HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 25, 22950-22958, June 21, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/25/22950    most recent M202682200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pelletier, B. Articles by Labbé, S. Search for Related Content PubMed PubMed Citation Articles by Pelletier, B. Articles by Labbé, S. Social Bookmarking                      What's this?

Fep1, an Iron Sensor Regulating Iron Transporter Gene Expression in Schizosaccharomyces pombe^*

Benoit Pelletier^§, Jude Beaudoin, Yukio Mukai^¶, and Simon Labbé

From the  Département de Biochimie, Université de Sherbrooke, Sherbrooke, J1H 5N4, Canada and ^¶ Department of Biotechnology, Osaka University, Osaka 565-0871, Japan

Received for publication, March 20, 2002, and in revised form, April 12, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Schizosaccharomyces pombe cells acquire iron under high affinity conditions through the action of a cell surface ferric reductase encoded by the frp1⁺ gene and a two-component iron-transporting complex encoded by the fip1⁺ and fio1⁺ genes. When cells are grown in the presence of iron, transcription of all three genes is blocked. A conserved regulatory element, 5'-(A/T)GATAA-3', located upstream of the frp1⁺, fip1⁺, and fio1⁺ genes, is necessary for iron repression. We have cloned a novel gene, termed fep1⁺, which encodes an iron-sensing transcription factor. Binding studies reveal that the putative DNA binding domain of Fep1 expressed as a fusion protein in Escherichia coli specifically interacts with the 5'-(A/T)GATAA-3' sequence in an iron-dependent manner. In a fep1 mutant strain, the fio1⁺ gene is highly expressed and is unregulated by iron. Furthermore, the fep1 mutation increases activity of the cell surface iron reductase and renders cells hypersensitive to the iron-dependent free radical generator phleomycin. Mutations in the transcriptional co-repressors tup11⁺ and tup12⁺ are phenocopies to fep1⁺. Indeed, strains with both tup11 and tup12 deletions fail to sense iron. This suggests that in the presence of iron and Fep1, the Tup11 and Tup12 proteins may act as co-repressors for down-regulation of genes encoding components of the reductive iron transport machinery.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Iron is an essential trace element (1, 2). Because of its ability to undergo electronic changes by adopting both the reduced (Fe²⁺) and oxidized (Fe³⁺) forms, iron serves as catalytic co-factor for a wide variety of indispensable enzymes (3, 4). Paradoxically, when present in excess, iron ions can have detrimental effects by reacting with reactive oxygen species such as hydrogen peroxide or dioxygen to produce free radicals that damage DNA, proteins, and membrane lipids (5). Therefore, cells possess specialized biochemical pathways that maintain the delicate balance between essential and toxic iron levels by controlling uptake and distribution (6).

Although iron is abundant in nature, its bioavailability is limited (7). In the presence of atmospheric oxygen, iron is oxidized to insoluble ferric hydroxides (8). Many organisms have developed different iron-scavenging systems for solubilizing iron and transporting it into cells, including cell surface reduction to soluble ferrous species, utilization of heme, and synthesis of siderophores, which are low molecular weight iron-specific chelators (9, 10). Production and secretion of siderophores is a commonly used mechanism in aerobic bacteria and fungi, except budding and fission yeasts (11). Although these two yeasts lack the ability to synthesize siderophores, they can utilize siderophores produced by other microbes (12). In some fungi including Ustilago maydis (13), Neurospora crassa (14), Penicillium chrysogenum (15), and Aspergillus nidulans (16), when iron is in excess, siderophore synthesis is negatively regulated at the transcriptional level by a repressor. The promoter element necessary for DNA binding of the repressor contains the nucleotides 5'-GATAA-3' (17). Indeed, it was determined that this short sequence bears a strong sequence similarity to the recognition site, named GATA element, which is recognized by a family of regulatory proteins termed GATA binding transcription factors (13, 18).

The use of bakers' yeast Saccharomyces cerevisiae as a model organism has led to the identification of critical components of the iron transport pathway (4, 19, 35). For high affinity iron uptake into cells, Fe³⁺ is reduced to Fe²⁺ by the Fre1 and Fre2 cell surface reductases (20-23). After reduction, Fe²⁺ ions are specifically transported across the plasma membrane by the Ftr1-Fet3 permease-oxidase complex (24). Within this complex, Fet3 can re-oxidize Fe²⁺ to Fe³⁺ in a copper-dependent oxidation reaction (25), allowing the passage of Fe³⁺ ions across the membrane in concert with Ftr1. In the absence of Fet3 activity, Fet4 can transport reduced iron across the plasma membrane with low affinity (26, 27). Alternative pathways for iron uptake in S. cerevisiae have been identified (28). For example, iron bound to siderophores can be taken up by cells through either components of the reductive iron uptake system or cell surface transporters of the ARN family (29). Furthermore, the cell wall mannoproteins Fit1, Fit2, and Fit3 have been found to mediate transport of iron (30). When cells are grown under iron starvation conditions, the expression of all yeast genes except FET4 encoding the above-mentioned components of the reductive and non-reductive iron uptake systems is up-regulated via the transcription factor Aft1 (30). Aft1 binds to the promoters of these genes in the absence of iron by interacting with the consensus cis-acting element, 5'-(T/C)(G/A)CACCC(A/G)-3' (31, 32, 34). When cells are grown under elevated iron concentrations, the Aft1 protein localizes to the cytoplasm (33), suggesting that Aft1 activity is modulated by its localization. Recently, studies in S. cerevisiae revealed a second iron sensor, Aft2 (36, 37), with extended homology (residues 38-285; 39%) to Aft1. Although Aft2 appears to control expression of genes involved in iron metabolism, a distinct regulatory function for Aft2 from that mediated by Aft1 has not been identified.

In Schizosaccharomyces pombe, studies have shown that Fe³⁺ is reduced to Fe²⁺ by the Frp1 cell surface reductase (38). Once reduced, Fe²⁺ is transported across the plasma membrane via a permease-oxidase complex called Fip1-Fio1, orthologs of the Ftr1-Fet3 complex in S. cerevisiae (39). Although Fio1 is similar to Fet3, by itself Fio1 cannot complement the iron starvation defects of an S. cerevisiae fet3 mutant strain, indicating that some molecular differences exist for high affinity iron uptake between the two species of yeast (39). It has been shown that the frp1⁺, fip1⁺, and fio1⁺ genes are transcriptionally repressed under iron-replete conditions (38-40). Interestingly, no sequence identity has been observed between the fio1⁺ and FET3 promoter sequences or with any other 5' regions of iron-responsive genes from S. cerevisiae. Furthermore, BLAST searches for Aft1 or Aft2 homologs in the S. pombe genome data base (41) have revealed no S. pombe proteins with significant identity. Based on this observation, we sought to determine a consensus DNA sequence requirement for the putative S. pombe iron-sensing protein and, subsequently, to identify the fission yeast iron metalloregulatory protein that regulates the iron transporter gene expression.

In this study, we demonstrate that iron-mediated repression of the reductive iron transporter gene fio1⁺ in S. pombe requires the promoter cis-acting element, 5'-(A/T)GATAA-3'. Furthermore, we find that the S. pombe Fep1 protein can sense and translate iron concentration changes to the iron transport machinery because of its ability to interact directly in an iron-dependent manner with the 5'-(A/T)GATAA-3' element found in the fio1⁺ promoter region, which gives a marked repression of the fio1⁺ gene expression. Moreover, we have also identified two proteins, Tup11 and Tup12, which act as putative co-repressors for iron repression of the fio1⁺ gene expression. Taken together, these results reveal the identity of cis- and trans-acting elements for molecular control of critical genes encoding components of the reductive iron uptake machinery in fission yeast.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Strains and Growth Conditions-- The S. pombe strains used in this study were the wild-type FY435 (h⁺ his7-366 leu1-32 ura4-18 ade6-M210) (42) and the fep1 disruption strain (h⁺ his7-366 leu1-32 ura4-18 ade6-M210 fep1::ura4⁺). To ascertain that the results observed were not specific to the S. pombe strain FY435, identical experiments were carried out with the strain JSY174 (h leu1-32 ura4-18 ade6-M210). The tup11 (h leu1-32 ura4-18 ade6-M210 tup11::ura4⁺), tup12 (h leu1-32 ura4-18 ade6-M210 tup12::LEU2), and tup11 tup12 double mutant (hleu1-32 ura4-18 ade6-M210 tup11::ura4⁺ tup12::LEU2) disruption strains are isogenic to the strain JSY174 (43). When plasmid maintenance was required, yeast cells were grown in Edinburgh minimal medium as described previously (44), except that the media contained only 74 nM FeCl₃. Iron deprivation or iron repletion was carried out by adding the indicated amount of BPS¹ or FeCl₃ to cells grown to mid-logarithmic phase (A₆₀₀ = 0.9-1.1) in Edinburgh minimal medium. At this mid-logarithmic phase, cells were treated for 90 min at 30 °C. Under nonselective conditions, cells were grown on yeast extract plus supplements (44). For observing the phleomycin-sensitive growth phenotype, 10 µg/ml phleomycin (Sigma) was added to yeast extract plus supplements. To detect the enhanced reductase activity associated with the inactivation of the fep1⁺ allele (fep1), a plate assay was used as described previously (45), except that the 2,3,5-triphenyltetrazolium chloride-containing overlay was poured on fresh colonies grown on YES plates, which contained 50 µM FeCl₃.

Plasmids and Site-directed Mutagenesis-- The plasmid pSP1fio1⁺-1155lacZ contains the fio1⁺ promoter region up to 1155 from the start codon of the fio1⁺ gene in addition to the E. coli lacZ gene. This latter plasmid was constructed via three-piece ligation by simultaneously introducing the EcoRI-StuI fragment of YEp357R (46) and the BamHI-EcoRI fragment from the fio1⁺ promoter containing 1155 bp of the 5'-noncoding region and the first 13 codons of the fio1⁺ gene into the BamHI-SmaI cut pSP1 vector (47). Four plasmids (pSP1fio1⁺-884lacZ, pSP1fio1⁺-793lacZ, pSP1fio1⁺-761lacZ, and pSP1fio1⁺-680lacZ) harboring sequential deletions from the 5' end of the fio1⁺ promoter were created from plasmid pSP1fio1⁺-1155lacZ using the ExoIII/mung bean nuclease method as described previously (48). The plasmid pSKfio1⁺297 containing nucleotides from position 922 to position 625 with respect to the A of the ATG codon of the fio1⁺ ORF was created to introduce mutations in either or both GATA elements (positions 800 to 795; positions 777 to 772) by site-directed mutagenesis. Precisely, the oligonucleotides 5'-⁷⁷⁹CCAATCTGGACAAAAGGGCGTCGATGTAATCCAGATGCCTGGAAG⁸²³-3', 5'-⁷⁵⁶CACTTTGATCGGTTGCGACAGGACCAATCTGGACAAAAGTTATCAGATG⁸⁰⁴-3', and 5'-⁷⁵⁶CACTTTGATCGGTTGCGACAGGACCAATCTGGACAAAAGGGCGTCGATGTAATCCAGATG⁸¹⁵-3' (letters that are underlined represent multiple point mutations in the GATA elements) were used in conjunction with pSKfio1⁺297 and the Chameleon mutagenesis kit (Stratagene, La Jolla, CA). The DNA sequence for each construct created was verified by dideoxy sequencing, and the fio1⁺ promoter fragment was inserted into the XhoI and SmaI sites of pCF83 (49) for analyzing heterologous reporter gene expression.

Disruption of the S. pombe fep1⁺ Gene-- A functional ura4⁺ cassette was isolated from pUR18 (50) by PCR. The primers were designed to create ClaI and NdeI sites at the beginning and the end of the ura4⁺ genetic marker, respectively. After digestion at these sites, the ura4⁺ fragment was inserted to replace two-thirds of the fep1⁺ ORF, leaving 477 and 200 bp each side of the fep1⁺ locus for homologous recombination, creating pfep1::ura4⁺. The gene disruption fragment (5'-fep1-ura4⁺-fep1-3') was generated by restriction endonuclease digestion using unique flanking sites (BamHI and Asp718) and then transformed into the appropriate S. pombe strains by electroporation (51). The allele status of the locus in all strains generated was verified using Southern blotting and diagnostic PCR. Conveniently, this disruption rendered the mutant strain unable to grow aerobically on medium containing 10 µg/ml phleomycin (Sigma), an antibiotic that confers iron-dependent toxicity. The phleomycin-sensitive growth phenotype, because of the inactivation of fep1⁺, was remediated by integration of the wild type fep1⁺ gene to the leu1 locus in fep1 strain cells. The plasmid for integration was constructed by insertion of a 3.2-kb SacII-XhoI genomic fragment encompassing the fep1⁺ gene, which was cloned into plasmid pJK148 (52) before transformation into cells for homologous recombination.

RNA Analysis Methods-- For RNase protection analyses (53), three plasmids for making antisense RNA probes were utilized. The plasmids pKSlacZ and pSKact1⁺ used were described previously (40, 48, 54). The plasmid pSKfio1⁺ was constructed by inserting a 218-bp BamHI-EcoRI fragment of the fio1⁺ gene into the same sites of pBluescript II SK. The antisense RNA hybridizes to the region between +91 and +309 downstream from the initiator codon of fio1⁺. For Northern blot analyses, the fep1⁺ gene was isolated by PCR using primers that corresponded to the start and stop codons of the ORF. This PCR product was purified using the GFX gel band purification kit (Amersham Biosciences). A ³²P-labeled probe was made from the DNA fragment using the Random primed labeling kit (Roche Molecular Biochemicals) and purified using the Quick spin probe purification column system (Roche Molecular Biochemicals). Hybridization was carried out according to the Schleicher & Schuell protocol. The S. pombe act1⁺ probe (40) was used as an internal control for normalization during quantitation.

Expression of the MBP-Fep1 Fusion Protein-- The DNA containing the amino-terminal 241 codons of Fep1 was fused in-frame to the maltose-binding protein. To generate this fusion, the fep1⁺ gene starting at +4 after the start codon up to +723 was amplified using Pfu Turbo polymerase (Stratagene). The polymerase chain reaction fragment was cloned into the BamHI-PstI sites of pBluescript II KS and sequenced to verify its integrity. The fragment was digested and cloned into the pMAL-c2X vector (New England BioLabs, Beverly, MA) using the same restriction sites. Plasmid pMAL-fep1⁺ was transformed into E. coli TB1. Fresh transformants of TB1 cells containing the plasmid pMAL-c2X or pMAL-Fep1 were grown to A₆₀₀ of 0.5 in rich medium (1% Bacto-tryptone, 0.5% yeast extract, 1% NaCl, and 0.2% glucose) containing 100 µg of ampicillin/ml. At this early growth phase, the cells were induced in the presence of FeCl₃ (0 and 1 mM) or BPS (1 mM) with 0.2 mM isopropyl--D-thiogalactopyranoside for 2 h at 25 °C. Harvested cells were washed once in ice-cold water and resuspended in C buffer (20 mM Tris-HCl at pH 7.4, 200 mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, and 1 mM phenylmethylsulfonyl fluoride) with an equal volume of glass beads and protease inhibitors (8 µg/ml aprotinin, 4 µg/ml pepstatin, 2 µg/ml leupeptin). The mixture was vortexed for 45 s at top speed at 4 °C for 4 times. After centrifugation at 4 °C, the whole cell extracts were purified by affinity chromatography using the amylose resin as described by the manufacturer.

Electrophoretic Mobility Shift Assays-- To demonstrate specific DNA binding activity for Fep1, electrophoretic mobility shift assay binding reactions were carried out using 1× binding buffer that contained 12.5 mM HEPES (pH 7.9), 75 mM NaCl, 4 mM MgCl₂, 1 mM EDTA, 10% glycerol, 4 mM Tris-HCl (pH 7.9), 0.6 mM dithiothreitol, 1 µg of poly(dI-dC)₂, 5 µM ZnSO₄, and 5 µM FeCl₃ unless otherwise stated. Typically, ~240 ng of affinity-purified MBP-Fep1 was incubated for 20 min at 25 °C with ~1 ng of ³²P-end-labeled double-stranded oligomers harboring the two 5'-(A/T)GATAA-3' sites. When indicated, competitors to concentrations specified in Fig. 7A were added together with the probe. Once incubated, the reaction mixtures were loaded onto a 4% native polyacrylamide gel (30:0.8 acrylamide/bis ratio) that had been preelectrophoresed for 60 min in 0.25× TB (44.5 mM Tris and 44.5 mM borate) at 4 °C. The DNA-protein complex was separated from the free probe by electrophoresis at 4 °C and 4 W constant power for 2 h. Subsequently, the gel was fixed, dried, and exposed to a Molecular Dynamics screen.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of Cis-acting Elements Responsible for Iron-repression of the fio1⁺ Multicopper Oxidase Gene Expression-- Studies of iron uptake in S. pombe show that the frp1⁺ gene encodes a ferric reductase, which reduces Fe³⁺ to Fe²⁺ at the cell surface (38, 55). Once reduced, Fe²⁺ is taken up by a permease-oxidase complex called Fip1/Fio1, which transports iron across the plasma membrane with high affinity (39). A hallmark of the genes encoding components of the high affinity iron uptake system including frp1⁺, fip1⁺, and fio1⁺ is the fact that they are transcriptionally expressed according to iron need. They are activated during iron deprivation and repressed by iron repletion (38-40). In S. pombe, the fip1⁺ and fio1⁺ genes share the same promoter, with the fip1⁺-fio1⁺ genes divergently transcribed (39). Consistently, it is thought that both genes share the same iron regulatory elements in that intergenic promoter. A previous investigation has shown that a short promoter region of the frp1⁺ gene (from position 332 to position 279 relative to the first nucleotide of the initiator codon) was involved in response to iron repletion (38). However, no regulatory element was defined in detail for the iron responsiveness of the frp1⁺ gene. The program GeneStream (Baylor College, Houston, TX) was used to determine a common cis-acting element between fip1⁺-fio1⁺ and frp1⁺ promoters. Comparison of the fip1⁺-fio1⁺ intergenic promoter with frp1⁺ revealed one short region exhibiting 68.5% identity in 54-bp overlap between the two promoters (Fig. 1). Within this shared promoter segment, we noted the presence of two copies of a repeated sequence, 5'-(T/A)GATA(A/T)-3', similar to the binding sites for the GATA family transcription factors (56). A third sequence, highly conserved but distinct from the two GATA sequences, was also observed at the 3' end of that promoter segment. To ascertain whether the two GATA-like elements play a role in fio1⁺ regulation by iron, a series of nested 5' deletions of promoter sequences beginning at position 1155 were created in the plasmid pSP1fio1⁺-1155lacZ (Fig. 2). This fusion promoter was able to down-regulate (~2-fold) and up-regulate (~8-fold) lacZ mRNA expression in the presence of iron or BPS, respectively (Fig. 2C). Removal of the fio1⁺ upstream region between 1155 and 884 had little effect on the iron-dependent regulation of the fio1⁺-lacZ fusion, except for the magnitude of the response, which was more pronounced with ~3-fold repression in response to iron and ~13-fold activation under iron starvation conditions (Fig. 2C). Further deletion to position 793 gave high constitutive levels of fio1⁺-lacZ fusion gene expression with failure to repress gene expression in response to iron concentrations below 100 µM. Under iron deprivation conditions, increased gene expression was detected. When the fio1⁺ promoter was further deleted to position 761, the fio1⁺-lacZ gene was still remarkably highly expressed. Furthermore, this pSP1fio1⁺-761lacZ derivative was completely defective in iron-regulated gene expression. Deletion to position 680 abolished the highly expressed steady-state level of fio1⁺-lacZ mRNA, lowering its expression to a minimal threshold. Interestingly, this 81-bp DNA region between positions 761 and 680 contained the above-mentioned third conserved region located at the 3' end of the two GATA-like elements. However, our data do not allow us to establish whether this third conserved DNA region was responsible by itself for high constitutive levels of fio1⁺-lacZ fusion gene expression. Because of the observation that the integrity of the region between positions 884 and 761 was essential for driving iron repression of the fio1⁺-lacZ fusion gene, we examined whether a fio1⁺ promoter segment including this region could regulate a heterologous reporter as a function of iron availability (Fig. 3). A short 297-bp DNA segment derived from the fio1⁺ promoter (positions 922 to 625) was inserted in its natural orientation upstream of the minimal promoter of the CYC1 gene fused to lacZ in pCF83 (49). This fusion was able to repress (~3-fold) lacZ mRNA expression in the presence of iron. Conversely, under iron starvation conditions, lacZ mRNA expression was strongly derepressed (~12.5-fold) as compared with the level of transcript detected from control (untreated) culture (Fig. 3). Within this 297-bp DNA segment, two copies of a repeated sequence, 5'-(T/A)GATAA-3', which bears a striking similarity to the binding sites for the GATA transcription factors, was altered in either or both repeats. Cells carrying these fio1⁺-CYC1-lacZ fusion plasmids were assayed for iron-regulated expression of lacZ mRNA (Fig. 3). Although the overall magnitude of the response is clearly optimal with the presence of both elements, the presence of only one of the two elements is sufficient to confer regulation in a iron-dependent fashion. As compared with the wild type promoter segment, ~40% of the response was still observed when the first element was unaltered and the second one mutated (Fig. 3). When the first element was mutated and the second one was wild type, although the down-regulation of the lacZ gene was compromised, induction was still observed in response to iron limitation. Indeed, when both repeats were mutated, there was a complete lack of iron-responsive gene expression (Fig. 3). Taken together, these results show that a conserved element in the fip1⁺-fio1⁺ intergenic promoter with the sequence 5'-(T/A)GATAA-3', which is also found as direct repeats in the frp1⁺ promoter, plays a critical role in iron-regulated gene expression in fission yeast.

View larger version (11K): [in this window] [in a new window]   Fig. 1.   Short conserved region between the fip1+-fio1+ and frp1+ promoters. Two putative GATA-like elements of the fip1+-fio1+ promoter are boxed. These GATA-like sequences are found within a predicted iron-dependent regulatory region of the frp1+ promoter (38), which has yet to be characterized.

View larger version (20K): [in this window] [in a new window]   Fig. 2.   Mapping of the fio1+ promoter region critical for iron-mediated repression. A, representative RNase protection assay from strain FY435 containing the fio1+ promoter-lacZ fusion. Total RNA from BPS (B) (100 µM), control (), or FeCl3 (1 and 100 µM) cultures was isolated. The lacZ and act1+ mRNA steady-state levels are indicated with arrows. B, schematic representation of nested 5' deletions of fio1+ promoter sequences. The gray boxes indicate the location of the 5'-(A/T)GATAA-3' elements within the fio1+ promoter. The nucleotide numbers refer to the position relative to the A of the start codon of the fio1+ ORF. C, quantitation of lacZ levels after treatments shown in A. The values are the means of three replicates ±S.D.

View larger version (19K): [in this window] [in a new window]   Fig. 3.   The fio1+ promoter GATA elements mediate iron-dependent repression to the minimal promoter CYC1-lacZ. A, RNase protection analysis of repression by iron (1 and 100 µM) versus low () or iron-starved activation by BPS (100 µM). CYC1-lacZ fusion genes harboring wild type (WT) DNA fragments and GATA mutants (M1, M2, M1,2) derived from the fio1+ promoter were assayed. The lacZ and act1+ mRNA levels are shown with arrows. B, the gray boxes indicate the wild type repeated 5'-(A/T)GATAA-3' element, and the filled boxes represent the mutant elements. The nucleotide numbers refer to the position relative to the A of the ATG codon of the fio1+ ORF. C, reporter gene activities after treatments shown in A. The data are the means of three replicates ±S.D.

The fio1⁺ Gene Expression is Negatively Regulated by Iron through Fep1-- Because of the presence and requirement of the cis-acting element 5'-(T/A)GATAA-3' for appropriate regulation of the fio1⁺ gene expression, we sought to identify a trans-acting protein able to recognize such a DNA binding motif. Analysis of genomic DNA sequence from the S. pombe Genome Project revealed four complete ORFs that encode putative GATA-type transcription factors. Among them, SPAC23E2.01² (57) encodes a protein that exhibits an extended homology to four previously identified iron transcriptional repressors of siderophore biosynthesis in other fungi (16). This polypeptide of 564 amino acids, which we have termed Fep1 (Fe protein 1), has a predicted molecular mass of 60.6 kDa (Fig. 4A). The amino-terminal 220 amino acids of Fep1 bears strong identity (42%) to the amino-terminal region of Srea (residues 87-300) from A. nidulans (16), Srep (residues 77-287) (42%) from P. chrysogenum (15), Urbs1 (residues 304-532) (39%) from U. maydis (13), and Sre (residues 86-331) (37%) from N. crassa (14). Within this region of Fep1 reside two GATA-type zinc finger motifs (Fig. 4A). Analogous to the situation for urbs1 and sre, the steady-state levels of fep1⁺ mRNA were found to be constitutive and unresponsive to cellular iron status (Fig. 4B). Interestingly, we observed two fep1⁺ transcripts of ~3.1 and ~1.6 kb, with the lower one much weaker relative to the upper one (Fig. 4B). These two fep1⁺ mRNA species may represent RNAs in which two distinct sites of poly(A) addition have been utilized. To investigate the role of Fep1 in fission yeast, we deleted the fep1⁺ gene (fep1). Inactivation of fep1⁺ gave rise to a high level of fio1⁺ gene expression without any change in response to iron repletion or iron starvation conditions (Fig. 5). In the fep1 strain, the fio1⁺ gene was highly derepressed by ~18-fold as compared with the basal level of fio1⁺ transcript detected in the wild type strain (fep1⁺) (Fig. 5B). Moreover, cells harboring an inactivated fep1⁺ gene (fep1) exhibited increased activity of the cell surface metalloreductase(s) (Fig. 6A), presumably as a consequence of lack of transcriptional repression of gene(s)-encoded reductase(s) (e.g. frp1⁺). Using a plate assay for detection of cell surface reductase activity (45), we observed that fep1 cells exhibited a strong and bright red coloration as a consequence of the tetrazolium salt reduction to formazan that occurs at the cell surface. Conversely, reductase activity is much lower in fep1⁺ wild type cells or in mutant cells corrected by the restitution of a wild type copy of the fep1⁺ gene. Consistently, fep1 mutant cells displayed hypersensitivity to phleomycin, an antibiotic that cleaves nucleic acids in the presence of excess iron when cells are grown aerobically (58, 59). As shown in Fig. 6B, mutant cells (fep1) were unable to grow in the presence of the drug. In contrast, fep1 cells in which the wild type fep1⁺ gene was re-integrated regained phleomycin resistance, thereby indicating that the inability to grow was linked with the fep1 mutation (Fig. 6B). Taken together, these data indicate that fep1 cells accumulate iron in excess of the physiological requirement and suggest that Fep1 plays a critical role as a sensor to repress iron transporter gene expression as a function of iron availability.

View larger version (39K): [in this window] [in a new window]   Fig. 4.   Fep1 protein sequence and fep1+ mRNA levels. A, shown is the Fep1 amino acid sequence depicted by its single-letter code. The NH2-terminal region of Fep1 contains two GATA-type zinc finger motifs (ZF1 and ZF2). The RXXE motif is in bold. The arginine 184 is marked with an asterisk. The up arrowhead defines the portion of the protein that we expressed as the fusion product with the maltose-binding protein in E. coli. A leucine-proline dipeptide repeat is shown with a double line underneath. B, the steady-state levels of fep1+ mRNA species are unaffected by exogenous iron chelators ferrozine (Fz, 100 µM) and BPS (B, 100 µM) or by FeCl3 (Fe, 100 µM). Two fep1+ transcripts of ~3.1 and ~1.6 kb are indicated with solid and dashed arrows, respectively. The bottom panel shows act1+ mRNA levels under the same conditions as a control. M, reference marker.

View larger version (18K): [in this window] [in a new window]   Fig. 5.   Fep1 is required for iron-mediated repression of the fio1+ gene expression. A, the indicated isogenic strains were grown to mid-logarithmic phase in yeast extract plus supplements. BPS (B, 100 µM) or FeCl3 (Fe, 1 and 100 µM) was added, and after a 90-min incubation at 30 °C, total RNA was isolated. Shown is a representative RNase protection assay of fio1+ and act1+ (as control) mRNA steady-state levels. B, values are the averages of triplicate determinations ±S.D.

View larger version (25K): [in this window] [in a new window]   Fig. 6.   Inactivation of the fep1+ gene perturbs the homeostatic control of reductive iron acquisition. A, S. pombe strain bearing the disrupted fep1 allele displays high levels of cell surface ferrireductase activity as indicated by the dark red formazan that precipitates around the colony within 10-90 min. As a control, the wild type strain (fep1+) or the disruption strain in which the wild type fep1+ gene was re-integrated (fep1; leu1::fep1+) exhibits much lower reductase activity as shown by a lack of coloration to a level comparable with that of fep1 cells. B, the indicated isogenic strains were spotted onto yeast extract plus supplements containing the iron-dependent free radicals generator phleomycin. The ability of a copy of the wild type fep1+ gene to suppress phleomycin sensitivity when re-integrated was assayed.

Fep1 Interacts Directly with GATA Sequences in an Iron-dependent Manner-- Based on the gene expression data we obtained, we predicted that the Fep1 factor directly interacts with 5'-(T/A)GATAA-3' sequences to mediate iron regulation. To test this hypothesis, we produced in E. coli cells a MBP-Fep1 fusion protein that comprises the amino-terminal region of Fep1 from residues 2 to 241. The polypeptide was purified to near homogeneity using two rounds of one-step affinity chromatography based on MBP affinity for maltose (60).³ To examine whether the amino-terminal domain of Fep1 (residues 2-241) interacts with GATA-like elements, DNA binding experiments were carried out with the purified fusion protein. As shown in Fig. 7 by a representative electrophoretic mobility shift assay, the wild type ³²P-labeled 46-bp oligomer, which is identical to the fio1⁺ upstream region between 808 and 762 relative to the first nucleotide of the initiator codon, forms a strong DNA-protein complex in the presence of Fep1. To investigate the specificity of this complex formation, we carried out competition experiments with unlabeled oligomers either wild type or containing multiple point mutations in either or both GATA motifs within the 46-bp fio1⁺ DNA fragment (Fig. 7). Formation of the complex was inhibited by incubation with excess wild type oligomer but not by the double mutant M1,2 competitor (Fig. 7A), indicating that the complex is attributable to sequence-specific interactions. When the oligomer had the first GATA sequence (M1) mutated, the complex formation was only slightly diminished. In contrast, the oligomer harboring identical point mutations but within the second GATA sequence (M2) competed almost as well as the wild type oligomer, indicating that the first GATA motif is the strongest element for Fep1 binding, whereas the second motif is much weaker. Interestingly, there is a good correlation between the binding affinity of Fep1 toward the two GATA elements, as assayed in vitro by electrophoretic mobility shift assay analyses, and their relative strength for transcriptional iron repression in vivo (Figs. 2 and 3). To test whether the MBP-Fep1 fusion protein binds the 5'-(T/A)GATAA-3' elements in a iron-dependent manner, electrophoretic mobility shift assay experiments were performed using preparations derived from E. coli expressing the MBP-Fep1 fusion protein and from cells containing the expression plasmid alone as a control. As shown in Fig. 8A by a representative electrophoretic mobility shift gel, the wild type 46-bp double-stranded DNA fragment formed a complex with MBP-Fep1 when the fusion protein was purified from E. coli cells grown in the presence of 1 mM FeCl₃ before extract preparation and purification. Although this complex was also detected with purified MBP-Fep1 prepared from untreated E. coli cells, no such complex was observed when the purified fusion protein was prepared from cells grown in the presence of BPS (Fig. 8A). The proteins produced from cells grown under iron-limiting conditions appeared less stable as shown in Fig. 8B. Taken together, these results strongly suggest that Fep1 differentially binds the 5'-(T/A)GATAA-3' elements under conditions of iron adequacy to repress the expression of the fio1⁺ and fip1⁺ (and possibly frp1⁺) iron transport genes.

View larger version (34K): [in this window] [in a new window]   Fig. 7.   The MBP-Fep1 fusion protein differentially binds the 5'-(A/T)GATAA-3' elements. A, electrophoretic mobility shifted gel of a representative competition experiment using affinity-purified MBP-Fep1. Competition was conducted with double-stranded DNA unlabeled oligomers corresponding to 5'-(A/T)GATAA-3' wild type (WT) and mutant elements (M1, M2, and M1,2). The amount of competitor used in each reaction is shown over the lanes, and the probe concentration was ~1 ng/reaction. B, bound probe DNA; F, free probe DNA. B, sequences of the synthetic oligomers used. The boxes indicate the wild type element 5'-(A/T)GATAA-3', whereas the boxes marked with dots indicate that the element contains six substitutions. The nucleotide numbers refer to the position relative to the A of the initiator codon of the fio1+ ORF.

View larger version (19K): [in this window] [in a new window]   Fig. 8.   The fio1+ GATA elements are bound in an iron-dependent manner by MBP-Fep1 fusion protein. A, electrophoretic mobility shift analysis was performed using chromatographic fractions prepared from E. coli cells expressing either the plasmid alone (c2X) or the MBP-fep1+ fusion allele. Iron-treated cells (1 mM FeCl3), which produce MBP-Fep1, exhibit a DNA-protein complex, which is absent in preparations from cells treated with BPS (100 µM). FP, free probe DNA. The DNA-protein complex (B) is observed using an oligomer, which is identical to the fio1+ upstream region between 806 and 765 relative to the A of the start codon of the fio1+ ORF. B, MBP-Fep1 fusion protein isolated from E. coli cultures grown in the presence of 0 (), 1 mM FeCl3, or 1 mM BPS was analyzed by immunoblotting using anti-MBP antibody. MBP-Fep1 was detected with an apparent molecular mass of ~69.5-kDa, whereas MBP fused to  peptide exhibits a faster electrophoretic mobility with a molecular mass of ~50.0-kDa.

A Role for S. pombe Tup11 and Tup12 for Appropriate Expression of the fio1⁺ Gene-- Because fio1⁺ gene down-regulation by iron is controlled by Fep1, which acts as a transcriptional repressor, we sought to identify additional components that participate in the iron-mediated inactivation of the high affinity iron transport genes. The S. pombe Tup11 and Tup12 encode proteins required for repression of the fbp1⁺ gene, which is down-regulated when cells are grown on glucose (43, 61). Much like S. cerevisiae Tup1, S. pombe Tup11 binds specifically to histone H3 and H4, and it is thought that the protein forms a multimeric complex with Tup12 and a putative S. pombe Ssn6 ortholog to repress gene expression in fission yeast (43). Based on information from S. cerevisiae, it is highly likely that this complex does not bind DNA directly but is recruited by sequence-specific DNA binding transcription factors (62). Using isogenic strains harboring wild type tup11⁺ and tup12⁺ genes or insertionally inactivated tup11, tup12, or tup11 tup12 double mutant genes, we ascertained whether Tup11 and Tup12 play a role in fio1⁺ gene regulation as a function of cellular iron status (Fig. 9). In the wild type strains, although low basal levels of expression were observed, fio1⁺ mRNA were reduced (~2-3-fold) in the presence of iron. Conversely, in the presence of BPS, fio1⁺ mRNA levels were induced (~3-7-fold) over basal levels. In the tup11 and tup12 single mutant strains, a similar profile of fio1⁺ gene expression was found, except for the magnitude of the fio1⁺ steady-state mRNA levels detected in the tup12 mutant strain, which were more pronounced under each culture condition used (~3-fold). In the tup11 tup12 double mutant strain, a high constitutive level of fio1⁺ mRNA was observed, with a lack of significant down (~1.1-fold) or up (~1.4-fold) regulation of the fio1⁺ gene expression. Because the strain with both tup11 and tup12 deletions fails to sense iron, this suggests that the Tup11 and Tup12 proteins may act downstream of Fep1 (Fig. 10). Taken together, these data reveal that transcriptional repression of the fio1⁺ iron transport gene in fission yeast by the iron-responsive repressor Fep1 requires functional tup11⁺ and tup12⁺ genes.

View larger version (17K): [in this window] [in a new window]   Fig. 9.   Tup11 and Tup12 act as co-factors for appropriate iron repression of fio1+ gene expression. The isogenic strains JY741 (WT) (tup11+ tup12+), tup11, tup12, and tup11 tup12 were grown to early log phase in yeast extract plus supplements. The cultures were incubated in the absence () or presence of FeCl3 (1 and 100 µM), FeSO4 (100 µM), or BPS (100 µM) for 90 min. After total RNA extraction, the fio1+ steady-state mRNA levels were analyzed by RNase protection assay. fio1+ and act1+ levels are indicated with arrows. The wild type strain FY254 (left side) was used as control. M, reference marker.

View larger version (11K): [in this window] [in a new window]   Fig. 10.   A model for iron-responsive gene regulation in fission yeast. In the presence of iron, Fep1 binds DNA and forms a complex with Tup11 and Tup12, which act as co-repressors to inactivate gene expression. Conversely, in the absence of iron, the genes (e.g. fio1+) encoding components of the iron transport machinery are synthesized since Fep1 fails to bind DNA.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In S. pombe, the frp1⁺, fip1⁺, and fio1⁺ genes involved in reductive iron acquisition are transcriptionally regulated by iron availability (38-40). In this report, we have defined a cis-acting element, 5'-(A/T)GATAA-3', which is found in two copies in each of the frp1⁺, fip1⁺, and fio1⁺ promoters, and is required for iron-dependent repression of fio1⁺. Our studies of fio1⁺ gene regulation suggest that the distal 5'-(A/T)GATAA-3' element (from position 800 to position 795 relative to the first nucleotide of the initiator codon) is the strongest for mediating iron repression. This idea is supported by two experimental results, first, its relative strength for transcriptional iron down-regulation in vivo (Figs. 2 and 3) and, second, its ability to compete for Fep1 binding to the GATA element (Fig. 7). Similarly to the U. maydis sid1 promoter in which the two distal GATA sequences clearly show distinct strength as binding site of Urbs1 (63), Fep1 exhibits a higher affinity for interacting to the upstream 5'-(A/T)GATAA-3' element of the S. pombe fio1⁺ promoter. Which nucleotides within and flanking this fio1⁺ promoter element contribute to the magnitude of the regulatory response must await a comprehensive dissection of the cis-acting element. Furthermore, although the two 5'-(A/T)GATAA-3' elements found in each of the fip1⁺, fio1⁺, and frp1⁺ promoters are arranged as either inverted or direct repeats, it is currently unknown whether the geometry plays a role in the regulation of iron transporter gene expression via these elements.

A key role for S. pombe Fep1 in regulation of reductive iron transport was revealed by the following data. First, fep1 cells exhibited a marked reductase activity at their surface. Second, in the fep1 mutant strain, the fio1⁺-encoded cell surface multi-copper ferroxidase was constitutively highly expressed (~18-fold) with respect to the basal level detected in wild type strain. Third, the disruption strain (fep1) was hypersensitive to phleomycin, suggesting that intracellular iron levels were elevated in these cells since the toxicity to this drug is iron-dependent. Fourth, the DNA binding domain of Fep1, expressed as a fusion protein in E. coli as the sole protein with the ability to recognize GATA-like elements, exhibited specific binding to the 5'-(A/T)GATAA-3' sequence. Furthermore, this specific interaction was only observed when the purified fusion protein was prepared from cells grown in the presence of iron. Taken together, these data suggest that Fep1 plays a critical nuclear signaling function by directly repressing the expression of the reductive iron transport genes under conditions of high iron availability through the 5'-(A/T)GATAA-3' promoter elements.

Consistent with a role for Fep1 as an iron sensor that represses fio1⁺ gene expression in the presence of iron, we have identified two genes, tup11⁺ and tup12⁺, known to encode proteins that function as general transcriptional co-repressors (43) that are required for iron-regulated gene expression. Strains with both tup11 and tup12 deletions are insensitive to changes in iron levels. Indeed, in tup11 tup12 double mutant cells, fio1⁺ expression was derepressed, reaching levels up to 8-fold of those observed in the wild type strain under comparable conditions. Interestingly, the steady-state levels of fio1⁺ mRNA were also increased (to less extended) in the tup12 single mutant strain (~3-fold) but not in the tup11 disruptant strain. Thus, tup12⁺ may encode a nuclear component that limits fio1⁺ expression even under conditions of iron scarcity. The Fep1 protein harbors several leucine-proline dipeptide repeats (from residues 286-427) located in the middle part of the carboxyl-terminal half of the protein. One of them, ⁴¹⁴Leu-Pro-Pro-Ile-Leu-Pro⁴¹⁹, is highly conserved in other repressors, including Srea from A. nidulans (16) and Srep from P. chrysogenum (15). Furthermore, in S. cerevisiae, this dipeptide repeat is also found in the Mig1 and Rox1 sequence-specific DNA binding repressors and has been proposed to play a role in protein-protein interactions with the general co-repressor complex that contains Tup1 and Ssn6 proteins (64). Perhaps this motif in Fep1 is required to recruit the co-repressor complex, which contains Tup11 and Tup12 in fission yeast (43). Recently, Knight et al. (65) demonstrate that iron-mediated regulation of genes involved in reductive iron uptake in Candida albicans requires a co-repressor protein orthologous to S. cerevisiae Tup1, supporting our observation that the S. pombe tup11⁺ and tup12⁺ genes plays a crucial role in down-regulation of iron transport genes.

How does repression occur in response to iron? Interestingly, Fep1 harbors within its second zinc finger region an RXXE motif, which is composed of and flanked by amino acids such as arginine, aspartic acid, and glutamic acid (residues 184-187) able to coordinate iron. This motif lacks only one glutamic acid residue (second position) to be identical to the REXXE motifs identified in the S. cerevisiae Ftr1 and Fth1 proteins and also found and shown to coordinate the binding of iron within mammalian ferritin light chains (24, 66). Iron may directly bind Fep1, making the factor competent to recognize the 5'-(A/T)GATAA-3' element in an iron-dependent manner for inactivating target gene expression. Consistently, within the U. maydis Urbs1 protein, a single substitution of arginine 494, which corresponds to arginine 184 of Fep1, renders the metalloregulatory factor unable to respond to the presence of iron for repressing gene expression (67). Furthermore, this putative iron-regulatory RXXE motif is highly conserved in all five identified fungal GATA factors. Interestingly, the MBP-Fep1 fusion protein purified from E. coli with no added iron or from cells grown in the presence of BPS appears unstable (Fig. 8B). One would expect that iron binding stabilizes the protein from putative cellular proteolysis. Efforts are under way to investigate the functional association of iron with this putative iron regulatory RXXE motif of Fep1.

How does repression take place through Fep1 and the 5'-(A/T)GATAA-3' elements identified in this study relate to the previous report of repression of the fio1⁺ promoter by the Cuf1 copper-sensing transcription factor (40)? At the core of this question, one point is critical to understand. Cuf1 is required for repression of iron uptake genes under low copper conditions (40). The rationale behind this proposed model is that in low copper conditions, the cells repress the copper-dependent iron uptake system, presumably to avoid a futile expenditure of energy in producing a system that lacks the necessary cofactor to function. In this study, the copper conditions were not limiting, therefore eliminating any interference with Fep1 function by Cuf1 in the fio1⁺ promoter.

Although fission yeast lacks the ability to produce siderophore, it is intriguing that the Fep1 iron-sensing transcription factor exhibits many similarities to iron sensors from fungal species that produce siderophores, including U. maydis Urbs1, A. nidulans Srea, P. chrysogenum Srep, and N. crassa Sre (16, 67). Based on the results available, we propose a model predicting that the nutritional transcription factor Fep1 can sense and translate iron concentration changes to the reductive iron transport machinery because of its ability to interact directly in an iron-dependent manner with the 5'-(A/T)GATAA-3' element and a general co-repressor complex that contains the Tup11 and Tup12 proteins (Fig. 10). Further studies will be needed to assess how Fep1 recruits and interacts with Tup11 and Tup12 to dictate the iron-dependent transcriptional response to maintain appropriate intracellular iron levels.

	ACKNOWLEDGEMENTS

We gratefully acknowledge Dr. Kevin Morano for valuable comments on the manuscript. We thank Mélanie Sanschagrin and Rosalie Francoeur for excellent technical assistance.

	FOOTNOTES

^* This study was supported by Natural Sciences and Engineering Research Council of Canada Grant 238238-01 (to S. L.). Infrastructure equipment essential for performing this investigation was obtained through Canada Foundation for Innovation Grant NOF-3754 (to S. L.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Supported by the Fondation de la Recherche sur les Maladies Infantiles du Québec.

A New Investigator Scholar from the Canadian Institutes of Health Research. To whom correspondence should be addressed. Tel.: 819-820-6868 (ext. 15460); Fax: 819-564-5340; E-mail: slabbe@courrier.usherb.ca.

Published, JBC Papers in Press, April 15, 2002, DOI 10.1074/jbc.M202682200

² The fep1⁺ gene corresponds to the GenBank^TM accession number AJ457978.

³ B. Pelletier and S. Labbé, unpublished data.

	ABBREVIATIONS

The abbreviations used are: BPS, bathophenanthrolinedisulfonic acid; Fep1, Fe protein 1; MBP, maltose-binding protein; ORF, open reading frame.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES