|
Originally published In Press as doi:10.1074/jbc.M200338200 on March 27, 2002
J. Biol. Chem., Vol. 277, Issue 25, 22240-22250, June 21, 2002
The 7472insC Mitochondrial DNA Mutation Impairs the Synthesis and
Extent of Aminoacylation of tRNASer(UCN) but Not Its
Structure or Rate of Turnover*
Marina
Toompuu §¶,
Takehiro
Yasukawa ,
Tsutomu
Suzuki **,
Terhi
Hakkinen ,
Johannes N.
Spelbrink ,
Kimitsuna
Watanabe **, and
Howard T.
Jacobs  §§
From the Institute of Medical Technology and Tampere
University Hospital, FIN-33014 University of Tampere, Finland, the
§ National Institute of Chemical Physics and Biophysics,
Akadeemia tee 23, 12618 Tallinn, Estonia, the Department
of Chemistry and Biotechnology, Graduate School of Engineering and the
** Department of Integrated Biosciences, Graduate School of
Frontier Sciences, University of Tokyo, Tokyo 113-8656, Japan, and the
 Institute of Biomedical and Life Sciences,
University of Glasgow, Glasgow G12 8QQ, Scotland, United Kingdom
Received for publication, January 11, 2002, and in revised form, March 1, 2002
 |
ABSTRACT |
The 7472insC mitochondrial DNA mutation in the
tRNASer(UCN) gene is associated with sensorineural
deafness combined, in some patients, with a wider neurological
syndrome. In cultured cybrid cells it causes a 70% decrease in
tRNASer(UCN) abundance and mild respiratory impairment,
previously suggested to be due to decreased tRNA stability. When
mitochondrial transcription was blocked by ethidium bromide
treatment, the half-life of the mutant tRNA was not significantly
different from that of wild-type tRNASer(UCN).
Over-expression of mitochondrial translational elongation factor EF-Tu
also had no effect on the mutant phenotype. However, during recovery
from prolonged ethidium bromide treatment, the synthesis of the mutant
tRNASer(UCN) was specifically impaired, without polarity
effects on downstream tRNAs of the light strand transcription unit. We
infer that the mutation acts posttranscriptionally to decrease
tRNASer(UCN) abundance by affecting its synthesis rather
than its stability. The extent of aminoacylation of the mutant tRNA was
also decreased by ~25%. In contrast, the mutation had no detectable
effect on tRNASer(UCN) base modification or structure other
than the insertion of an extra guanosine templated by the mutation,
which was structurally protected from nuclease digestion like the
surrounding nucleotides. These findings indicate a common molecular
process underlying sensorineural deafness caused by mitochondrial
tRNASer(UCN) mutations.
 |
INTRODUCTION |
More than 50 pathological mutations in mitochondrial tRNA genes
have now been reported and validated (Ref. 1, see also www.gen.emory.edu/mitomap.html), and the molecular effects of many have
been at least partially elucidated via the creation of 0
cybrids (fusions to cells lacking endogenous mitochondrial DNA, see
Ref. 2) or other cell culture models. Heteroplasmic mutations, such as
A3243G or other tRNALeu(UUR) mutations found in cases of
MELAS1 (mitochondrial
encephalomyopathy with lactic acidosis and stroke-like episodes) and
other syndromes or A8344G and T8356C found in cases of MERFF (myoclonic
epilepsy with ragged-red fibers), tend to have severe quantitative
and/or qualitative effects on mitochondrial protein synthesis and
respiratory function (3-6). They are associated with abnormal base
modification (7-9), decreased aminoacylation (4, 8, 10-12), and
reduced steady-state levels of the corresponding tRNAs (5, 6, 8, 11).
Mutations in tRNALeu(UUR) are associated frequently with
defective RNA processing (6, 13-15) and also shortened half-life (8)
of the affected tRNA. By contrast, mutations affecting
tRNASer(UCN), which are frequently homoplasmic or
implicated pathologically only at high levels of heteroplasmy, have
rather modest effects on mitochondrial function and are generally
associated with mild or tissue-restricted pathological states,
principally sensorineural deafness.
The 7472insC mutation is one such mutation. Clinically, most subjects
have an apparently non-syndromic hearing impairment (16), with a
minority suffering a more widespread neurological disease including
ataxia and myoclonic seizures (16-18), sometimes with a measurable
deficit of cytochrome c oxidase (18). In 143B osteosarcoma-derived cybrid cells, homoplasmy for the 7472insC mutation
produces only a very modest biochemical phenotype, comprising a small
decrease in complex I activity (17) and a growth deficit in galactose
medium when the mutation is present in combination with a diminished
copy number of mtDNA (19). Effects on mitochondrial protein synthesis
are minimal, with only a slight quantitative decrease in mitochondrial
translation products detectable by pulse labeling (19), an effect
mildly exacerbated by doxycycline treatment (19). The only clear
molecular effect of the mutation that can be seen in cybrid cells is a
decrease of ~70% in the steady-state level of
tRNASer(UCN) (19), an effect shared with the A7445G
deafness-associated mutation (20, 21). Unlike the case of the latter,
which has been studied only in lymphoblastoid cells, 7472insC produces
no systematic change to the level of the upstream (ND6) mRNA,
leading to the suggestion that its effects are most likely on the
half-life of tRNASer(UCN) rather than on its processing
(19). Electrophoretic analysis of [14C]serine-labeled
tRNA also suggested only a minimal effect on aminoacylation.
To investigate in further detail the molecular effects of the 7472insC
mutation, we applied a variety of assays. These compared 143B
osteosarcoma-derived cybrid cell lines homoplasmic for the mutation
with those containing only wild-type mtDNA derived from the same
patient. Mitochondrial tRNA half-lives and synthesis rates were
measured via the use of ethidium bromide (EtBr) to block new
transcription of mtDNA (8). Effects on aminoacylation were studied
using oxidation-circularization of tRNA (12) combined with
minisequencing to determine the ratio of mutant to wild-type tRNA in
the final product mixture. Effects on base modification were studied by
primary sequence determination of tRNASer(UCN) (22, 23) and
on secondary/tertiary structure by partial RNase digestion under
non-denaturing conditions. Possible effects on tRNA stability were also
investigated by overexpression of mitochondrial EF-Tu. These assays
revealed a pronounced decrease in the rate of synthesis but not the
half-life of the mutant tRNA, combined with a small but clear decrease
in the extent of aminoacylation. Because of the absence of polarity
effects on the synthesis of downstream tRNAs of the light strand
transcription unit, the mutation is inferred to act
posttranscriptionally. Only very subtle effects on structure or
stability were found. Considered alongside previous findings on the
A7445G mutation (20, 21, 24), a consistent picture emerges of mtDNA
mutations that impair tRNASer(UCN) maturation producing
sensorineural deafness as their primary clinical phenotype.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines and Culture--
143B osteosarcoma cell cybrids
homoplasmic for the np7472insC mutation or for wild-type mtDNA from the
same individual were as described previously (17, 19). Specific cell
lines used in the experiments are indicated in figure legends. Except
where indicated, line 43 was used as the source of control tRNA and line 47 was used as the source of mutant tRNA. Cells were routinely cultured in media supplemented with uridine and pyruvate as described previously (19) and passaged weekly.
Oligonucleotides--
Custom-designed oligonucleotides were
purchased from DNA Technology (Aarhus, Denmark) or Genset (Paris,
France) and are as follows (all shown as 5'-3'). For Northern and
dot-hybridization: Ser11-AAGGAAGGAATCGAACCCCCCAAAGCTG (np
7451-7478 of human mtDNA, Ref. 25); Leu21 (Ref.
6)-GTTTTATGCGATTACCGGGC (np 3263-3244), Gln-GAATCGAACCCATCCCTGAG (np
4341-4360), Tyr-ATTTACAGTCCAATGCTTCACTC (np 5857-5879),
Asn-CACAAACACTTAGTTAACAGC (np 5679-5699), Lys-AAAGGTTAATGCTAAGTTAGC (np 8304-8324), and 5S1 (Ref. 8)- GGGTGGTATGGCCGTAGAC (np 294-276 of
GenBankTM entry X71797); for purification of
tRNASer(UCN): Ser-Bio, with 3'
biotinylation-AGCCAACCCCATGGCCTCCATGACTTTTTC (np 7485-7514 of
human mtDNA); for RT-PCR of circularized tRNASer(UCN):
cser1-TGGCCTCCATGACTTTTTC (np 7496-7514); and cser2-ATGGGGTTGGCTTGAAAC (np 7496-7479); for minisequencing: cser3-CTTGAAACCAGCTTTGGGGGG (np
7486-7467), and cser4-AAGGAAGGAATCGAACCCCCC (np 7451-7471). For
RT-PCR cloning of the human mitochondrial EF-Tu cDNA (from the TUFM gene),
BamHI/TufA51- CGCGGATCCACCACAATGGCGGCCGCCACCCTGCT and
HindIII/TufA33-stop-GGGAAGCTTTCAACCCCATTTGATATTCTTC;
for analysis of the presence of the TUFM transgene in
transfected cell clones by PCR and its expression by RT-PCR:
BGH-TAGAAGGCACAGTCGAGGC and TufA-52:
GTTCTCCCTGACTTGGAACATGGCCTGT; for analysis of the presence and
expression of empty vector in transfected cell clones: BGH (as
above) and T7-TAATACGACTCACTATAGGG.
Miscellaneous RNA and DNA Manipulations--
Total RNA was
prepared from cells using the Trizol method as previously described
(19). For sequencing, about 500 or 1000 A260
units (depending on the purpose) of total RNA were extracted from
100-200 9-cm plates of semiconfluent cells (~109 cells)
by Trizol extraction (Invitrogen). Total RNA was incubated at
37 °C for 2 h in 20 mM Tris-HCl, pH 9.0, to
deacylate tRNAs. After this treatment, the pH was adjusted to 7.5, and
RNA was fractionated on 1 × 45-cm DEAE-Sepharose fast flow
columns (Amersham Biosciences) as described previously (8). Fractions
enriched for tRNASer(UCN) were monitored by dot
hybridization with oligonucleotide Ser-11. Oligonucleotide labeling,
hybridization, and wash conditions were as used previously (19).
tRNASer(UCN) was finally purified by selective
hybridization using a solid phase 3'-biotinylated oligonucleotide probe
(Ser-Bio) followed by gel electrophoresis as described previously (26).
The final yield of tRNASer(UCN) for sequencing was
estimated at ~0.5-1 µg. RT-PCR used 0.0125 A260 units of random hexamers and Invitrogen
M-MLV-RTase. Except where indicated, PCR and RT-PCR reactions used
55 °C for the annealing step. Northern blotting to oligonucleotide
probes used the same conditions as described previously (19). Acidic
gel electrophoresis to distinguish aminoacylated and non-aminoacylated
tRNAs, as well as alkaline deacylation, were as described previously
(10).
RNA Sequencing and Structure
Analysis--
tRNASer(UCN), purified from cybrid cells
with or without the 7472insC mutation, was sequenced by a combination
of partial RNase digestion (22) and thin-layer chromatographic analysis
of 5'-postlabeled nucleotides (23) with modifications as described (8).
Briefly, for the partial digestion method, the tRNA was labeled at the 5' end with [ -32P]ATP (185 TBq/mmol, Amersham
Biosciences) and T4 polynucleotide kinase (MBI Fermentas) or at the 3'
end with [32P]pCp (110 TBq/mmol, Amersham
Biosciences) and T4 RNA ligase (MBI Fermentas) followed by
gel-purification and partial digestion under denaturing conditions. The
nucleotide-specific RNases used for partial digestion were RNase T1
(USB), specific for G, RNase U2 (Amersham Biosciences) specific for A > G, RNase CL, i.e. from chicken liver (Sigma),
specific for C, RNase A (USB), which cuts at C and U, RNase PhyM
(Amersham Biosciences), which cuts at A and U, plus RNase ONE (Promega)
and RNase T2 (Sigma), both of which are not base-specific. The
procedures for the chromatographic method were as described previously
(8). Briefly, the tRNA was incubated at 95 °C for 1.5 min in water
to induce single site, random cleavage. The 3'-half-fragments were
5'-labeled with [ -32P]ATP using T4 polynucleotide
kinase and electrophoresed in denaturing polyacrylamide gels. The
ladders of 5'-32P-labeled fragments were then cut out one
by one and eluted from the gel. Each of the 5'-labeled fragments was
then digested completely by RNase P1. The resultant 5'-labeled
nucleotides from each fragment were analyzed individually by
two-dimensional TLC with two different solvent systems (23) on 10 × 10-cm plates. Solvent system A consisted of isobutyric
acid/concentrated ammonia/H2O (66:1:33 by volume) in the
first dimension and 2-propanol/HCl/H2O (70:15:15 by volume)
in the second dimension. In solvent system B, the first dimension was
the same as that used for system A, but 0.1 M sodium phosphate, pH 6.8/ammonium sulfate/1-propanol (100 ml:60 mg:2 ml) was
used for the second dimension. For enzymatic probing of differences in
secondary/tertiary structure, the 5' end-labeled tRNA was refolded in
20-30 µl of renaturation buffer (150 mM NaCl, 10 mM MgCl2, 20 mM Tris-HCl, pH7.5) by
cooling from 95 to 35 °C at 2 °C per min and then digested with
specific RNases at 37 °C in the same buffer. Approximately 5000 cpm
of labeled RNA was used in each reaction. Alkaline digestions (in 50 mM Na2CO3, pH 9.0) were carried out
on non-renatured tRNA heated to 95 °C and immediately quenched
on ice. Intactness of the RNA to be used in enzymatic digests was
checked electrophoretically after renaturation.
Aminoacylation Analysis by Oxidation-Circularization
Assay--
The extent of aminoacylation of tRNASer(UCN)
was measured using the oxidation-circularization assay, essentially as
described by Börner et al. (12) but with the following
modifications. Total RNA was isolated by Trizol extraction from cells
grown to 90% confluence and dissolved on ice in 0.1 M
NaOAc, pH 5.0. In some experiments, small RNAs were isolated from 25 µg of total RNA, using chromatography on DEAE-Sepharose fast flow
(Amersham Biosciences). Eluates were divided into four aliquots,
precipitated, and used for two sets of oxidation-circularization
reactions. RNA preparations from control and mutant cybrids were mixed
in various arbitrary proportions, giving ratios of wild-type to mutant
signal in the final assay of between 0.2 and 3. cDNA was
synthesized from circularized tRNASer(UCN) using primer
cser1 and then amplified with primers cser1 and cser2 (92 °C, 2 min;
30 cycles of 94 °C, 30 s, 55 °C, 30 s, 72 °C,
30 s; final extension at 72 °C, 5 min). RT-PCR products were isolated by 10% PAGE, eluted, and purified (PCR purification kit, Qiagen). Quantitation of the ratio of mutant to wild-type product from
total and aminoacylated (oxidation-resistant) RNA was carried out by
minisequencing using the ABI Prism SNaPshot ddNTP primer extension kit
(PE Biosystems) under the conditions recommended by the supplier.
Extension primers cser3 and cser4 (for opposite strands) were used to
analyze all products.
tRNA Half-life and Synthesis Measurements--
For half-life
measurements, cell cultures were seeded at equal densities, giving
60-70% confluence, on 6-cm plates 14-16 h before the experiment.
They were then incubated in fresh medium containing 250 ng/ml of EtBr
for the times indicated in the figures. For synthesis measurements,
cells were seeded at 50% confluence on 9-cm plates 14-16 h before the
experiment and then incubated in medium containing 250 ng/ml of EtBr
for two days after which they were passaged into fresh medium on 6-cm
plates. Medium was again replaced after 5-6 h of recovery and then
daily until cells were harvested at the times indicated in figures.
Cells were either seeded initially at different densities so that they
reached approximately the same final densities at the time of
harvesting or else were passaged once more, reaching different final
densities according to the time at which they were harvested. The two
sets of data thus obtained were indistinguishable. Total RNA was
isolated by Trizol extraction, separated on 12% PAGE/7 M
urea/TBE gels, and analyzed by Northern hybridization. Northern blots
were quantitated by phosphorimaging as described previously (19).
Cell Transfection and Expression Analysis--
The mitochondrial
EF-Tu cDNA was amplified from human HEK293T cell cDNA in an
RT-PCR reaction using the primers BamHI/TufA51 and HindIII/TufA33 (4 min at 94 °C, then 30 cycles of 30 s at 94 °C, 1 min at 58 °C, 3 min at 72 °C,
with a final extension of 15 min at 72 °C). The product was digested
with BamHI and HindIII and cloned into
BamHI/HindIII-digested pcDNA3.1(-) Myc/His A
(Invitrogen). Clones were sequence-verified against GenBank accession
no. X84694 using BigDye terminator chemistry (Applied Biosystems,
Foster City, CA) with a combination of vector-specific and
mtDNA-specific primers. Sequencing products were analyzed by capillary
electrophoresis on an Applied Biosystems 310 Genetic Analyzer using the
manufacturer's software. The final TUFM clone (or empty
vector) was transfected into 143B osteosarcoma cybrid cell lines 43 (control) and 47 (7472insC mutant), seeded on 9-cm plates and grown to
50-60% confluence. For each transfection, 4 µg of DNA and 40 µg
of LipofectAMINE (Invitrogen) were diluted in 4 ml of Opti-MEM
(Invitrogen) and added to cells washed with Opti-MEM. After 5 h 8 ml of fresh medium was added, and after 24 h cells were placed
under selection in 1.6 mg/ml Geneticin (Invitrogen). After 1 week of
selection cells were passaged to obtain single clones, which were
picked and regrown in 6-well plates. The presence and expression of a
transgene was tested by PCR and RT-PCR, using the primers described above.
Western Blotting--
Whole cell lysates from transfected cell
clones were processed for Western blotting essentially as described
previously (27). Cells from a 6-cm plate were lysed in 50 µl of
PBS/1% Triton-X100/2.5 mM phenylmethylsulfonyl fluoride,
vortexed, incubated on ice for 30 min, and centrifuged for 2 min at
14,000 × gmax. Protein concentrations were
measured by the Bradford method (28). For detection of EF-Tu mouse
monoclonal mAb-68 (1:500 dilution) (Ref. 29, a kind gift of Frank
Henkler) and goat or horse anti-mouse horseradish peroxidase (1:10000
dilution) antibodies were used. Detection of PAK1 (p21-associated
kinase) used rabbit polyclonal PAK C-19 (Santa Cruz Biotechnology,
1:5000 dilution) and horse anti-rabbit horseradish peroxidase (1:10000
dilution) antibodies. Fluorographs were analyzed by densitometry.
 |
RESULTS |
The 7472insC Mutation Has Only a Minimal Effect on
tRNASer(UCN) Structure--
To evaluate the structural
effects of the 7472insC mutation, the primary sequence of
tRNASer(UCN) from two different control cybrid cell lines
was first determined (Fig. 1) via a
combination of partial RNase digestion of end-labeled tRNAs
(Donis-Keller method, see Ref. 22) and TLC of postlabeled mononucleotides derived from a standard, stepwise degradation procedure
(Kuchino method, see Ref. 23). The tRNA was first purified by
DEAE-Sepharose chromatography, followed by affinity hybridization to a
specific biotinylated oligonucleotide immobilized on
streptavidin-coated beads (26). Modifications of four kinds were
detected at five positions of the tRNA. Two pseudouridines were found,
one located in the anticodon stem (conventional position 28 based on
the scheme given in Ref. 30, actual position 25 numbered from the 5'
end), the other in the T-loop at conventional position 55 (actual
position 51), adjacent to a ribothymidine (conventional position 54, actual position 50), giving the conventional T C motif. In the
anticodon loop, two additional modifications similar to those found
previously in bovine mitochondrial tRNASer(UCN) (31) were
found: 3-methylcytosine at conventional position 32 (actual position
29) and N6-isopentenyladenosine
(i6A) or
2-methylthio-N6-isopentenyladenosine
(ms2i6A), which the solvent systems used for
TLC do not resolve, at conventional position 37 (actual position 34).
This modified base is probably ms2i6A because
bovine mitochondrial tRNASer(UCN) has exclusively
ms2i6A at this
position.2 The wobble base U
(conventional position 34, actual position 31) was found to be
unmodified.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Primary sequence and proposed secondary
structure of human mitochondrial tRNASer(UCN).
a, the tRNA sequence, shown in conventional clover-leaf
form, as deduced by a combination of single nucleotide analysis as in
b and partial RNase digestions as exemplified in Fig. 2
using both 5'- and 3'-labeled tRNA. The sequence is numbered, for
clarity, from the 5' end. Numbering of the modified nucleotides in
b is shown according to the conventional scheme (30), with
actual numbering shown in parentheses alongside. Sequencing of
tRNASer(UCN) independently purified from each of two
control cybrid cell lines (lines 34 and 43, see Ref. 19) gave identical
results. The unorthodox secondary structure, with a 6-bp anticodon stem
and only one nucleotide between the acceptor and D-stems, is the one
proposed earlier for mammalian mitochondrial tRNASer(UCN),
based on structural studies of the bovine tRNA (31). The nucleotide
analysis (phosphorimaging output) is shown for the five positions at
which modified 5'-nucleotides were detected. For each position, two
different solvent systems were used, A in the left-hand panel, B in the
right-hand panel as described under "Experimental Procedures." The
identities of the 5'-modified nucleotides were deduced from standard
chromatographic maps, as illustrated (see Ref. 23). All assignments
were also consistent with partial digestions (Fig. 2) based on known
RNase specificities and electrophoretic properties of RNA fragments
containing modified nucleotides. Note the presence of additional
nucleotides in the chromatograms, which are due to contaminating
fragments in the excised bands from the RNA ladder. Modified
nucleotides, which are poor substrates for end-labeling by T4 kinase,
can appear as relatively minor species in the chromatograms; this is a
recognized feature of the technique (23). Modified nucleosides are
abbreviated as follows: , pseudouridine; T,
ribothymidine; m3C, 3-methylcytidine,
i6A,
N6-isopentenyladenosine;
ms2i6A,
2-methylthio-N6-isopentenyladenosine. The
wobble-base U (conventional position 34, actual position 31) is
unmodified. The modification at conventional position 37 (actual
position 34) is assumed to be ms2i6A (see
"Results").
|
|
The equivalent tRNA was extracted from cells homoplasmic for the
mutation and analyzed in parallel, via partial RNase and alkaline
digestions (Fig. 2). No differences in
the digestion patterns were seen, except for the presence of the
additional G templated by the inserted nucleotide pair that defines the
mutation, which lies within a homopolymeric tract spanning from the
extra loop through the T-stem. All of the modifications identified by TLC produce characteristic changes in RNase sensitivity and/or mobility
that allow their presence to be unambiguously scored by the partial
RNase digestion method. In every case, the digestion pattern of the
mutant tRNA indicated that the modified base detected by TLC in the
wild-type tRNA was present also in the mutant tRNA.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Sequence comparison of
tRNASer(UCN) from control and 7472insC mutant cybrid cell
lines. a, a portion of the alkaline ladder and RNase T1
digest of the 5'-labeled tRNA from control cybrid cell line 43 (denoted
c) and mutant cybrid cell line 47 (denoted m).
The characteristic abnormal spacing associated with three of the
modified nucleotides (conventional numbering) is seen clearly in the
alkaline ladder for both control and mutant tRNA. b, partial
digestions of the same 5'-labeled tRNAs with each of five
ribonucleases. The portion of the gel shown covers all of the modified
nucleotides. Nuclease specificities were as expected from the
literature, except that the available preparations of RNase U2 cut
weakly also at pyrimidines. RNase CL was found to cut only weakly at
some Cs adjacent to another C, and weakly also at some Us. RNase A was
very variable in activity at different positions. RNase ONE, although
largely nonspecific, was found to cut only weakly or not at all at most
Gs. Control RNA from cybrid cell line 34 was also sequenced using RNase
PhyM, which gave concordant results. The enzyme is no longer available
from any source. The only reproducible difference between the mutant
and control tRNAs is the inserted G templated by the 7472insC mutation
itself. In both samples, the modified adenosine at conventional
position 37 (actual position 34), the modified cytidine at conventional
position 32 (actual position 29) and the ribothymidine at conventional
position 54 (actual position 50) are not cut with any enzyme tested.
The unmodified wobble-base U-34 (actual position 31) is cut as normally
by RNases A and T2, and also very weakly by RNase CL, in both samples.
The pseudouridines at conventional positions 28 (actual position 25)
and 55 (actual position 51) are cut efficiently by RNase T2, but not by
RNase A and only weakly or very weakly by any other enzyme. All
nucleotides outside the region shown were cut as predicted, based on
the known properties of the enzymes, in both control and mutant
tRNAs.
|
|
Partial RNase digestion carried out on non-denatured, 5'end-labeled
tRNASer(UCN) from homoplasmic mutant and control cybrid
cells also revealed only very subtle differences attributable to the
mutation (Fig. 3). Like the other
guanosines of the T-arm and extra loop, the inserted G was protected
from digestion by RNase T1. The T-arm and extra loop were almost
entirely inaccessible to all nucleases tested in both mutant and
control tRNASer(UCN); therefore it is not possible to
ascertain whether the inserted G creates an additional base pair in the
T-stem or is found in the extra loop or T-loop. However, the mutation
appears to cause no major structural disturbance.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 3.
Nuclease sensitivity of
tRNASer(UCN) under non-denaturing conditions.
a, summary of data from partial digestions using RNases T1,
U2, T2, A, and CL in many different experiments. Control and mutant
tRNAs gave essentially identical results. Filled circles
indicate residues that were strongly cut by at least one of the
diagnostic nucleases (or by RNase T2, in the case of some A residues
because under non-denaturing conditions RNase U2 gave poor signals).
Open circles indicate weakly reactive residues. The
approximate position of the additional G, templated by the inserted
nucleotide pair of the mutant mtDNA, is arrowed. Because the
whole region is protected from digestion by any of the nucleases
tested, in both mutant and wild-type tRNAs, it is not possible to
ascertain whether the extra G forms an additional base pair in the
T-stem or contributes to the extra loop or to the T-loop without
significantly disturbing the tertiary structures in which these loops
participate. b, a sample of the data on which a
is based. Digestions of tRNASer(UCN) from control (denoted
c) or mutant (denoted m) cybrid cells, with each
of three informative RNases. For clarity, the top and bottom halves of
the gel are shown separately. Note that the extra G in the mutant tRNA
is not accessible to RNase T1, but that the very poorly accessible
cytidines at conventional positions 56 (T-loop, actual position 52), 61 and 62 (T-stem, actual positions 57 and 58) are even less digestible by
RNase CL in the mutant tRNA, although RNase A does not distinguish the
two substrates in this region. The accessible guanosines of the
anticodon (G-35 on the conventional scheme, actual position 32) and at
the base of the acceptor stem (G-7, using conventional or actual
numbering) are arrowed for reference.
|
|
The 7472insC Mutation Decreases the Extent of Aminoacylation of
tRNASer(UCN)--
Although earlier analyses (19) concluded
that any effects on aminoacylation must be minor, we adopted a modified
version of the oxidation-circularization assay described by
Börner et al. (12) to obtain more precise information.
The need for this indirect assay arises from the fact that the
aminoacylated and non-aminoacylated tRNASer(UCN) cannot be
separated electrophoretically. The assay distinguishes aminoacylated
from non-aminoacylated tRNA on the basis that periodate oxidation renders the latter incapable of being circularized by RNA
ligase, whereas the former is protected by the amino acid and can be
circularized after subsequent deacylation. The amount of wild-type
versus mutant RNA in the circularized product can then be
determined by RT-PCR using a reverse transcription primer that anneals
adjacent to the 5' end of the tRNA and hence will only use circularized
RNA as a template. We used fluorescent minisequencing to compare the
amount of mutant and wild-type product derived from the total and
aminoacylated RNA fractions. To exclude any systematic error from the
choice of primer or fluorescent labels used for minisequencing, we
analyzed each product twice, using unrelated primers (and different
dNTP labels) for the two strands. The assay was originally developed
for studies of heteroplasmic cells, whereas the 7472insC mutation in
the test cells was homoplasmic. To circumvent this problem, we created
various arbitrary mixtures of RNA from cybrid cells containing
wild-type and mutant mtDNA and then used the assay to compare the ratio
of mutant to wild-type product in total RNA and aminoacylated RNA for
each such mixture. This approach is valid because the assay merely
determines the ratio between the aminoacylation efficiencies
of mutant versus wild-type tRNA.
As shown in Fig. 4, the proportion of
mutant tRNA in the aminoacylated fraction relative to its proportion in
unfractionated RNA, was uniformly around 75%, regardless of the mixing
ratio used, at least across the 6-fold range employed. Minisequencing on the two strands gave essentially identical results (77.3 ± 3.8% using the coding-strand primer, or 73.0 ± 3.9% using the non-coding strand primer), as did several different RNA preparations or
prior purification of the small RNA fraction by DEAE-Sepharose chromatography. The mutation therefore causes a 25% decrease in steady-state aminoacylation of tRNASer(UCN) in the 143B
cell background. It should be noted, however, that the assay assumes
that all of the aminoacylation that has occurred is by the correct
amino acid (serine). Any mis-aminoacylation of the mutated tRNA would
have been overlooked. Nevertheless, a substantial level of
mis-aminoacylation would very likely have been detected
electrophoretically in earlier studies because acylation of the 14 other mitochondrial tRNAs tested has produced a mobility shift
detectable on acidic polyacrylamide gels (32).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Extent of aminoacylation of
tRNASer(UCN) in control and mutant cybrid cells using the
oxidation-circularization assay. The results plotted are from a
total of 17 different experiments, using different, arbitrary mixtures
of RNA from control and mutant cells and based on four independent RNA
isolations from each source. In each case, the ratio of mutant to
wild-type product was analyzed by RT-PCR and fluorescent
mini-sequencing using primers for each strand (open circles,
coding-strand primer; filled circles, non-coding strand
primer). For each RNA mixture, parallel samples were analyzed that had
and had not been deacylated in vitro prior to the oxidation
step. Arbitrary mixtures are appropriate because the assay measures
only a ratio, namely that of the proportion of mutant tRNA
that is aminoacylated to the proportion of wild-type tRNA that is
aminoacylated. It also assumes that the amount of unreacted
(deacylated) tRNA is a small and constant proportion of the whole. The
fact that the data points lie on a straight line confirms the validity
of the approach. Despite the very different relative fluorescence
signals for the diagnostic chain terminators on the two strands, the
relative proportion of mutant to wild-type signal in aminoacylated RNA
versus total RNA was virtually identical for the two strands
in all samples analyzed. The line of slope 0.75 represents an
unweighted mean ratio of all data points. Identical results were
obtained when RNA samples were processed further to purify short
RNAs, confirming that the differences between mutant and control RNAs
are unlikely to result from differential lability during extraction.
RT-PCR performed on the circularized products routinely generated a low
proportion of apparently dimerized product, but this did not differ
according to the ratio of input mutant and wild-type tRNAs, and in fact
the minisequencing ratios obtained from excised, presumptive dimer
bands were invariably identical to those obtained from monomer bands
excised in the same experiment.
|
|
The 7472insC Mutation Has No Effect on the Half-life of
tRNASer(UCN)--
Although the aminoacylation defect
is modest, the observation is similar to that for the A3243G mutation
on tRNALeu(UUR), which results in defective aminoacylation
(8, 10-12) and is associated with a >70% decrease in the abundance
of the tRNA in cybrid cells at or near homoplasmy for the mutation (6,
11). In the latter case, the mutation also causes a large
decrease in tRNALeu(UUR) half-life (8). We therefore tested
whether the 7472insC mutation similarly affects
tRNASer(UCN) stability in cybrid cells. We used EtBr to
block mitochondrial RNA synthesis as described previously (8, 33, 34).
Wild-type and mutant cybrids were initially treated with EtBr at
various concentrations, and total RNA was extracted at various time
points after the addition of the drug. Northern blots of these RNA
samples, fractionated on urea-polyacrylamide gels, were probed for
mitochondrial tRNALeu(UUR) and tRNASer(UCN) and
for 5 S rRNA as a loading control. We selected the lowest concentration
of EtBr (250 ng/ml) that appeared to give complete inhibition of
mitochondrial RNA synthesis (i.e. above which the profiles of tRNA degradation were indistinguishable) and then repeated
the experiment a sufficient number of times using these conditions to
minimize the effects of experimental variation. Within the margins of
error, the half-lives of both tRNASer(UCN) and the control
tRNA, tRNALeu(UUR), were the same in 7472insC mutant
and wild-type cybrid cells. The different steady-state levels of
tRNASer(UCN) in mutant and wild-type cells must therefore
be due to differences in the rate of synthesis of the tRNA, not its stability.
During prolonged EtBr treatment, mitochondrial protein synthesis should
be rapidly shut down due to the short half-lives of mitochondrial
mRNAs (35). To check whether this was accompanied by tRNA
deacylation under conditions of ATP depletion, which might have
influenced the relative stability of the mutant and wild-type tRNAs, we
checked the aminoacylation status of mitochondrial tRNALys
and tRNALeu(UUR) electrophoretically. The latter remained
aminoacylated throughout the 24 h of EtBr treatment, although
tRNALys gradually became partially deacylated (Fig.
5b). Although aminoacylated and deacylated tRNASer(UCN) cannot be distinguished
electrophoretically, the aminoacylation difference between wild-type
and mutant tRNA allowed us to use the oxidation-circularization
minisequencing assay to detect changes in aminoacylation during the
course of the experiment. The relative extent of aminoacylation of the
mutant tRNA was slightly lower after 24 h of EtBr treatment than
in untreated cells (Fig. 5c), implying that a small amount
of deacylation was occurring. However, this does not appear to have
affected the half-life of the tRNA. On the other hand, the fact that
the changes in aminoacylation are modest means that the minimal effects
of the mutation on tRNA half-life are not an artifact attributable to
deacylation.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 5.
Decay kinetics of mitochondrial tRNAs in
control and 7472insC mutant cybrid cells. a, tRNA
levels were determined from phosphorimaging of Northern blots probed
with oligonucleotides specific for tRNASer(UCN) and
tRNALeu (UUR) using RNA isolated from cells at different
times during EtBr treatment. RNA levels expressed as a fraction of the
signal obtained from a panel of replicates taken at zero time (the time
at which EtBr was added) were converted to logarithms on the assumption
of first-order decay kinetics. All hybridization signals were
normalized against 5 S rRNA as loading control. The data plotted
represent the mean ± S.D. of five separate experiments. Lines of
best fit (least squares method) are shown, r2
for the four panels (clockwise, from top left) being
0.990, 0.985, 0.967, and 0.989, respectively. No significant
differences in tRNA half-life were inferred between control and mutant
cybrids or between the two tRNAs. b, analysis of the effects
of EtBr treatment on aminoacylation of mitochondrial tRNAs by acidic
gel electrophoresis and Northern hybridization. Samples deacylated at
pH 9 denoted as `d'. Graphical values, shown alongside the gel image,
are based on densitometric analysis. c, analysis of effects
of EtBr treatment on relative aminoacylation of mutant
versus wild-type tRNASer(UCN), by
oxidation-circularization-minisequencing assay, as in Fig. 4. Each data
point is the mean of at least 4 experiments, using both sense- and
antisense-strand oligonucleotides for minisequencing.
|
|
As a further test of the effect of the mutation on
tRNASer(UCN) stability we made use of the observation
that moderate over-expression of mitochondrial elongation factor EF-Tu
in yeast, via manipulation of its gene dosage, can complement a variety
of mutations affecting mitochondrial tRNAs (36, 37). EF-Tu binds
aminoacyl-tRNAs in a ternary complex with GTP, acting as a molecular
chaperone to facilitate their delivery to the acceptor site of the
ribosome. The complementation activity of yeast EF-Tu is presumably
based on the stabilization of mutant aminoacyl-tRNA structures that are
otherwise unstable. We transfected an EF-Tu expression construct into
cybrid cells containing either wild-type or 7472insC mutant mtDNA,
picked colonies, and verified the presence and expression of the
transgene by PCR and RT-PCR. We then tested the expression level of
EF-Tu by Western blotting and measured the representation of
tRNASer(UCN) by Northern blotting in stably transfected
clones compared with those transfected with only the empty vector.
Based on analysis of a panel of such transformants (Fig.
6), modest (up to 3-fold) overexpression
of mitochondrial EF-Tu in cybrid cells had no effect on the decreased
abundance of tRNASer(UCN) associated with the 7472insC
mutation, consistent with the above findings from EtBr-treated cells
that the mutation did not grossly affect the structure or turnover of
the tRNA.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
Effects on cybrid cells of overexpression of
mitochondrial EF-Tu. a, Western blots of whole cell
extracts (75 µg per lane) from several of the control and 7472insC
mutant cybrid cell clones that had been transfected either with empty
vector (A, clones a) or an EF-Tu expression construct
(E, clones e) for human mitochondrial EF-Tu. Blots were
probed for EF-Tu and, as loading control, for p-21-activated kinase 1. EF-Tu levels in cells transfected with the EF-Tu expression construct
were typically two to three times higher than those in cells
transfected with empty vector. b, Northern blot of RNA from
empty vector or EF-Tu expression construct-transfected cybrid cell
clones probed for tRNASer(UCN). Lanes representing the
parental cybrid cell lines are denoted ( ). As loading control, an
oligonucleotide probe for tRNALeu(UUR) gave approximately
equal hybridization in all lanes (not shown). c, levels of
tRNASer(UCN) in the same cells based on phosphorimaging
analysis of a series of Northern blots such as those shown in
b normalized against tRNALeu(UUR) and expressed
as a percentage of the signal from several replicates from the control
cybrid cell line 43. Control cybrid cells and clones are shown as
open bars, 7472insC mutant cybrids and clones as
filled bars. Clones with EF-Tu expression levels more than
twice that of untransfected or vector-transfected cells, based on
normalized densitometric analysis of Western blots, are denoted by
asterisks. The maximum increase of EF-Tu was 2.8-fold over
control cells. Normalization of Northern signals against G3PDH or ND1
mRNAs gave essentially the same results. For clarity, error bars
are not shown because generally these are mean values from just two or
three Northern blots that were in reasonably close agreement (within
the range of variation of the parental line, i.e. no more
than ± 5% of the control cell value).
|
|
The 7472insC Mutation Impairs the Synthesis of
tRNASer(UCN) but Not That of Downstream tRNAs of
the Light Strand Transcription Unit--
The above results suggest
that it is the synthesis of tRNASer(UCN), rather than its
turnover, that is affected by the mutation, raising the additional
question of whether the effect is transcriptional or
posttranscriptional. To address these questions directly we followed
the resynthesis of mitochondrial tRNAs in wild-type and mutant cells
depleted of mitochondrial transcripts by prolonged EtBr treatment (Fig.
7). EtBr was removed after 48 h, and
the cells allowed to recover for a further 7 days. After correcting for
the loading control (5 S rRNA), the signal for each tRNA was normalized
to its level in untreated control cells always included on the same gel
blot. The data plotted in Fig. 7 represent the means from six
experiments. No systematic effects were observed that depended on cell
density or the time at which cells were passaged. The heavy
strand-encoded tRNALeu(UUR) was again included as a control
to reveal any effects attributable to mtDNA copy number or other
inherent properties of the mitochondrial transcription system in
control versus mutant cell lines. To detect any polarity
effects on the downstream tRNAs of the light strand transcription unit,
we also probed for tRNATyr and tRNAGln. All
tRNAs returned to their starting levels within 5-7 days of recovery,
typically with a small "overshoot."

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
Effects of the 7472insC mutation on
mitochondrial tRNA synthesis. a, schematic diagram of
the 16.6-kb LSTU of human mtDNA, indicating the approximate positions
of the eight light strand-encoded tRNAs and ND6 mRNA with respect
to the light strand promoter PL.
Asterisks indicate the light strand-encoded tRNAs whose
synthesis was studied in the experiments. b, phosphorimaging
analyses of Northern blots of four mitochondrial tRNAs during EtBr
treatment and recovery. All Northern signals were first normalized
against the loading control (5 S rRNA) and then expressed as a fraction
of the signal for the tRNA in question from untreated control cells,
replicates of which were included on every blot. Solid
circles and lines, control cybrid cells (line 43).
Open circles and dotted lines, 7472insC mutant
cybrid cells (line 47). All data points are the means and standard
deviations of at least six experiments (where error bars are not
visible they are contained entirely within the plotted data points).
Zero time point indicated is the time EtBr was added. EtBr treatment
was terminated after 2 days (indicated by vertical arrows),
but tRNA levels continued to drop and only began to recover after a
further day. In general they reached starting levels after 5 days of
recovery. The inclusion of a heavy strand-encoded tRNA,
tRNALeu(UUR), controlled for any copy number differences
between the cell lines or arising from the EtBr treatment. The
steady-state level of an additional, light strand-encoded tRNA,
tRNAAsn, was also very similar in mutant and control
cybrids (not shown).
|
|
The rate of resynthesis of tRNASer(UCN) in mutant cells, as
judged by the recovery profiles shown in Fig. 7, was approximately
one-third of that in wild-type cells. For the other tRNAs, control and
mutant cells gave very similar recovery profiles. For all of the tRNAs analyzed, including the heavy strand-encoded control,
tRNALeu(UUR), both the starting and final levels reached
were slightly lower in the mutant than control cells, which indicates a
small effect of mtDNA copy number. We conclude that the synthesis of
the tRNASer(UCN) is specifically impaired by the mutation,
but the absence of polarity effects on downstream, light strand-encoded
tRNAs indicates that the effect must be posttranscriptional.
To investigate this further, we probed Northern blots with
oligonucleotides for tRNASer(UCN) and the regions
immediately upstream and downstream (antisense transcripts of COXI and
COXII). To control for possible cross-reaction to other transcripts, we
tested two different oligonucleotides for a given gene. We detected no
high molecular weight precursor-like transcripts, even at the longest
exposure times (data not shown). This applied to both mutant and
wild-type cybrid cells. The relevant RNA processing intermediates must
therefore be heterogeneous and/or of very low abundance and do not
accumulate in mutant cells to higher levels than in control cells.
 |
DISCUSSION |
Primary Effects of the 7472insC Mutation on Mitochondrial Gene
Expression--
Previous studies of 143B osteosarcoma cell cybrids
homoplasmic for the 7472insC mutation (19) indicated that the mutation is associated with approximately a 70% decrease in the steady-state level of tRNASer(UCN) compared with control cybrids. The
cells exhibit a modest, quantitative deficit of mitochondrial protein
synthesis (19) and mild respiratory impairment (17, 19). These earlier
findings left open several key questions regarding the primary effect
of the mutation, to which the present study provides clear answers.
In cells treated with EtBr, the half-life of the mutant tRNA was
indistinguishable from wild-type. This finding assumes that EtBr
treatment blocks mitochondrial RNA synthesis completely, but does not
directly affect RNA stability. This is supported by the fact that
across a wide range of concentrations (150 ng/ml to over 1 µg/ml),
EtBr treatment gave essentially the same decay profiles for
mitochondrial tRNAs. Another assumption is that the RNA used as loading
control, 5 S rRNA, is unaffected by the treatment. Use of
an alternate loading control in some experiments, a probe for a
cytosolic tRNA (19, 38), gave similar results (data not shown). The
half-life of tRNALeu(UUR) as measured in these
experiments (~18 h) is somewhat shorter than inferred previously in
HeLa cell cybrids (8), probably reflecting cell type differences in
gene expression that influence tRNA half-life.
In contrast, the 7472insC mutation profoundly and specifically affected
the synthesis of tRNASer(UCN) during recovery from EtBr
treatment. Quantitatively, the effect was similar to the decrease in
steady-state level (in both cases ~70%). Because turnover was
unaffected, simple first-order kinetic considerations support the view
that this decreased synthesis is sufficient to account for the effects
of the mutation on the tRNASer(UCN) level. In previous
experiments, we found that ND6 mRNA, encoded upstream of
tRNASer(UCN) in the light strand transcription unit (LSTU),
was not systematically affected by the mutation (19). The absence of
any effect on downstream tRNAs of the LSTU confirms that the effect of
the mutation is posttranscriptional. In principle the defect could be
in processing of the primary transcript or in a late step of
maturation, such as CCA addition, possible 3' end trimming, or the rate
of base modification.
Although we cannot exclude an interference with processing at the
termini of tRNASer(UCN), the absence of detectable
precursor accumulation in mutant cells suggests that the mutation most
likely affects the efficiency of a later step in
tRNASer(UCN) maturation. Because the mutant tRNA has
the same termini as wild-type tRNASer(UCN), any effect on
RNA processing would have to be quantitative rather than qualitative,
although it cannot be excluded that the mutation promotes
mis-processing and that incorrectly processed transcripts are turned
over very rapidly. Structural studies indicated only very subtle
differences in the region of the extra loop/T-arm that may conceivably
extend or bend the T-arm. The combined length of the acceptor and
T-stems is a critical determinant for pre-tRNA processing by RNase P in
Xenopus (39) and also by mammalian 3'-tRNA endonuclease
(40). Nuclear and mitochondrial RNase P appear to be identical in human
cells (41), and the same may be true of 3'-tRNA endonuclease (42). The
A7445G mutation has recently been shown to block processing of
pre-tRNASer(UCN) by mitochondrial 3'-tRNA endonuclease
in vitro (24). However, in the same assay, a substrate with
the 7472insC mutation was not processed at a rate that was
substantially below
wild-type.3 An interference
with 5' pre-tRNA processing remains a plausible mechanism, but effects
on later maturation steps seem more likely. Testing this will require
the development and validation of appropriate in vitro assays.
The finding of a reduced extent of aminoacylation raised the
possibility that inefficient charging of the mutant tRNA might contribute to its decreased abundance. However, partial deacylation during prolonged EtBr treatment was not accompanied by any detectable destabilization of the mutant tRNA. We conclude that the poor aminoacylation of the mutant tRNA is unlikely to have any bearing on
its decreased steady-state level: the two are independent effects of
the mutation.
The length and orientation of the extra arm, but not its specific
nucleotides, are known to be important for the interaction of
tRNASer with seryl-tRNA synthetase in both
Escherichia coli (43) and humans (44). However, a G
insertion equivalent to the 7472insC mutation did not block in
vitro aminoacylation of a bovine tRNASer(UCN)
substrate by bovine mitochondrial seryl-tRNA synthetase recombinantly expressed in E. coli (45). The reaction showed only a small change in kinetic parameters, consistent with the modest decrease in
aminoacylation efficiency in vivo reported here.
The combined effects of the 7472insC mutation on tRNA synthesis and
aminoacylation reduce the steady-state level of aminoacylated tRNASer(UCN) by ~75-80%. This is probably sufficient to
account for the modest protein synthesis deficiency and respiratory
phenotype and may also explain why the mutation only causes a severe
disease when homoplasmic or at high percentages of mutant mtDNA. The
fact that the impairment in protein synthesis is modest suggests that
tRNASer(UCN) may be present in excess in normal cells,
which may be of critical importance in understanding the tissue
specificity of the phenotype. The drop in abundance may not be critical
unless some other component of the mitochondrial protein synthesis
apparatus is limiting.
Other mitochondrial tRNA disease mutations, such as A3243G,
profoundly affect base modification (7, 8), and lack of wobble-base
modification seems to correlate with a more severe effect on protein
synthesis (8, 46). A3243G also has a more drastic effect on
aminoacylation both in vivo (12) and in some cybrid models
(10, 11), as well as affecting tRNA stability (8). However, in cells
80-90% heteroplasmic for A3243G the combined effects on the level of
functional, aminoacylated tRNAleu(UUR) may be similar
to the effects of homoplasmy for 7472insC on tRNASer(UCN).
This level of heteroplasmy for A3243G also has only modest effects on
mitochondrial functions in cybrid cells (3, 6), but is indisputably pathological.
A Similar Pathogenic Mechanism for Deafness-associated Mutations
Affecting Mitochondrial tRNASer?--
The molecular
effects of two deafness-associated mitochondrial mutations, A7445G and
7472insC, are strikingly similar (19-21, 24, and this paper),
suggesting a similar underlying pathogenic mechanism, based on impaired
synthesis of (aminoacylated) tRNASer(UCN).
Three other pathological mutations have been found in the same gene,
mapping to consecutive residues on the 5' side of the aminoacyl stem
(18, 47-49). T7512C has been reported in association with a disease
similar to the extended phenotype of 7472insC (18), elsewhere described
as "MERFF/MELAS overlap syndrome" (49). T7511C and T7510C are found
in families with maternally inherited hearing impairment (47, 48).
These mutations each disrupt base-pairing, converting an A-U to a G-U
base pair. The C12258A mutation in the acceptor stem of mitochondrial
tRNASer(AGY) has also been implicated in syndromic deafness
(50, 51). Helix-destabilizing mutations in another mitochondrial
tRNAIle have recently been shown to impair aminoacylation
(52). Disruptions of base-pairing in the middle of the acceptor stem
might also impair RNA processing based on in vitro
processing of a Drosophila pre-tRNA substrate (53).
Pathological mutations in mitochondrial tRNASer may
therefore affect aminoacylation, RNA processing, or both, leading to a
similar end result.
Genotype-Phenotype Correlations in Mitochondrial tRNA
Disease--
Mutations affecting tRNASer(UCN) mainly cause
sensorineural deafness, whereas mutations in other mitochondrial tRNA
genes are usually associated with wider, multi-system disorders. This
might reflect the rather unusual situation of tRNASer(UCN)
within the LSTU, separated from other functional transcripts on either
side by several kilobases. Virtually all other mitochondrial tRNAs are
immediately adjacent to another same-strand transcript on one or both
sides, the only other prominent exceptions being tRNAGln
and tRNAPro (see Fig. 7). Because of this punctuation model
of mitochondrial RNA synthesis (54), virtually all mutations that
affect tRNA processing will have multiple effects on adjacent transcript(s).
Although both A7445G and 7472insC manifest primarily as hearing
impairment, both are associated, at least in some individuals, with a
disorder affecting other tissues. In A7445G families many individuals
suffer also from palmoplantar keratoderma (55,
56).4 In 7472insC families
some individuals have a wider neurological syndrome including ataxia
and myoclonus (16-18), sometimes associated with a clear cytochrome
c oxidase deficiency (18). The wider but distinct features
of these disorders may be attributable to specific effects of each
mutation on processes other than on the synthesis of
tRNASer(UCN). In the case of 7472insC the aminoacylation
defect may produce tissue-specific features in individuals where the
expression of, for example, mitochondrial seryl-tRNA synthetase
(serine-tRNA ligase, SARSM) may be limiting. The recent identification
of single nucleotide polymorphisms in the SARSM gene (57)
may provide a useful tool to assess whether the clinical phenotype of
7472insC disease shows linkage with the locus, provided enough families can be collected. In turn, the specific features of A7445G disease may
be attributable to effects of the mutation on the expression of the
upstream gene of the LSTU, ND6 (21), which are not shared with 7472insC
(19).
In yeast, a variety of mitochondrial tRNA gene defects, including at
least one example of an apparent RNA processing defect, are
suppressible by modest increases in gene dosage of TUFM,
encoding mitochondrial EF-Tu (36, 37). The suppression mechanism is unknown, although the steady-state level of the affected tRNA is
invariably increased. In the case of 7472insC no such suppression was
found, consistent with the minimal effects of the mutation on tRNA
structure and turnover; although it is possible to hypothesize an
undetected effect on the translational properties of the tRNA without
an increase in its steady-state level. However, it would be virtually
impossible to detect this reliably, using currently available
techniques. Alternatively, there may be species differences in the
interaction of EF-Tu with tRNA or mitoribosomes, or EF-Tu may already
be present in excess, although a recent estimate (58) suggested
otherwise. In either case, our finding suggests that overexpression of
TUFM may not be a useful general strategy for correcting the
effects of mitochondrial tRNA mutations in humans.
 |
ACKNOWLEDGEMENTS |
We thank Jaanus Remme for advice regarding
structural analysis of tRNAs and Anja Rovio for invaluable technical assistance.
 |
FOOTNOTES |
*
This work was supported financially by grants from the
Academy of Finland, Tampere University Hospital Medical Research Fund, and a grant-in-aid for Scientific Research on Priority Areas from the
Ministry of Education, Culture, Sport, Science, and Technology of
Japan.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Supported by a graduate studentship of the Finnish Ministry
of Education.
§§
To whom correspondence should be addressed. Tel.: 358-3215-7731;
Fax: 358-3215-7710; E-mail: howy.jacobs@uta.fi.
Published, JBC Papers in Press, March 27, 2002, DOI 10.1074/jbc.M200338200
2
T. Suzuki, T. Suzuki, and K. Watanabe,
unpublished data.
3
L. Levinger, personal communication.
4
G. A. Vernham, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
MELAS, mitochondrial
encephalomyopathy with lactic acidosis and stroke-like episodes;
MERFF, myoclonic epilepsy with ragged-red fibers;
EtBr, ethidium bromide;
np, nucleotide pair;
RT, reverse transcription;
LSTU, light
strand transcription unit.
 |
REFERENCES |
| 1.
|
Di Mauro, S.,
and Andreu, A. L.
(2000)
Brain Pathol.
10,
431-441[Medline]
[Order article via Infotrieve]
|
| 2.
|
King, M. P.,
and Attardi, G.
(1988)
Science
246,
500-503
|
| 3.
|
Dunbar, D. R.,
Moonie, P. A.,
Zeviani, M.,
and Holt, I. J.
(1996)
Hum. Mol. Genet.
5,
123-129[Abstract/Free Full Text]
|
| 4.
|
Enriquez, J. A.,
Chomyn, A.,
and Attardi, G.
(1995)
Nat. Genet.
10,
47-55[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Masucci, J. P.,
Davidson, M.,
Koga, Y.,
Schon, E. A.,
and King, M. P.
(1995)
Mol. Cell. Biol.
15,
2872-2881[Abstract]
|
| 6.
|
El Meziane, A.,
Lehtinen, S. K.,
Hance, N.,
Nijtmans, L. G. J.,
Dunbar, D.,
Holt, I. J.,
and Jacobs, H. T.
(1998)
Nat. Genet.
18,
350-353[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Helm, M.,
Florentz, C.,
Chomyn, A.,
and Attardi, G.
(1999)
Nucleic Acids Res.
27,
756-763[Abstract/Free Full Text]
|
| 8.
|
Yasukawa, T.,
Suzuki, T.,
Suzuki, T.,
Ueda, T.,
Ohta, S.,
and Watanabe, K.
(2000)
J. Biol. Chem.
275,
4251-4257[Abstract/Free Full Text]
|
| 9.
|
Yasukawa, T.,
Suzuki, T.,
Ishii, N.,
Ueda, T.,
Ohta, S.,
and Watanabe, K.
(2000)
FEBS Lett.
467,
175-178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
El Meziane, A.,
Lehtinen, S. K.,
Holt, I. J.,
and Jacobs, H. T.
(1998)
Hum. Mol. Genet.
7,
2141-2147[Abstract/Free Full Text]
|
| 11.
|
Chomyn, A.,
Enriquez, J. A.,
Micol, V.,
Fernandez-Silva, P.,
and Attardi, G.
(2000)
J. Biol. Chem.
275,
19198-19209[Abstract/Free Full Text]
|
| 12.
|
Börner, G. V.,
Zeviani, M.,
Tiranti, V.,
Carrara, F.,
Hoffmann, S.,
Gerbitz, K. D.,
Lochmuller, H.,
Pongratz, D.,
Klopstock, T.,
Melberg, A.,
Holme, E.,
and Pääbo, S.
(2000)
Hum. Mol. Genet.
9,
467-475[Abstract/Free Full Text]
|
| 13.
|
Kaufmann, P.,
Koga, Y.,
Shanske, S.,
Hirano, M., Di,
Mauro, S.,
King, M. P.,
and Schon, E. A.
(1996)
Ann. Neurol.
40,
172-180[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Bindoff, L. A.,
Howell, N.,
Poulton, J.,
McCullough, D. A.,
Morten, K. J.,
Lightowlers, R. N.,
Turnbull, D. M.,
and Weber, K.
(1993)
J. Biol. Chem.
268,
19559-19564[Abstract/Free Full Text]
|
| 15.
|
Rossmanith, W.,
and Karwan, R. M.
(1998)
FEBS Lett.
433,
269-274[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Verhoeven, K.,
Ensink, R. J.,
Tiranti, V.,
Huygen, P. L.,
Johnson, D. F.,
Schatteman, I.,
Van Laer, L.,
Verstreken, M.,
Van de Heyning, P.,
Fischel-Ghodsian, N.,
Zeviani, M.,
Cremers, C. W. R. J.,
Willems, P. J.,
and Van Camp, G.
(1999)
Eur. J. Hum. Genet.
7,
45-51[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Tiranti, V.,
Chariot, P.,
Carella, F.,
Toscano, A.,
Soliveri, P.,
Girlanda, P.,
Carrara, F.,
Fratta, G. M.,
Reid, F. M.,
Mariotti, C.,
and Zeviani, M.
(1995)
Hum. Mol. Genet.
4,
1421-1427[Abstract/Free Full Text]
|
| 18.
|
Jaksch, M.,
Klopstock, T.,
Kurlemann, G.,
Dorner, M.,
Hofmann, S.,
Kleinle, S.,
Hegemann, S.,
Weissert, M.,
Muller-Hocker, J.,
Pongratz, D.,
and Gerbitz, K. D.
(1998)
Ann. Neurol.
44,
635-640[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Toompuu, M.,
Tiranti, V.,
Zeviani, M.,
and Jacobs, H. T.
(1999)
Hum. Mol. Genet.
8,
2275-2283[Abstract/Free Full Text]
|
| 20.
|
Reid, F. M.,
Rovio, A.,
Holt, I. J.,
and Jacobs, H. T.
(1997)
Hum. Mol. Genet.
6,
443-449[Abstract/Free Full Text]
|
| 21.
|
Guan, M. X.,
Enriquez, J. A.,
Fischel-Ghodsian, N.,
Puranam, R. S.,
Lin, C. P.,
Maw, M. A.,
and Attardi, G.
(1998)
Mol. Cell. Biol.
18,
5868-5879[Abstract/Free Full Text]
|
| 22.
|
Donis-Keller, H.
(1980)
Nucleic Acids Res.
8,
3133-3142[Abstract/Free Full Text]
|
| 23.
|
Kuchino, Y.,
Hanyu, N.,
and Nishimura, S.
(1987)
Methods Enzymol.
155,
379-396[Medline]
[Order article via Infotrieve]
|
| 24.
|
Levinger, L.,
Jacobs, O.,
and James, M.
(2001)
Nucleic Acids Res.
29,
4334-4340[Abstract/Free Full Text]
|
| 25.
|
Anderson, S.,
Bankier, A. T.,
Barrell, B. G.,
de Bruijn, M. H.,
Coulson, A. R.,
Drouin, J.,
Eperon, I. C.,
Nierlich, D. P.,
Roe, B. A.,
Sanger, F.,
Schreier, P. H.,
Smith, A. J.,
Staden, R.,
and Young, I. G.
(1981)
Nature
290,
457-465[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Wakita, K.,
Watanabe, Y.,
Yokogawa, T.,
Kumazawa, Y.,
Nakamura, S.,
Ueda, T.,
Watanabe, K.,
and Nishikawa, K.
(1994)
Nucleic Acids Res.
22,
347-353[Abstract/Free Full Text]
|
| 27.
|
Spelbrink, J. N.,
Toivonen, J. M.,
Hakkaart, G. A. J.,
Kurkela, J. M.,
Cooper, H. M.,
Lehtinen, S. K.,
Lecrenier, N.,
Back, J. W.,
Speijer, D.,
Foury, F.,
and Jacobs, H. T.
(2000)
J. Biol. Chem.
275,
24818-24828[Abstract/Free Full Text]
|
| 28.
|
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Wells, J.,
Henkler, F.,
Leversha, M.,
and Koshy, R.
(1995)
FEBS Lett.
358,
119-125[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Sprinzl, M.,
Horn, C.,
Brown, M,
Ioudovitch, A.,
and Steinberg, S.
(1998)
Nucleic Acids Res.
26,
148-153[Abstract/Free Full Text]
|
| 31.
|
Yokagawa, T.,
Watanabe, Y. I.,
Kumazawa, Y.,
Ueda, T.,
Hirao, I,
Miura, K. I.,
and Watanabe, K.
(1991)
Nucleic Acids Res.
19,
6101-6105[Abstract/Free Full Text]
|
| 32.
|
Enriquez, J. A.,
and Attardi, G.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
8300-8305[Abstract/Free Full Text]
|
| 33.
|
Knight, E.
(1969)
Biochemistry
8,
5089-5093[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Zylber, E.,
and Penman, S.
(1969)
J. Mol. Biol.
46,
201-204[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Gelfand, R.,
and Attardi, G.
(1981)
Mol. Cell. Biol.
1,
497-511[Abstract/Free Full Text]
|
| 36.
|
Rinaldi, T.,
Lande, R.,
Bolotin-Fukuhara, M.,
and Frontali, L.
(1997)
Curr. Genet.
31,
494-496[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Francisci, S.,
Bohn, C.,
Frontali, L.,
and Bolotin-Fukuhara, M.
(1998)
Curr. Genet.
33,
110-116[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Krupp, J. L.,
Shu, H. H.,
and Martin, N. C.
(1988)
Nucleic Acids Res.
16,
770[Free Full Text]
|
| 39.
|
Carrara, G.,
Calandra, P.,
Fruscolini, P.,
Doria, M.,
and Tocchini-Valentini, G. P.
(1989)
Cell
58,
37-45[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Nashimoto, M.,
Tamura, M.,
and Kaspar, R. L.
(1999)
J. Mol. Biol.
287,
727-740[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Puranam, R. S.,
and Attardi, G.
(2001)
Mol. Cell. Biol.
21,
548-561[Abstract/Free Full Text]
|
| 42.
|
Rossmanith, W.,
Tullo, A.,
Potuschak, T.,
Karwan, R.,
and Sbisa, E.
(1995)
J. Biol. Chem.
270,
12885-12891[Abstract/Free Full Text]
|
| 43.
|
Asahara, H.,
Himeno, H.,
Tamura, K.,
Nameki, N.,
Hasegawa, T.,
and Shimizu, M.
(1993)
Nucleic Acids Symp. Ser.
29,
207-208
|
| 44.
|
Wu, X. Q.,
and Gross, H. J.
(1993)
Nucleic Acids Res.
21,
5589-5594[Abstract/Free Full Text]
|
| 45.
|
Shimada, N.,
Suzuki, T.,
and Watanabe, K.
(2001)
J. Biol. Chem.
276,
46770-46778[Abstract/Free Full Text]
|
| 46.
|
Yasukawa, T.,
Suzuki, T.,
Ishii, N.,
Ohta, S.,
and Watanabe, K.
(2001)
EMBO J.
20,
4794-4802[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Hutchin, T. P.,
Parker, M. J.,
Young, I. D.,
Davis, A. C.,
Pulleyn, L. J.,
Deeble, J.,
Lench, N. J.,
Markham, A. F.,
and Mueller, R. F.
(2000)
J. Med. Genet.
37,
692-694[Abstract/Free Full Text]
|
| 48.
|
Sue, C. M.,
Tanji, K.,
Hadjigeorgiou, G.,
Andreu, A. L.,
Nishino, I.,
Krishna, S.,
Bruno, C.,
Hirano, M.,
Shanske, S.,
Bonilla, E.,
Fischel-Ghodsian, N.,
DiMauro, S.,
and Friedman, R.
(1999)
Neurology
52,
1905-1908[Abstract/Free Full Text]
|
| 49.
|
Nakamura, M.,
Nakano, S.,
Goto, Y.,
Ozawa, M.,
Nagahama, Y.,
Fukuyama, H.,
Akiguchi, I.,
Kaji, R.,
and Kimura, J.
(1995)
Biochem. Biophys. Res. Commun.
214,
86-93[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Lynn, S.,
Wardell, T.,
Johnson, M. A.,
Chinnery, P. F.,
Daly, M. E.,
Walker, M.,
and Turnbull, D. M.
(1998)
Diabetes
47,
1800-1802[Medline]
[Order article via Infotrieve]
|
| 51.
|
Mansergh, F. C.,
Millington-Ward, S.,
Kennan, A.,
Kiang, A. S.,
Humphries, M.,
Farrar, G. J.,
Humphries, P.,
and Kenna, P. F.
(1999)
Am. J. Hum. Genet.
64,
971-985[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Kelley, S. O.,
Steinberg, S. V.,
and Schimmel, P.
(2000)
Nat. Struct. Biol.
7,
862-865[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Mohan, A.,
and Levinger, L.
(2000)
J. Mol. Biol.
303,
605-616[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Ojala, D.,
Montoya, J.,
and Attardi, G.
(1981)
Nature
290,
470-474[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Sevior, K. B.,
Hatamochi, A.,
Stewart, I. A.,
Bykhovskaya, Y.,
Allen-Powell, D. R.,
Fischel-Ghodsian, N.,
and Maw, M. A.
(1998)
Am. J. Med. Genet.
75,
179-185[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Martin, L.,
Toutain, A.,
Guillen, C.,
Haftek, M.,
MacHet, M. C.,
Toledano, C.,
Arbeille, B.,
Lorette, G.,
Rotig, A.,
and Vaillant, L.
(2000)
Br. J. Dermatol.
143,
876-883[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Shah, Z. H.,
Toompuu, M.,
Hakkinen, T.,
Rovio, A.,
Smith, R. J. H.,
Cremers, F. P.,
Cremers, C. W. R. J.,
and Jacobs, H. T.
(2001)
Hum. Mutation
17,
433-434[Medline]
[Order article via Infotrieve]
|
| 58.
|
Cai, Y. C.,
Bullard, J. M.,
Thompson, N. L.,
and Spremulli, L. L.
(2000)
J. Biol. Chem.
275,
20308-20314[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. Sasarman, H. Antonicka, and E. A. Shoubridge
The A3243G tRNALeu(UUR) MELAS mutation causes amino acid misincorporation and a combined respiratory chain assembly defect partially suppressed by overexpression of EFTu and EFG2
Hum. Mol. Genet.,
December 1, 2008;
17(23):
3697 - 3707.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Ling, H. Roy, D. Qin, M. A. T. Rubio, J. D. Alfonzo, K. Fredrick, and M. Ibba
Pathogenic mechanism of a human mitochondrial tRNAPhe mutation associated with myoclonic epilepsy with ragged red fibers syndrome
PNAS,
September 25, 2007;
104(39):
15299 - 15304.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. O. Pohjoismaki, S. Wanrooij, A. K. Hyvarinen, S. Goffart, I. J. Holt, J. N. Spelbrink, and H. T. Jacobs
Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells
Nucleic Acids Res.,
November 6, 2006;
34(20):
5815 - 5828.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Yan, N. Zareen, and L. Levinger
Naturally Occurring Mutations in Human Mitochondrial Pre-tRNASer(UCN) Can Affect the Transfer Ribonuclease Z Cleavage Site, Processing Kinetics, and Substrate Secondary Structure
J. Biol. Chem.,
February 17, 2006;
281(7):
3926 - 3935.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mollers, K. Maniura-Weber, E. Kiseljakovic, M. Bust, A. Hayrapetyan, M. Jaksch, M. Helm, R. J. Wiesner, and J.-C. von Kleist-Retzow
A new mechanism for mtDNA pathogenesis: impairment of post-transcriptional maturation leads to severe depletion of mitochondrial tRNASer(UCN) caused by T7512C and G7497A point mutations
Nucleic Acids Res.,
September 30, 2005;
33(17):
5647 - 5658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, N. Fischel-Ghodsian, F. Schwartz, Q. Yan, R. A. Friedman, and M.-X. Guan
Biochemical characterization of the mitochondrial tRNASer(UCN) T7511C mutation associated with nonsyndromic deafness
Nucleic Acids Res.,
February 11, 2004;
32(3):
867 - 877.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. T. Jacobs
Disorders of mitochondrial protein synthesis
Hum. Mol. Genet.,
October 15, 2003;
12(90002):
R293 - 301.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Levinger, R. Giege, and C. Florentz
Pathology-related substitutions in human mitochondrial tRNAIle reduce precursor 3' end processing efficiency in vitro
Nucleic Acids Res.,
April 1, 2003;
31(7):
1904 - 1912.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|