression of fully functional R-PPase in
Escherichia coli and use this expression system in conjunction with site-directed mutagenesis to identify the Cys residues
responsible for R-PPase inactivation by mersalyl. Furthermore, phylogenetic analyses performed in this study reveal a unique relationship between the mersalyl-reactive Cys residues and
K+ dependence in H+-PPases.
Plasmid Construction--
Full-length R-PPase gene (1) was
amplified from an original cDNA clone (32) by PCR using
Pfu Turbo DNA polymerase (Stratagene). The primers,
AACGACATATGGCTGGCATCTATC (forward) and
TTTTCTCGAGTTAGTGGGCCAGCACCGC (reverse), incorporated
artificial NdeI and XhoI restriction sites (underlined), respectively. The PCR product was digested with these
restriction enzymes and inserted into the multiple cloning site of
pET22b(+) (Novagen). The resulting construct was further manipulated by
introducing a KpnI restriction site via a silent mutation,
0.5 kb upstream of the C terminus of the R-PPase gene. Mutagenesis was
performed by an overlapping PCR technique with a Stratagene
QuikChangeTM mutagenesis kit or ordinary PCR in the case of
C573A. The primers employed in our experiments are listed in Table
I. R-PPase-encoding regions of the
constructs were sequenced to confirm the presence of the required
mutations and/or the absence of secondary substitutions.
R-PPase Expression--
E. coli C43(DE3) cells (34)
were transformed with wild-type or variant R-PPase-pET22b(+)
constructs, and selected for antibiotic resistance on LB plates
containing 100 µg/ml ampicillin. The cells were grown in 2× YT
medium (35) supplemented with 70 µg/ml ampicillin (2× YT-amp) at
37 °C with shaking at 250 rpm. A single colony was used to inoculate
5 ml of 2× YT-amp. The cells grown for 4 h were transferred to
4 °C and stored overnight. The following day, the cells were
collected by centrifugation at 3800 × g for 15 min at
4 °C, resuspended in 1 ml of fresh 2× YT, and transferred to 30 ml
prewarmed 2× YT-amp. After 1 h of incubation at 37 °C, the
cells were induced with 1 mM
isopropyl- Isolation of Inner Membrane Vesicles (IMV)--
The cell pellets
were thawed on ice, resuspended in 1 ml of ice-cold buffer A, and
disrupted by sonication using a 100 W ultrasonic disintegrator (MSE
Ltd., London, UK) with a microtip at an operating frequency of 20 kHz
and a 9-µm amplitude for 2 min in an ice-water bath. Unbroken cells
and cell debris were removed by centrifugation at 20,000 × g for 2 min at 4 °C. The supernatant was diluted 20-fold with buffer A, and the membrane fraction was harvested by
centrifugation at 150,000 × g for 1 h. The
resulting pellet was resuspended in 1 ml of buffer A, homogenized by
brief sonication with a microtip at 4 µm amplitude for 15 s,
frozen in liquid nitrogen, and stored at
IMV used in proton translocation measurements were isolated in buffer B
(20 mM Tris-HCl, 40 µM EGTA, 200 mM choline chloride, 5 mM MgCl2,
250 mM trehalose, pH 7.5). The washed cell pellets were not
frozen, cell disruption was performed in four 30-s pulses with 1-min
breaks, and the IMV pellet was resuspended by agitation at 4 °C for
2-3 h, instead of homogenization by sonication.
Protein concentrations in IMV suspensions were measured by the Bradford
assay (36). IMV quantities were calculated in terms of protein content.
Polyacrylamide Gel Electrophoresis and Western
Analyses--
Electrophoresis was performed with 12% gels containing
0.1% SDS (37). The gels were stained using a Silver Stain Plus kit (Bio-Rad) (38). Prior to electrophoresis, IMV (2.5 mg
protein/ml) were solubilized by mixing with an equal volume of cold 20 mM Tris-HCl buffer, pH 7.5, containing 1.2 M
MgCl2, 50% glycerol, 5 mM dithiothreitol, and
4% Triton X-100. The mixture was allowed to stand on ice for 15 min
and diluted 5-fold with 125 mM Tris-HCl buffer, pH 6.8, containing 20% glycerol, 300 mM dithiothreitol, and 2.5%
sodium dodecyl sulfate, and 5 µl (1.2 µg of protein)/lane was
loaded onto the gel.
For Western blot analyses, only 0.3 µg of protein was loaded per
lane. The electrophoresed samples were transferred to a nitrocellulose HybondTM ECLTM membrane (Amersham Biosciences)
in standard Towbin buffer (39) containing 20% (v/v) methanol for
1 h at 100 V in a Mini Trans-Blot apparatus (Bio-Rad). Transferred
protein bands were stained with Ponceau S, and the R-PPase
antiserum-reactive bands (32) were visualized using an ECL kit
(Amersham Biosciences).
PPi Hydrolysis Measurements--
PPi
hydrolysis was assayed by continuously recording Pi
liberation with an automatic Pi analyzer (40). IMV
suspensions (5-50 µl) were preincubated for 1 min with 25 ml of 0.12 M Tris-HCl buffer, pH 7.5, containing 5 µM
gramicidin D and 40 µM EGTA. The reaction was initiated
by the addition of 0.1 mM PPi and 2 mM MgCl2. The liberation of Pi was
monitored for about 3 min. In experiments measuring the inhibiting
effect of mersalyl and the protective effects of MgCl2,
these reagents were included in the preincubation medium.
PPi Synthesis Measurements--
PPi
synthesis was assayed continuously by a coupled enzyme procedure (41,
42), using ATP-sulfurylase to convert PPi into ATP and
luciferase to monitor ATP formation. The assay mixture (at a total
volume of 0.2 ml) contained 5.2 mM potassium phosphate (2 mM MgPi complex), 7 mM
MgCl2 (5 mM free Mg2+), 5 µl
luciferin/luciferase solution reconstituted with 5 ml of water (Sigma
ATP assay mix; catalog number FL-ASC), 0.7 unit/ml ATP-sulfurylase
(Sigma), 10 µM adenosine 5'-phosphosulfate, 1 mM dithiothreitol, 1 mg/ml bovine serum albumin, and 0.15 M HEPES/KOH buffer, pH 7.5. The reaction was initiated by
adding 1 µl of IMV suspension, and the time course of luminescence
was monitored with an LKB model 1250 luminometer.
Proton Translocation Measurements--
H+
translocation across the IMV membrane was assayed fluorometrically in 2 ml of buffer B, using 50 µg of IMV and 3 µM acridine orange as a Heterologous Expression of R-PPase in E. coli--
The R-PPase
gene was cloned into pET22b(+) vector under control of the T7/lac
promoter. E. coli strain C43(DE3) (34) was transformed with
either pET22b(+) only or the vector containing R-PPase gene. The
resulting cell lines were cultivated in rich medium (2× YT) in the
presence of 1 mM
isopropyl- Functional Characteristics of R-PPase in IMV--
RPP-IMV
displayed salt wash-resistant PPase activity with the following
characteristics distinctive of
H+-PPase: hypersensitivity to the
H+-PPase inhibitor, AMDP (>95% inhibition by 20 µM AMDP), and low sensitivity to soluble PPase inhibitor,
fluoride (5% inhibition by 0.25 mM fluoride) (44). The
specific activity of IMV PPase was 1.7 µmol/min/mg protein, which is
eight times greater than that in R. rubrum chromatophores
(IMV prepared from R. rubrum cells) (13, 30). PPase activity
of IMV was not significantly affected by the monovalent cations,
K+ or Na+ (50 mM), but
increased by 60% in the presence of 1 µM of the uncoupler carbonyl cyanide
p-(trifluoromethoxy)phenylhydrazone (gramicidin was omitted
from the assay medium in this experiment), consistent with the
formation of a proton concentration gradient.
In contrast, the PPase activity of control pET-IMV was 20 times lower
than that of RPP-IMV. This residual salt-washable and entirely
fluoride-sensitive (>95% inhibition by 0.25 mM fluoride) activity was attributed to contaminating soluble E. coli pyrophosphatase.
Addition of PPi to RPP-IMV resulted in significant
intravesicular acidification, as monitored by acridine orange
fluorescence quenching (Fig. 2). The
sensitivity of H+ transport activity to AMDP and fluoride
was comparable with that of PPi hydrolysis activity.
Neither the initial rate nor the extent of the
PPi-dependent intravesicular acidification was
significantly affected by monovalent cations (K+ and
Na+) or valinomycin plus K+ (data not shown).
The pET-IMV exhibited no H+ transport activity (Fig. 2).
However, both types of IMV maintained the [H+] gradient
generated by the intrinsic E. coli membrane proteins, F1F0-ATPase and D-lactate
dehydrogenase (observed upon the addition of ATP and lactate,
respectively), indicating IMV integrity (data not shown).
RPP-IMV exhibited appreciable PPi synthesizing activity
(Fig. 3). Its absence from pET-IMV and
sensitivity to AMDP clearly indicated that PPi synthesis is
catalyzed by R-PPase. The observed rate of synthesis decreased with
time, supposedly because of the action of intrinsic ATPase on ATP
formed from PPi by the action of ATP sulfurylase. This
explanation is supported by the decay of the signal generated by added
PPi in Fig. 3. The activity calculated from the
initial slope of curve 1 in Fig. 3 was 0.010 µmol/min/mg protein
(representing 0.6% hydrolytic activity). This PPi
synthesizing activity was evident in nonenergized vesicles and thus
characterizes the approach to equilibrium in the
Pi/PPi system.
Mersalyl-reactive Cys Residues of
R-PPase--
H+-PPases are highly sensitive to sulfhydryl
reagents, such as mersalyl and N-ethylmaleimide (2).
Inactivation of R-PPase by mersalyl occurs biphasically (30),
suggesting the involvement of at least two Cys residues. From the seven
Cys residues present in the R-PPase sequence (32), four (cysteines 87, 268, 335, and 395) are located within predicted membrane regions (18, 32) and therefore can hardly react with charged,
membrane-impermeable mersalyl. However, the remaining three Cys
residues (cysteines 185, 222, and 573) occur within regions assigned to
cytoplasmic loops and are thus potentially reactive. To determine the
cytoplasmically oriented residues responsible for inactivation by
sulfhydryl modifying reagents, each Cys was replaced with an aliphatic
residue (Ala or Val), and the effects of these substitutions on
PPi hydrolyzing and proton pumping activities and
sensitivity to mersalyl were determined.
None of the Cys substitutions affected the PPi hydrolyzing
and H+ pumping activities to an extent significantly
exceeding batch-to-batch scatter (25%), thus demonstrating
dispensability of these residues for catalytic activity and the lack of
gross structural changes in R-PPase upon substitution. However, all
three substitutions slowed down R-PPase inactivation by the
sulfhydryl modifying reagent, mersalyl, to some extent, with
C185A exerting by far the largest effect (Fig.
4). Two phases of inactivation were
observed in most cases, including rapid inactivation (by 20-30%) and
slower inactivation to nearly zero activity. In these experiments, IMV
were always preincubated with mersalyl before the addition of
PPi. If mersalyl was added after PPi and
Mg2+, the hydrolysis rate rapidly dropped by ~20%, with
all of the R-PPase variants exhibiting the rapid inactivation phase in
Fig. 4, and remained constant thereafter. These observations indicate that MgPPi has no effect on the rapid phase but abolishes
the slower phase. No rapid phase was observed with the C222V variant, suggesting that this phase specifically corresponds to
Cys222 modification. The effects of mersalyl on the
H+ transport activity of the R-PPase variants were
qualitatively similar to those presented in Fig. 4 (data not
shown).
Similar experiments conducted with Mg2+ omitted from
preincubation conditions generated qualitatively similar inactivation
curves but with much faster kinetics. The pseudo-first-order rate
constants calculated from the initial slopes of the slower phase of the inactivation curves were approximately 10 times larger in the absence
of Mg2+ than in its presence (Table
II). A R-PPase mutant protein in which
all three Cys residues were substituted was completely resistant to
mersalyl.
E. coli versus Yeast as a Host Cell for H+-PPase
Expression--
Initially, Kim et al. (15) expressed
H+-PPase (from the plant Arabidopsis thaliana)
in the yeast S. cerevisiae. Yeast was selected for
heterologous expression, because it is a vacuolated host lacking
endogenous vacuolar H+-PPase. Later, five more
H+-PPases, including two plant vacuolar (one from
Vigna radiata (19) and the second from A. thaliana (20)), one protozoal (from Trypanosoma cruzi
(31)), one archaeal (from Pyrobaculum aerophilum (45)), and
one bacterial (from T. maritima (33)) enzyme were expressed
in yeast. The general applicability of the yeast system for expression
of H+-PPase was thus established. However, problems were
encountered in bacterial H+-PPase expression, including low
yield of T. maritima H+-PPase and complete
failure to express functional R-PPase (33). These problems were not
unexpected, because compartmentalization of yeast cells presents a
significant challenge for H+-PPase lacking eukaryotic
sorting signals and may lead to mislocalization, improper
post-translational modification, and, consequently, degradation or
inactivation of H+-PPase. Moreover, differences in the
interpretation of topogenic signals by eukaryotic and prokaryotic
protein insertion machinery (46) may result in incorrect topology upon
insertion of the bacterial protein into endoplasmic reticulum membrane.
In E. coli, bacterial H+-PPase is targeted and
inserted directly into the cytoplasmic membrane, which is its usual
environment. In addition, E. coli lacks endogenous
H+-PPase and is by far the most manipulatable and resilient
host available.
In direct contrast to the yeast system where the specific activity of
H+-PPase in yeast vacuoles was at least twice as low as
that in plant vacuoles (15, 20), significant overexpression of
H+-PPase was achieved with the E. coli system.
The specific activity of R-PPase in E. coli IMV was an order
of magnitude higher than that in R. rubrum chromatophores,
signifying the potential applicability of IMV as a rich source for
R-PPase purification. The high expression levels achieved in the
present work was mainly due to the E. coli C43(DE3) strain
employed, which is particularly suitable for overexpression of integral
membrane proteins (34). We were additionally able to express the
R. rubrum protein in the conventional E. coli
BL21(DE3) strain (Novagen), although the expression level was four
times lower than that in C43(DE3) (data not shown).
Expressed R-PPase Is Fully Functional--
Heterologously
expressed R-PPase was competent in PPi hydrolysis and
synthesis and PPi-energized H+ translocation.
To our knowledge, this is the first study reporting H+
transport activity in a heterologously expressed bacterial
H+-PPase. Although T. maritima
H+-PPase was recently expressed in yeast (33), no
H+ transport activity was demonstrated in this case. The
high H+ transport activity observed with the E. coli IMV containing R-PPase is particularly notable. The initial
rate of fluorescence decay in Fig. 2 (1200
R-PPase may act as a PPi synthase in vivo (7,
12, 47, 48) and thus appears functionally similar to ATP synthase. The
two synthases act in parallel, with similar rates in chromatophore membranes driven by the light-induced Contribution of Different Cys Residues to Mersalyl
Sensitivity--
The heterologous expression of fully functional
R-PPase has paved the way for site-directed mutagenesis, a powerful
technique for studies on enzyme structure and function. Here, we used
this approach to identify the cytoplasmically oriented Cys residues responsible for R-PPase inactivation by the membrane-impermeable sulfhydryl reagent mersalyl.
The data presented in Fig. 4 clearly show that Cys222
modification is responsible for the rapid inactivation phase, resulting in the loss of ~20% of activity. The slower inactivation phase evidently involves Cys185 modification, because mutation of
this residue had the most significant effect on the rate constant for
this phase (Table II). However, the C185A variant exhibited both
inactivation phases in the absence of Mg2+ (Table II),
suggesting that Cys573 modification also contributes to the
slower inactivation phase. Significantly, modification of
Cys634 (corresponding to Cys573 of R-PPase)
inactivates plant vacuolar H+-PPase (28, 29).
Interestingly, Cys222 replacement not only prevented the
rapid MgPPi-insensitive inactivation phase but also
decreased the rate constant for the slower inactivation phase
attributable to Cys185 and Cys573 modification
by ~5-fold (Table II). A simple explanation is that adding a bulky
mersalyl group to Cys222 induces structural changes that
are propagated to the environment of Cys185 and
Cys573, thus increasing their accessibility to the
modification agent. Consistent with this interpretation, neither
Cys185 nor Cys573 is completely accessible in
wild-type R-PPase, as indicated by their lower reactivities in
comparison with Cys222.
Mg2+ and MgPPi are two other determinants of
Cys accessibility in R-PPase. Mg2+ binding decreased
ki by ~10-fold in both wild-type and variant
R-PPases (Table II), whereas MgPPi binding completely arrested the slower inactivation phase. These observations suggest that
Mg2+ and MgPPi induce conformational changes in
R-PPase. In plant vacuolar H+-PPase, only
Cys634 (corresponding to Cys573 of R-PPase) was
modified by sulfhydryl reagents. Although Mg2+ had a
negligible effect in this case, the effect of MgPPi was comparable with that in R-PPase (28, 29). This difference indicates a
greater conformational flexibility of R-PPase.
Conservation of Cys Residues and Subtyping H+-PPase
Family--
Fig. 5 reveals a clear
relationship between the evolution pattern of H+-PPase and
the occurrence of Cys at positions corresponding to the
mersalyl-reactive Cys222 and Cys573 of R-PPase.
The whole set of 23 nonredundant H+-PPase sequences can be
divided into two subfamilies, specifically, I (from A. thaliana to Carboxydothermus hydrogenoformans)
and II (from Brucella melitensis to P. aerophilum). All subfamily II H+-PPases (except
P. aerophilum H+-PPase) but none of the
subfamily I proteins contain an equivalent of Cys222. On
the other hand, an equivalent of Cys573 of R-PPase that is
only sporadically distributed within subfamily II is identified in all
subfamily I H+-PPases. The absence of any Cys in
P. aerophilum H+-PPase is not
unexpected, taking into account the strong selection against cysteines
in this organism adapted to tolerate oxygen at elevated temperatures.
Cys185 is unique to R-PPase. Moreover, at least in one
strain of R. rubrum (R2), this residue is replaced by
Gly2.
Surprisingly, subfamily I includes all heterologously expressed
H+-PPases displaying K+ dependence, whereas all
heterologously expressed K+-independent
H+-PPases are categorized as subfamily II. Furthermore, the
presence of K+-dependent H+-PPase
in four organisms classified as family I was demonstrated (52-55),
although the sequences shown in Fig. 5 may belong to an alternative
H+-PPase of these organisms. Assuming that the
K+ requirement was eliminated or acquired at a distinct
point in the evolution of H+-PPases, one can assign almost
all the sequences from subfamily I and II to
K+-dependent and K+-independent
H+-PPases, respectively (Fig. 5).
Pérez-Castiñeira et al. (33) also classified
H+-PPases into two phylogenetic groups based on their
K+ dependence. However, they demarcated the groups
differently because they did not take into account Cys conservation.
The sporadic occurrence of Cys573 in subfamily II
versus complete lack of Cys222 in subfamily I
suggests that subfamily II descends from subfamily I enzymes. Thus, the
incidence of Cys at position 222 and loss of K+ dependence
may be parallel events in H+-PPase evolution. However, the
loss of K+ sensitivity in family II is not a direct
consequence of Cys222 acquisition, because a reverse
evolutionary substitution (C222A) did not confer K+
sensitivity to R-PPase. Strong conservation of Cys222 in
subfamily II and Cys573 in subfamily I implies important
roles for these residues that are yet to be determined. The
dispensability of these cysteine residues for catalysis and proton
translocation established in the present work, in concurrence with
earlier reports (29), rules out their direct participation in
catalysis. A regulatory role involving Cys modification by formation of
a disulfide with a protein factor or a low molecular mass thiol (for
instance, glutathione) is thus the most likely theory.
We thank Dr. J. E. Walker (Cambridge)
for providing the E. coli C43(DE3) strain, Dr. M. Baltscheffsky and A. Schultz for providing R-PPase gene and antibody
against the protein and helpful discussions, and A. B. Zyryanov
for help with PPi synthesis measurements.
*
This work was supported by Academy of Finland Grants 35736 and 47513 and Russian Foundation for Basic Research Grants 00-04-48310, 00-15-97907, and 01-04-06114.The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence may be addressed. Tel.:
7-095-939-5541; Fax: 7-095-939-3181; E-mail:
baykov@genebee.msu.su.
Published, JBC Papers in Press, April 15, 2002, DOI 10.1074/jbc.M202951200
2
G. A. Belogurov and M. V. Turkina,
unpublished observations.
The abbreviations used are:
H+-PPase, proton translocating inorganic pyrophosphatase;
AMDP, aminomethylenediphosphonate;
IMV, inner membrane vesicles;
R-PPase, R. rubrum H+-PPase;
RPP-IMV, inner
membrane vesicles containing R-PPase;
pET-IMV, inner membrane vesicles
lacking R-PPase;
contig, group of overlapping clones.
H+-Pyrophosphatase of Rhodospirillum
rubrum
HIGH YIELD EXPRESSION IN ESCHERICHIA COLI AND
IDENTIFICATION OF THE CYS RESIDUES RESPONSIBLE FOR INACTIVATION BY
MERSALYL*
§,
,
,
Department of Biochemistry and Food
Chemistry, University of Turku, FIN-20014 Turku, Finland and the
§ A. N. Belozersky Institute of Physico-Chemical
Biology, Moscow State University, Moscow 119899, Russia
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
µH+) generated is used to transport a
variety of solutes via secondary transporters and osmoregulation (6).
In the photosynthetic bacterium Rhodospirillum rubrum,
H+-PPase is capable of sustaining both PPi
hydrolysis coupled with uphill proton translocation and PPi
synthesis in conjunction with downhill proton translocation at
significant rates under physiological conditions (7-11). The R. rubrum H+-PPase (R-PPase) is therefore often referred
to as PPi synthase by analogy with ATP synthase (12). Both
PPase and proton translocation activities are associated with a single
polypeptide of 66-90 kDa (13-15), which possibly forms a dimer (16,
17). About half of the PPase molecule is embedded in the membrane, as
estimated from the 14-16 transmembrane spans predicted by computer
modeling (18, 19).
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
PCR primers
-D-thiogalactopyranoside for 6 h and then
harvested by centrifugation at 3800 × g for 15 min at
4 °C. Next, the cells were resuspended in 1 ml of ice-cold buffer A
(120 mM Tris-HCl, 40 µM EGTA, 2 mM Mg2+, 10% glycerol, pH 7.5) and pelleted by
centrifugation at 7000 × g for 10 min at 4 °C. The
washed cell pellets were frozen and stored at
70 °C until use.
70 °C until use.
pH indicator (43). The excitation and emission wavelengths were set at 495 and 540 nm, respectively. H+
translocation was initiated by the addition of 0.1 mM
PPi, 0.1 mM ATP, or 15 mM
DL-lactate (sodium salts) and measured with a PerkinElmer
Life Sciences MPF-2A fluorometer. All of the measurements were
performed at 25 °C.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-thiogalactopyranoside to induce recombinant
protein production. IMV prepared from the C43(DE3) cells transformed
with pET22b(+) containing the R-PPase gene (RPP-IMV) produced on a
silver-stained SDS-polyacrylamide gel an intense 60-kDa band that
reacted with polyclonal antiserum raised against R-PPase (32). This
band was absent from pET-IMV prepared from C43(DE3) cells transformed
with pET22b(+) only (Fig. 1). It should
be noted that although the molecular mass of R-PPase calculated
from the amino acid sequence is 71 kDa, it migrates as a 60-kDa protein
in SDS-polyacrylamide gel electrophoresis because of extreme
hydrophobicity (13).

View larger version (25K):
[in a new window]
Fig. 1.
Polyacrylamide gel electrophoresis of pET-IMV
(lanes 1 and 3) and RPP-IMV
(lanes 2 and 4) in the presence of
sodium dodecyl sulfate. Lanes 1 and 2,
silver staining; lanes 3 and 4, Western analyses
using antibodies against R-PPase.

View larger version (13K):
[in a new window]
Fig. 2.
PPi-driven H+
transport in IMV containing recombinant R-PPase. The process was
initiated by the addition of PPi to RPP-IMV (curves
1-3) or pET-IMV (curve 4) and terminated with 10 mM NH4Cl. Curves 2 and 3 were obtained in the presence of 1 mM KF and 2 µM AMDP, respectively.

View larger version (14K):
[in a new window]
Fig. 3.
PPi synthesis catalyzed by IMV
containing recombinant R-PPase. The reaction was initiated by the
addition of RPP-IMV (curves 1 and 2) or pET-IMV
(curve 3). At the end of the incubation, 0.2 µM PPi was added to calibrate the assay.
Curve 2 was obtained in the presence of 10 µM
AMDP.

View larger version (14K):
[in a new window]
Fig. 4.
Time course of wild-type and variant R-PPase
inactivation in RPP-IMV by 15 µM
mersalyl in the presence of 2 mM MgCl2.
The ordinate is scaled logarithmically; 100% refers to
activity measured without mersalyl. The lines correspond to
the initial slopes of the curves.
Rate constants for IMV R-PPase inactivation by mersalyl
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
F%/min/1 mg
of IMV) was about seven times higher than that in similar assays
utilizing yeast microsomes containing A. thaliana
H+-PPase (18, 20). The difference in H+
transport activities is also confirmed by a greater steady-state quenching of acridine orange fluorescence, specifically, 1800
F%/mg for R-PPase (Fig. 2) versus 209
F%/mg for A. thaliana H+-PPase
(18).
µH+
(7, 10, 11) or artificial
pH across the membrane (49). We showed that nonenergized IMV containing R-PPase exhibited appreciable PPi synthesizing activity, as previously demonstrated with
soluble PPase (50, 51). In our system, converting PPi into
ATP by ATP-sulfurylase provided a thermodynamic pull for
PPi synthesis. Attempts to detect this activity with
nonenergized chromatophores were unsuccessful, because the ATPase
present in the chromatophore membrane strongly interferes with the
PPi assay by consuming ATP formed by
ATP-sulfurylase.2 In the
current system, this interference was markedly reduced because of the
greater PPase/ATPase ratio and only affected the linearity of
PPi accumulation curves (Fig. 3). IMV containing R-PPase
thus provide an efficient system to study nonenergized PPi
synthesis and may be of great importance in elucidating the mechanism
by which H+-PPase couples scalar PPi synthesis
with vectorial H+ transfer.

View larger version (35K):
[in a new window]
Fig. 5.
Subtyping H+-PPases on the basis
of phylogenetic analyses and Cys conservation patterns. The
neighbor-joining phylogenetic tree and multiple sequence alignment were
generated by Clustal X, version 1.81. Poorly aligned regions
corresponding to positions 1-30 and 249-332 of R-PPase were excluded
from the otherwise full-length sequence set used for tree calculation.
The confidence of the branching order was verified by making 1000 bootstrap replicates. The tree was arbitrarily rooted with the C. hydrogenoformans sequence to mark out subfamilies. The columns to
the right of the tree display residues corresponding to
Cys185, Cys222, and Cys573 of
R-PPase in the multiple sequence alignment, K+ requirement
of functionally characterized H+-PPases
(K+ dep), and protein sequence accession
numbers in the GenBankTM or DNA contig numbers for
preliminary sequences obtained from The Institute for Genomic Research
(www.tigr.org). The question mark in the K+
dep column specifies the organisms possessing
K+-dependent H+-PPases whose amino
acid sequences have not been directly determined and therefore may be
different from those used to construct the phylogenetic tree, because
these organisms possibly contain multiple H+-PPases.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
To whom correspondence may be addressed. Tel.: 358-2-333-6845;
Fax: 358-2-333-6860; E-mail: reijo.lahti@utu.fi.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Baltscheffsky, M.,
Schultz, A.,
and Baltscheffsky, H.
(1999)
FEBS Lett.
452,
121-127[CrossRef][Medline]
[Order article via Infotrieve]
2.
Maeshima, M.
(2000)
Biochim. Biophys. Acta
1465,
37-51[Medline]
[Order article via Infotrieve]
3.
Drozdowicz, Y. M.,
and Rea, P. A.
(2001)
Trends Plant Sci.
6,
206-211[CrossRef][Medline]
[Order article via Infotrieve]
4.
Rea, P. A.,
Kim, Y.,
Sarafian, V.,
Poole, R. J.,
Davies, J. M.,
and Sanders, D.
(1992)
Trends Biochem. Sci.
17,
348-353[CrossRef][Medline]
[Order article via Infotrieve]
5.
Docampo, R.,
and Moreno, S. N.
(2001)
Mol. Biochem. Parasitol.
114,
151-159[CrossRef][Medline]
[Order article via Infotrieve]
6.
Maeshima, M.
(2001)
Annu. Rev. Plant. Physiol. Plant Mol. Biol.
52,
469-497[CrossRef][Medline]
[Order article via Infotrieve]
7.
Baltscheffsky, H.,
Von Stedingk, L. V.,
Heldt, H. W.,
and Klingenberg, M.
(1966)
Science
153,
1120-1122 8.
Baltscheffsky, M.
(1967)
Nature
216,
241-243[Medline]
[Order article via Infotrieve]
9.
Moyle, J.,
Mitchell, R.,
and Mitchell, P.
(1972)
FEBS Lett.
23,
233-236[CrossRef][Medline]
[Order article via Infotrieve]
10.
Guillory, R. J.,
and Fisher, R. R.
(1972)
Biochem. J.
129,
571-581[Medline]
[Order article via Infotrieve]
11.
Nyrén, P.,
Nore, B. F.,
and Baltscheffsky, M.
(1986)
Biochim. Biophys. Acta
851,
276-282[CrossRef]
12.
Baltscheffsky, M.,
and Baltscheffsky, H.
(1995)
Photosynthesis Res.
46,
87-91
13.
Nyrén, P.,
Nore, B. F.,
and Strid, Å.
(1991)
Biochemistry
30,
2883-2887[CrossRef][Medline]
[Order article via Infotrieve]
14.
Sato, M. H.,
Kasahara, M.,
Ishii, N.,
Homareda, H.,
Matsui, H.,
and Yoshida, M.
(1994)
J. Biol. Chem.
269,
6725-6728 15.
Kim, E. J.,
Zhen, R. G.,
and Rea, P. A.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
6128-6132 16.
Sato, M. H.,
Maeshima, M.,
Ohsumi, Y.,
and Yoshida, M.
(1991)
FEBS Lett.
290,
177-180[CrossRef][Medline]
[Order article via Infotrieve]
17.
Wu, J. J., Ma, J. T.,
and Pan, R. L.
(1991)
FEBS Lett.
283,
57-60[Medline]
[Order article via Infotrieve]
18.
Zhen, R. G.,
Kim, E. J.,
and Rea, P. A.
(1997)
J. Biol. Chem.
272,
22340-22348 19.
Nakanishi, Y.,
Saijo, T.,
Wada, Y.,
and Maeshima, M.
(2001)
J. Biol. Chem.
276,
7654-7660 20.
Drozdowicz, Y. M.,
Kissinger, J. C.,
and Rea, P. A.
(2000)
Plant Physiol.
123,
353-362 21.
Mitsuda, N.,
Enami, K.,
Nakata, M.,
Takeyasu, K.,
and Sato, M. H.
(2001)
FEBS Lett.
488,
29-33[CrossRef][Medline]
[Order article via Infotrieve]
22.
McIntosh, M. T.,
Drozdowicz, Y. M.,
Laroiya, K.,
Rea, P. A.,
and Vaidya, A. B.
(2001)
Mol. Biochem. Parasitol.
114,
183-195[CrossRef][Medline]
[Order article via Infotrieve]
23.
Davies, J. M.,
Poole, R. J.,
Rea, P. A.,
and Sanders, D.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
11701-11705 24.
Ros, R.,
Romieu, C.,
Gibrat, R.,
and Grignon, C.
(1995)
J. Biol. Chem.
270,
4368-4374 25.
Randahl, H.
(1979)
Eur. J. Biochem.
102,
251-256[Medline]
[Order article via Infotrieve]
26.
Britten, C. J.,
Turner, J. C.,
and Rea, P. A.
(1989)
FEBS Lett.
256,
200-206[CrossRef]
27.
Baykov, A. A.,
Bakuleva, N. P.,
and Rea, P. A.
(1993)
Eur. J. Biochem.
217,
755-762[Medline]
[Order article via Infotrieve]
28.
Zhen, R. G.,
Kim, E. J.,
and Rea, P. A.
(1994)
J. Biol. Chem.
269,
23342-23350 29.
Kim, E. J.,
Zhen, R. G.,
and Rea, P. A.
(1995)
J. Biol. Chem.
270,
2630-2635 30.
Baykov, A. A.,
Sergina, N. V.,
Evtushenko, O. A.,
and Dubnova, E. B.
(1996)
Eur. J. Biochem.
236,
121-127[Medline]
[Order article via Infotrieve]
31.
Hill, J. E.,
Scott, D. A.,
Luo, S.,
and Docampo, R.
(2000)
Biochem. J.
351,
281-288[CrossRef][Medline]
[Order article via Infotrieve]
32.
Baltscheffsky, M.,
Nadanaciva, S.,
and Schultz, A.
(1998)
Biochim. Biophys. Acta
1364,
301-306[Medline]
[Order article via Infotrieve]
33.
Pérez-Castiñeira, J. R.,
Lopez-Marques, R. L.,
Losada, M.,
and Serrano, A.
(2001)
FEBS Lett.
496,
6-11[CrossRef][Medline]
[Order article via Infotrieve]
34.
Miroux, B.,
and Walker, J. E.
(1996)
J. Mol. Biol.
260,
289-298[CrossRef][Medline]
[Order article via Infotrieve]
35.
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
36.
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
37.
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
38.
Gottlieb, M.,
and Chavko, M.
(1987)
Anal. Biochem.
165,
33-37[CrossRef][Medline]
[Order article via Infotrieve]
39.
Towbin, H.,
Staehelin, T.,
and Gordon, J.
(1979)
Proc. Natl. Acad. Sci. U. S. A.
76,
4350-4354 40.
Baykov, A. A.,
and Avaeva, S. M.
(1981)
Anal. Biochem.
116,
1-4[CrossRef][Medline]
[Order article via Infotrieve]
41.
Nyrén, P.,
and Lundin, A.
(1985)
Anal. Biochem.
151,
504-509[CrossRef][Medline]
[Order article via Infotrieve]
42.
Fabrichniy, I. P.,
Kasho, V. N.,
Hyytiä, T.,
Salminen, T.,
Halonen, P.,
Dudarenkov, V. Y.,
Heikinheimo, P.,
Chernyak, V. Y.,
Goldman, A.,
Lahti, R.,
Cooperman, B. S.,
and Baykov, A. A.
(1997)
Biochemistry
36,
7746-7753[CrossRef][Medline]
[Order article via Infotrieve]
43.
Rosen, B. P.
(1986)
Methods Enzymol.
125,
328-336[Medline]
[Order article via Infotrieve]
44.
Baykov, A. A.,
Dubnova, E. B.,
Bakuleva, N. P.,
Evtushenko, O. A.,
Zhen, R. G.,
and Rea, P. A.
(1993)
FEBS Lett.
327,
199-202[CrossRef][Medline]
[Order article via Infotrieve]
45.
Drozdowicz, Y. M., Lu, Y. P.,
Patel, V.,
Fitz-Gibbon, S.,
Miller, J. H.,
and Rea, P. A.
(1999)
FEBS Lett.
460,
505-512[CrossRef][Medline]
[Order article via Infotrieve]
46.
Gafvelin, G.,
Sakaguchi, M.,
Andersson, H.,
and von Heijne, G.
(1997)
J. Biol. Chem.
272,
6119-6127 47.
Baltscheffsky, H.,
Lundin, M.,
Luxemburg, C.,
Nyrén, P.,
and Baltscheffsky, M.
(1986)
Chem. Scr.
26B,
259-262
48.
Nyrén, P.,
and Strid, Å.
(1991)
FEMS Microbiol. Lett.
77,
2265-2270
49.
Strid, Å.,
Karlsson, I. M.,
and Baltscheffsky, M.
(1987)
Acta Chem. Scand.
B41,
116-118
50.
Daley, L. A.,
Renosto, F.,
and Segel, I. H.
(1986)
Anal. Biochem.
157,
385-395[CrossRef][Medline]
[Order article via Infotrieve]
51.
Baykov, A. A.,
and Shestakov, A. S.
(1992)
Eur. J. Biochem.
206,
463-470[Medline]
[Order article via Infotrieve]
52.
Scott, D. A.,
de Souza, W.,
Benchimol, M.,
Zhong, L., Lu, H. G.,
Moreno, S. N.,
and Docampo, R.
(1998)
J. Biol. Chem.
273,
22151-22158 53.
Luo, S.,
Marchesini, N.,
Moreno, S. N.,
and Docampo, R.
(1999)
FEBS Lett.
460,
217-220[CrossRef][Medline]
[Order article via Infotrieve]
54.
Rodrigues, C. O.,
Scott, D. A.,
Bailey, B. N., De,
Souza, W.,
Benchimol, M.,
Moreno, B.,
Urbina, J. A.,
Oldfield, E.,
and Moreno, S. N.
(2000)
Biochem. J.
349,
737-745
55.
Ruiz, F. A.,
Marchesini, N.,
Seufferheld, M.,
Govindjee,
and Docampo, R.
(2001)
J. Biol. Chem.
276,
46196-46203
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
K. M. Au, R. D. Barabote, K. Y. Hu, and M. H. Saier Jr Evolutionary appearance of H+-translocating pyrophosphatases. Microbiology, May 1, 2006; 152(Pt 5): 1243 - 1247. [Full Text] [PDF] |
||||
![]() |
M. Hirono, H. Mimura, Y. Nakanishi, and M. Maeshima Expression of Functional Streptomyces coelicolor H+-Pyrophosphatase and Characterization of Its Molecular Properties J. Biochem., August 1, 2005; 138(2): 183 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Seufferheld, C. R. Lea, M. Vieira, E. Oldfield, and R. Docampo The H+-pyrophosphatase of Rhodospirillum rubrum Is Predominantly Located in Polyphosphate-rich Acidocalcisomes J. Biol. Chem., December 3, 2004; 279(49): 51193 - 51202. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Gomez-Garcia and A. Kornberg Formation of an actin-like filament concurrent with the enzymatic synthesis of inorganic polyphosphate PNAS, November 9, 2004; 101(45): 15876 - 15880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Mimura, Y. Nakanishi, M. Hirono, and M. Maeshima Membrane Topology of the H+-pyrophosphatase of Streptomyces coelicolor Determined by Cysteine-scanning Mutagenesis J. Biol. Chem., August 13, 2004; 279(33): 35106 - 35112. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nakanishi, I. Yabe, and M. Maeshima Patch Clamp Analysis of a H+ Pump Heterologously Expressed in Giant Yeast Vacuoles J. Biochem., October 1, 2003; 134(4): 615 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Seufferheld, M. C. F. Vieira, F. A. Ruiz, C. O. Rodrigues, S. N. J. Moreno, and R. Docampo Identification of Organelles in Bacteria Similar to Acidocalcisomes of Unicellular Eukaryotes J. Biol. Chem., August 8, 2003; 278(32): 29971 - 29978. [Abstract] [Full Text] [PDF] |
||||