JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M202947200 on April 5, 2002

J. Biol. Chem., Vol. 277, Issue 28, 25512-25518, July 12, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/28/25512    most recent
M202947200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ternes, P.
Right arrow Articles by Heinz, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ternes, P.
Right arrow Articles by Heinz, E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification and Characterization of a Sphingolipid Delta 4-Desaturase Family*

Philipp TernesDagger , Stephan Franke§, Ulrich Zähringer, Petra SperlingDagger , and Ernst HeinzDagger ||

From the Dagger  Institut für Allgemeine Botanik, Universität Hamburg, Ohnhorststr. 18, D-22609 Hamburg, Germany, the § Organische Mikroanalytik, Institut für Organische Chemie, Universität Hamburg, Martin-Luther-King-Platz 6, D-20146 Hamburg, Germany, and the  Laborgruppe Immunchemie, Forschungszentrum Borstel, Parkallee 22, D-23845 Borstel, Germany

Received for publication, March 27, 2002, and in revised form, April 4, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Sphingolipids desaturated at the Delta 4-position are important signaling molecules in many eukaryotic organisms, including mammals. In a bioinformatics approach, we now identified a new family of protein sequences from animals, plants, and fungi and characterized these sequences biochemically by expression in Saccharomyces cerevisiae. This resulted in the identification of the enzyme sphingolipid Delta 4-desaturase (dihydroceramide desaturase) from Homo sapiens, Mus musculus, Drosophila melanogaster, and Candida albicans, in addition to a bifunctional sphingolipid Delta 4-desaturase/C-4-hydroxylase from M. musculus. Among the sequences investigated are the Homo sapiens membrane lipid desaturase, the M. musculus degenerative spermatocyte, and the Drosophila melanogaster degenerative spermatocyte proteins. During spermatogenesis, but not oogenesis of des mutant flies, both cell cycle and spermatid differentiation are specifically blocked at the entry into the first meiotic division, leading to male sterility. This mutant phenotype can be restored to wild-type by complementation with a functional copy of the des gene (Endo, K., Akiyama, T., Kobayashi S., and Okada, M. (1996) Mol. Gen. Genet. 253, 157-165). These results suggest that Delta 4-desaturated sphingolipids provide an early signal necessary to trigger the entry into both meiotic and spermatid differentiation pathways during Drosophila spermatogenesis.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In eukaryotic cells, sphingolipids have recently become a focus of interest, because they are emerging as an important class of messenger molecules linked to many different cellular functions (1-6). Their chemical structure differs from the more commonly known glycerolipids in having a long-chain amino alcohol, the sphingoid base (Fig. 1), as a backbone. Sphingolipid biosynthesis starts in the endoplasmic reticulum from serine and a palmitic or stearic acid coenzyme A-thioester, which are condensed and subsequently reduced to form a sphingoid base. The free sphingoid base is then N-acylated to form a ceramide. In a further step, a polar head group is added onto the primary hydroxy group of the ceramide to give a variety of complex sphingolipids such as cerebrosides, sphingomyelin, and phytoglycolipids. A significant proportion of these sphingolipids is finally found in the outer leaflet of the plasma membrane, where they have both structural and signaling functions (1).


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 1.   Structures of some naturally occurring sphingoid bases with the enzymes responsible for their interconversion. a, (E)-sphing-4-enine (D-erythro-sphingosine); b, D-erythro-sphinganine; c, D-4-hydroxysphinganine (D-ribo-phytosphinganine).

In mammalian cells, sphingolipid-derived messengers, in particular ceramide and phosphorylated sphingoid bases, control activities such as cellular proliferation, differentiation, and motion (2), as well as cell cycle arrest and apoptosis (3). Ceramide can be generated either by de novo synthesis as described above or by hydrolysis of complex sphingolipids. Once released, ceramides may be hydrolyzed to free sphingoid base and fatty acid, which themselves give rise to messenger molecules such as phosphorylated sphingoid bases. In addition, free and phosphorylated sphingoid bases can also be generated by de novo synthesis.

Important postsynthetic modifications of sphingolipids are desaturation at the Delta 4-position and hydroxylation at the C-4-position of the sphinganine, so that they contain (E)-sphing-4-enine or D-4-hydroxysphinganine (Fig. 1). In mammals, the (E)-Delta 4-double bond contributes to the second messenger activity of ceramide (7). It is introduced by the enzyme sphingolipid Delta 4-desaturase (8). This enzyme is frequently called dihydroceramide desaturase in mammals, because its activity is highest with dihydroceramide as substrate (9). The C-4-hydroxy group is introduced by the enzyme sphingolipid C-4-hydroxylase, which is encoded by the yeast SUR2 gene and its plant homologues (10-12).

In the course of identifying enzymes involved in sphingolipid biosynthesis (12-14), we were interested in cloning the sphingolipid Delta 4-desaturase. Its biochemical characteristics, for example, the requirement of NAD(P)H and O2 as cofactors (9), are typical for membrane-bound desaturases and hydroxylases. These enzymes belong to a large superfamily defined by three characteristic sequence motifs, the histidine boxes HX3-4H, HX2-3HH, and (H/Q)X2-3HH (15). Members of this superfamily introduce double bonds or hydroxy groups into many different lipid substrates, including fatty acyl groups, sphingoid bases, and sterols (16). We therefore assumed the amino acid sequence of sphingolipid Delta 4-desaturase to be similar to that of other known desaturases or hydroxylases which contain the histidine box sequence motifs.

In a first approach, we expected the sequence of this enzyme to be similar to the Saccharomyces cerevisiae sphingolipid C-4-hydroxylase Sur2p (10, 11), because desaturases and hydroxylases of identical regioselectivity and substrate specificity were believed to be very similar at the amino acid sequence level (16, 17). However, cloning and expression of sequences similar to S. cerevisiae Sur2p resulted in the discovery of sphinganine C-4-hydroxylases from plants (12), but not of the unknown Delta 4-desaturase. This indicated that the sphingolipid Delta 4-desaturase and Sur2p were not as similar as expected.

We now employed a bioinformatics strategy to identify the protein sequence of the sphingolipid Delta 4-desaturase. Using PSI-blast (18), an extensive collection of sequences characterized by the histidine box sequence motifs was assembled and subsequently grouped into families according to sequence similarity. After identifying a new family with candidate sequences from animals, plants, and fungi, which will be called the DES family, several of these sequences were cloned and biochemically characterized by expression in S. cerevisiae. By this strategy, the first sphingolipid Delta 4-desaturases, as well as a bifunctional sphingolipid Delta 4-desaturase/C-4-hydroxylase were identified.

Among the sphingolipid Delta 4-desaturases investigated are the Drosophila melanogaster degenerative spermatocyte (des-1)12 (19), the Mus musculus degenerative spermatocyte (MDES) (20), and the Homo sapiens membrane lipid desaturase (MLD) (21) proteins. A considerable amount of information about these proteins is already present in the literature, generated without knowing their biochemical activity. Their identification as sphingolipid Delta 4-desaturases now allows assignment of unexpected cellular functions to Delta 4-desaturated sphingolipids. We propose that Delta 4-desaturated sphingolipids are involved in cell cycle control during Drosophila spermatogenesis.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bioinformatics

Initial PSI-Blast Searches-- The NCBI non-redundant protein sequence data base (www.ncbi.nlm.nih.gov) was searched using PSI-blast (18) with the S. cerevisiae Sur2p (10, 11) and Arabidopsis thaliana SLD1 (13) protein sequences (GenBankTM protein accessions NP_010583 and T47950) as queries. The search yielded two non-overlapping sets including a total of 397 sequences containing the three histidine box motifs. These sequences were grouped into families by manual inspection of multiple sequence alignments and phylogenetic trees generated with ClustalX (22). Putative biochemical functions were assigned to each family based on experimentally characterized member sequences. The new DES family was identified as described under "Results," and initially consisted of 7 sequences from H. sapiens (DES1, GenBankTM protein accession NP_003667), M. musculus (DES1, NP_031879), D. melanogaster (DES-1, CAA63889), C. elegans (NP_493549 and NP_501256), A. thaliana (AAD17340), and Schizosaccharomyces pombe (T40333).

Identification of Additional DES Homologues-- The TIGR Gene Indices (www.tigr.org/tdb) were searched with tblastn (18) for tentative consensus sequences with high similarity to the DES family at the protein level. Tentative consensus sequences corresponding to the DES family members identified in the PSI-blast searches (H. sapiens DES1, M. musculus DES1, and D. melanogaster DES-1) as well as tentative consensus sequences encoding new family members (DES2 homologue from H. sapiens, M. musculus DES2, and the DES homologue from Lycopersicon esculentum) were found. Corresponding cDNA clones were sequenced and their nucleotide sequences were submitted to the GenBankTM/EBI Data Bank. The sequence of I.M.A.G.E. Consortium cDNA clone 2578328 encoding H. sapiens DES1 has been submitted with accession number AF466375, I.M.A.G.E. Consortium cDNA clone 2123522 encoding M. musculus DES1 with accession number AF466376, I.M.A.G.E. Consortium cDNA clone 920524 encoding M. musculus DES2 with accession number AF466377, NSF Tomato Genome Project cDNA clone cLET2D1 encoding a DES homologue from L. esculentum with accession number AF466378, and BDGP cDNA clone LP11871 encoding D. melanogaster DES-1 with accession number AF466379. I.M.A.G.E. Consortium cDNA clone 2109176 encoding a DES2 homologue from H. sapiens contains an incomplete coding sequence and was not investigated further. I.M.A.G.E. Consortium (LLNL) cDNA Clones (23) were supplied by RZPD Deutsches Ressourcenzentrum für Genomforschung. The Berkeley Drosophila Genome Project cDNA Clone LP11871 (24) was obtained from Research Genetics. The cDNA clone cLET2D1 from the NSF Tomato Genome Project3 was supplied by the Clemson University Genomics Institute.

To find additional DES homologues from fungi, the Candida albicans and Neurospora crassa genomic sequences were searched with tblastn (18) for open reading frames showing high similarity to the DES family at the protein level. One open reading frame consisting of bases 7499-8611 of contig 6-2340 encoding Des1p from C. albicans and one open reading frame consisting of bases 17916-16535 of contig 9a58 encoding a Des1p homologue from N. crassa were identified. Sequence data for C. albicans were obtained from the Stanford Genome Technology Center website at sequence-www.stanford.edu/group/candida. Sequence data for N. crassa were obtained from the Neurospora Genome Project website at mips.gsf.de/proj/neurospora.

Cloning

Complete open reading frames were amplified from the cDNA clones indicated in the previous section (H. sapiens, M. musculus, D. melanogaster, and L. esculentum) or from genomic DNA (C. albicans strain CAI4) by PCR with specific primers using proofreading Pfu Turbo DNA polymerase (Stratagene). The primer sequences were: CGCGGATCCATGGGGAGCCGCGTCTCG and GCTCTAGATTACTCCAGCACCATCTCTC (H. sapiens DES1), CGCGGATCCATGGGTAGCCGCGTGTCC and GCTCTAGATTACTCCAGAATCTCGTTCC (M. musculus Des1), CGCGGATCCATGGGTAATAGCGCGGCCC and GCTCTAGATCAC- AGGTGGTCCTTCGCC (M. musculus Des2), CGCGGATCCATGGGACAGAAAGTTTCGCG and GCTCTAGATTAGGAGGCCAGGCCGCG (D. melanogaster des-1), CGCGGATCCATGGGATTTGAAGGG- GAAAA and GCTCTAGACTATTCGGACTTGTTTGCTT (DES homologue from L. esculentum), CGCGGATCCATGGACGCTGAAATCAAGCA and GCTCTAGATTAGTTCTCGTCTAACCTATTA (C. albicans DES1). The primers included adapter sequences containing the restriction sites KpnI (forward primer) or XbaI (reverse primer) (underlined). The PCR products were cloned into the KpnI and XbaI sites of the yeast expression vector pYES2 (Invitrogen). The resulting plasmids were used to transform the S. cerevisiae strain sur2Delta (MATalpha lys2 ura3-52 trp1Delta leu2Delta sur2::TRP1) (10). The plasmids carrying the open reading frames from C. albicans and L. esculentum were checked by sequencing. The insert sequence encoding the DES homologue from L. esculentum was identical to the cDNA sequence. The insert sequence encoding C. albicans Des1p differed in a single nucleotide (G or C at position 585) from the sequence determined by the Stanford Genome Technology Center, but this had no effect on the predicted protein sequence. C. albicans strain SC5314 was sequenced at the Stanford Genome Technology Center, whereas strain CAI4 was used in this study.

Yeast Cultures

Precultures of transformed sur2Delta cells were grown aerobically at 30 °C in complete minimal uracil dropout medium (25) containing 2% (w/v) glucose. To induce expression under control of the GAL1 promotor, cells were washed and transferred to complete minimal uracil dropout medium (25) containing 2% (w/v) raffinose and 2% (w/v) galactose as carbon sources. Cultures were grown aerobically at 25 °C for 70 h (final A600 = 2.5-3), subjected to heat shock at 37 °C for 90 min, and harvested by centrifugation. The heat shock treatment was performed to increase ceramide levels as observed in several studies (4, 5).

Sphingoid Base Analysis

HPLC Analysis-- Analysis of the sphingoid base composition was performed as described in Ref. 13 with optimizations. Yeast cells (370-520 mg fresh weight) were harvested by centrifugation, washed with H2O, and hydrolyzed directly with approx 10% (w/v) Ba(OH)2 in 3 ml of 1,4-dioxane/H2O 1:1 (v/v) (20 h at 110 °C) (26). The free sphingoid bases were extracted by phase partitioning with CHCl3/1,4-dioxane/H2O, 8:3:8 (v/v/v). The organic phase was washed with an equal volume of 0.1 M KOH + 0.5 M KCl. The sphingoid bases were converted to their DNP derivatives with 0.2 ml of 0.5% (v/v) methanolic 1-fluoro-2,4-dinitrobenzene and 0.8 ml of 2 M boric acid/KOH, pH 10.5 (30 min at 60 °C) (27), extracted by phase partitioning with CHCl3/methanol/H2O, 2:1:1 (v/v/v), and purified by TLC on Silica Gel 60 plates in CHCl3/methanol, 9:1 (v/v). The DNP-derivatized sphingoid bases were detected by their color (yellow under visible light and dark blue under UV illumination), extracted with CHCl3/methanol, 2:1 (v/v), followed by phase partitioning with CHCl3/methanol/0.1 M KOH, 2:1:1 (v/v/v), and dissolved in 0.5 ml of methanol. Analysis by reverse-phase HPLC was performed on a Multospher RP18-5 250 × 4-mm column (CS-Chromatographie) with a flow rate of 0.8 ml/min and a concave gradient from 84 to 100% methanol/acetonitrile/2-propanol, 10:3:1 (v/v/v), against H2O in 55 min. The elution was monitored with a UV detector (ThermoQuest) at 350 nm.

MS and NMR Analysis-- Reverse-phase HPLC/MS with electrospray ionization (ESI) and ESI/MS/MS with direct infusion were performed with DNP-derivatized sphingoid bases on a MAT 95XL-Trap instrument (ThermoQuest) in negative ion mode. DNP-derivatized sphinganine, (E)-sphing-4-enine, and D-4-hydroxysphinganine (Sigma) were used as reference substances.

For NMR analysis, S. cerevisiae sur2Delta cells (12 g fresh weight) expressing C. albicans Des1p were hydrolyzed in a total reaction volume of 120 ml (24 h under reflux) as described above. The free saturated and desaturated sphingoid bases were separated by TLC on Silica Gel 60 plates in CHCl3/methanol/25% NH4OH, 40:20:3 (v/v/v), detected with ANS under UV illumination, and extracted separately with methanol/25% NH4OH/10:1 (v/v). The sphingoid bases were dissolved in dried pyridine, peracetylated with acetic anhydride and N,N-dimethyl-4-aminopyridine (overnight at 25 °C) (28), and purified by TLC on Silica Gel 60 plates in CHCl3/methanol, 20:1 (v/v). The peracetylated sphingoid bases were detected with ANS under UV illumination, extracted with CHCl3/methanol, 2:1 (v/v), followed by phase partitioning with CHCl3/methanol/0.1 M KOH, 2:1:1 (v/v/v), and dissolved in 0.5 ml of CDCl3 (Cambridge Isotope Laboratories).

One-dimensional 1H and two-dimensional homonuclear correlation (1H,1H-COSY) spectra were recorded on a 600 MHz AVANCE DRX-600 spectrometer (Bruker) at 300 K with internal CDCl3 (delta H = 7.24) as reference using XWINMR software (Bruker). Peracetylated (E)-sphing-4-enine (Sigma) was used as reference substance.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Identification of a Putative Sphingolipid Delta 4-Desaturase Family with Members from Animals, Plants, and Fungi-- We employed a bioinformatics strategy to identify candidate sequences for sphingolipid Delta 4-desaturases. Using PSI-blast (18) with the S. cerevisiae sphingolipid C-4-hydroxylase Sur2p (10, 11) and the A. thaliana sphingolipid Delta 8-desaturase SLD1 (13) protein sequences as queries, we assembled an extensive collection of sequences showing the histidine box sequence motifs characteristic for membrane-bound desaturases and hydroxylases. The final collection of 397 sequences from various organisms was grouped into families as described under "Experimental Procedures," and each family was assigned a putative biochemical function based on experimentally characterized member sequences (Fig. 2). A candidate family for sphingolipid Delta 4-desaturases was identified based on the following criteria. 1) The family should consist exclusively of sequences with so far unknown biochemical function. 2) It should contain sequences from animals, plants, and fungi, because Delta 4-desaturated sphingolipids have been found in all these organisms. 3) The family should not contain sequences from S. cerevisiae, because this is one of the few eukaryotic organisms lacking Delta 4-desaturated sphingolipids.


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 2.   Dendrogram showing similarities between selected membrane-bound desaturases and hydroxylases. Red, sphingolipid Delta 4-desaturases (DES family, sequences 1-3 in bold); blue, fatty acid desaturases and sphingolipid Delta 8-desaturase (sequence 9); green, sphingolipid C-4-hydroxylases; brown, sterol desaturases and hydroxylases. *N, N-terminal cytochrome b5 fusion protein; *C, C-terminal cytochrome b5 fusion protein; ER, endoplasmic reticulum. The pink and light blue background indicates groups of desaturase and hydroxylase sequences distinguished by a different spacing between the first and second histidine box. The small pictures illustrate the distance between these histidine boxes, which is longer (25-34 amino acids) in the sequences with pink background, and shorter (7-18 amino acids) in the sequences with light blue background. The red box represents the insertion/deletion responsible for the different spacing, the histidine boxes are indicated by numbers (not drawn to scale). The dendrogram has been constructed from pair wise similarities of full-length amino acid sequences using T-Coffee (46). GenBankTM protein or nucleotide (*) accession numbers are: 1) AF466377*; 2) AF466379*; 3) AAD17340; 4) CAA18198; 5) P20388; 6) P48623; 7) P48622; 8) P46313; 9) T47950; 10) AAD01410; 11) AAF70457; 12) AAD31282; 13) Ref. 32; 14) P21395; 15) AAB62299; 16) CAB51047; 17) AAA34826; 18) NP_033154; 19) BAA25181; 20) NP_013999; 21) T01359; 22) CAB56060; 23) O88822; 24) NP_013157; 25) AAD38120; 26) NP_003947; 27) NP_011574; 28) AAF43928; 29) NP_010583; 30) AAC24374.

One family with sequences from H. sapiens, M. musculus, Rattus norvegicus, D. melanogaster, Caenorhabditis elegans (animals), A. thaliana, Lycopersicon esculentum (plants), S. pombe, C. albicans, N. crassa (fungi), and Toxoplasma gondii conformed to all three criteria (Fig. 2, red branch, and Fig. 3). Three of these sequences, DES-1 from D. melanogaster, MDES from M. musculus, and MLD from H. sapiens, have previously been studied without knowing their biochemical function (19-21). To unify nomenclature, we will call this new family the DES family and refer to mouse MDES and human MLD both as DES1, to the second mouse homologue as DES2, and to the DES homologue from C. albicans as Des1p.4 There is also a DES2 homologue in H. sapiens, but because we could not obtain its full-length sequence, we did not characterize it further.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 3.   Cladogram of protein sequences of different members of the DES family. Red, animal sequences; green, plant sequences; brown, fungal sequences; blue, sequence from T. gondii. Sequences that have been biochemically characterized as sphingolipid Delta 4-desaturases in this study are marked with asterisks. M. musculus DES2 is a bifunctional sphingolipid Delta 4-desaturase/C-4-hydroxylase. A human DES2 homologue (TIGR Gene Indices accession number THC520511) is not included in the figure because no full-length amino acid sequence was available. The parsimony tree was constructed with Phylip (J. Felsenstein, included in the EMBOSS package at www.hgmp.mrc.ac.uk/Software/EMBOSS) from a multiple alignment of full-length amino acid sequences generated with T-Coffee (46). One of the human Delta 6-fatty acid desaturase sequences was used as an outgroup. GenBankTM protein or nucleotide (*) accession numbers are: 1) AF466376*; 2) NP_445775; 3) AF466375*; 4) AF466377*; 5) AF466379*; 6) NP_493549; 7) NP_501256; 8) AF466378*; 9) AAD17340; 10) C. albicans genomic sequence, bases 7499-8611 of contig 6-2340; 11) N. crassa genomic sequence, bases 17916-16535 of contig 9a58; 12) T40333; 13) BAB58879; 14) AAD31282.

The DES Homologues from Animals and Fungi Show Sphingolipid Delta 4-Desaturase Activity-- To investigate if the sequences in the DES family in fact encode sphingolipid Delta 4-desaturases, the complete open reading frames coding for H. sapiens DES1, M. musculus DES1 and DES2, D. melanogaster DES-1, the DES homologue from L. esculentum, and C. albicans Des1p were cloned into the yeast expression vector pYES2 under the control of the inducible GAL1 promotor. The resulting plasmids were used to transform the S. cerevisiae sur2Delta mutant (10). In this mutant, the sphingolipid C-4-hydroxylase gene SUR2 (10, 11) is disrupted, so that sphinganine is the only sphingoid base found in the sphingolipids. It was expected that these sphinganine-containing sphingolipids would be suitable as substrates for Delta 4-desaturation. Expression of H. sapiens DES1, M. musculus DES1 and DES2, D. melanogaster DES-1, and C. albicans Des1p indeed resulted in the formation of sphingolipids containing the Delta 4-desaturated sphingoid base (E)-sphing-4-enine (H. sapiens DES1, 2.1 mol %; M. musculus DES1, 0.2 mol %; M. musculus DES2, 0.7 mol %; D. melanogaster DES-1, 5.4 mol %; C. albicans Des1p, 6.3 mol %) (Fig. 4). In sur2Delta cells expressing the DES homologue from L. esculentum and in cells transformed with the empty vector pYES2 (control), no (E)-sphing-4-enine could be detected. In summary, H. sapiens DES1, M. musculus DES1 and DES2, D. melanogaster DES-1, and C. albicans Des1p show sphingolipid Delta 4-desaturase activity, whereas no such activity could be detected with the DES homologue from L. esculentum under these experimental conditions.

The identity of the sphingoid bases indicated in Fig. 4 was confirmed by HPLC/MS. In the negative ion mode, pseudomolecular ions with (m/z = Mr - 1) corresponding to the DNP derivatives of the sphingoid bases were detected at the expected retention times, with m/z = 466 for sphinganine, m/z = 464 for (E)-sphing-4-enine, and m/z = 482 for 4-hydroxysphinganine. In addition, expression of C. albicans Des1p in S. cerevisiae sur2Delta allowed the isolation of (E)-sphing-4-enine in quantities sufficient for NMR analysis. The 1H NMR spectra of peracetylated (E)-sphing-4-enine isolated from transgenic yeast were indistinguishable from spectra obtained with peracetylated (E)-sphing-4-enine reference substance (data not shown) and were consistent with data from the literature (29). Diagnostic inter alia resonances of the Delta 4-double bond gave rise to signals at 5.372 ppm (H-4) and 5.772 ppm (H-5) expressing a coupling constant of J4,5 = 15.2 Hz characteristic for an (E)-configuration. These data show that the members of the DES family indeed catalyze the formation of (E)-sphing-4-enine.


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 4.   Formation of (E)-sphing-4-enine and 4-hydroxysphinganine in the S. cerevisiae sur2Delta mutant expressing D. melanogaster DES-1 and M. musculus DES2. a, sur2Delta cells expressing D. melanogaster DES-1 form (E)-sphing-4-enine (d18:1) and, in addition, C20-(E)-sphing-4-enine (d20:1). b, sur2Delta cells expressing the empty vector pYES2 do not form (E)-sphing-4-enine (control). c, (enlarged) sur2Delta cells expressing M. musculus DES2 form both (E)-sphing-4-enine (d18:1) and 4-hydroxysphinganine (t18:0) (top). Cells expressing the empty vector pYES2 form neither (E)-sphing-4-enine nor 4-hydroxysphinganine (control, bottom). d16:0, C16-sphinganine; d18:0, sphinganine; d20:0, C20-sphinganine; d18:1, (E)-sphing-4-enine; d20:1, C20-(E)- sphing-4-enine; t18:0, 4-hydroxysphinganine. Absorbance at 350 nm is given in units relative to the largest peak.

M. musculus DES2 Is a Bifunctional Sphingolipid Delta 4-Desaturase/C-4-Hydroxylase-- Expression of M. musculus DES2 in S. cerevisiae sur2Delta unexpectedly resulted in the formation of both (E)-sphing-4-enine (0.7 mol %) and 4-hydroxysphinganine (0.3 mol %) (Fig. 4c). The (E)-sphing-4-enine/4-hydroxysphinganine ratio was 2.5:1. In HPLC/MS analysis, the putative 4-hydroxysphinganine gave rise to a pseudomolecular ion with m/z = 482, being consistent with its designation as 4-hydroxysphinganine. The ESI/MS/MS fragmentation spectrum of this ion is indistinguishable from that of the DNP-derivatized D-4-hydroxysphinganine reference substance, whereas it is clearly different from the secondary ion spectra of sphinganine and (E)-sphing-4-enine (data not shown). These data confirm that expression of M. musculus DES2 in transgenic yeast resulted in the formation of 4-hydroxysphinganine in addition to (E)-sphing-4-enine. We did not determine the stereochemistry of the 4-hydroxysphinganine formed in this reaction, but we assume the C-4-hydroxy group to be of the D-configuration, as this is the configuration found in all naturally occurring trihydroxylated sphingoid bases investigated to date (12). Because the reaction mechanisms of desaturation and hydroxylation are very similar (16), we conclude that M. musculus DES2 is a bifunctional sphingolipid Delta 4-desaturase/C-4-hydroxylase. Expression of H. sapiens DES1, D. melanogaster DES, and C. albicans Des1p also resulted in the formation of small amounts (0.03-0.09 mol %) of 4-hydroxysphinganine in addition to (E)-sphing-4-enine, with a (E)-sphing-4-enine/4-hydroxysphinganine ratio of 60-70:1. This indicates that a bifunctional Delta 4-desaturase/C-4-hydroxylase activity might be a general feature of sphingolipid Delta 4-desaturases.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Evolution of Sphingolipid Desaturases and Hydroxylases-- Until now, the yeast sphingolipid C-4-hydroxylase Sur2p (10, 11) and its plant homologues (12) were the only enzymes known to be capable of synthesizing C-4-hydroxylated sphingolipids. In particular, no mammalian Sur2p homologue could be found in the public sequence data bases, although some mammalian tissues, in particular kidney and the intestine, contain considerable amounts of D-4-hydroxysphinganine (1), and a mammalian sphinganine C-4-hydroxylase activity has been demonstrated biochemically (30). It was unclear how C-4-hydroxylated sphingolipids were biosynthesized in mammals. In this study, we have identified the M. musculus DES2 protein, which is a bifunctional sphingolipid Delta 4-desaturase/C-4-hydroxylase. This indicates that sphinganine C-4-hydroxylation is mediated by Sur2p in yeast and by Sur2p homologues in plants, but by DES2 in mammals.

The superfamily of membrane-bound desaturases and hydroxylases can be divided into two major groups, which are distinguished by a different spacing between the first and the second histidine box (Fig. 2). This difference likely represents an insertion/deletion event very early in the evolution of this superfamily. From this, it can be concluded that yeast Sur2p and its plant homologues (10-12) with a short spacing (Fig. 2, green branch) and mammalian DES2 with a long spacing between the first and second histidine box (DES family, in Fig. 2, red branch) have evolved their sphingolipid C-4-hydroxylase activity independently of each other.

Sphingolipid Delta 4-desaturase activity has evolved independently of sphingolipid Delta 8-desaturase activity. The plant sphingolipid Delta 8-desaturase SLD1 (13) is very similar to the plant and animal fatty acid Delta 5- and Delta 6-desaturases, all of which are cytochrome b5 fusion proteins (Fig. 2, sequences 9-12) (17, 31). In contrast, the sphingolipid Delta 4-desaturases share only limited similarity with any other proteins characterized by the histidine box motifs, and they do not contain a cytochrome b5 domain (DES family, Fig. 2, red branch).

It has been believed that regioselectivity placed a higher constraint on the evolution of membrane-bound desaturases and hydroxylases than substrate specificity or desaturase versus hydroxylase activity (16, 17), i.e. that enzymes with identical or similar regioselectivity are also similar in their amino acid sequence. The fatty acid Delta 4-desaturase, which has recently been cloned from Thraustochytrium sp. (32), is closely related to the fatty acid Delta 5/Delta 6-desaturases, and like them, is a cytochrome b5 fusion protein (Fig. 2, sequence 13). Although it cannot be completely excluded on phylogenic reasons that their most recent common ancestor had a Delta 4-regioselectivity, the fatty acid Delta 4-desaturase and the sphingolipid Delta 4-desaturases (DES family, Fig. 2, red branch) most likely have evolved their Delta 4-regioselectivities independently of each other. Delta 4/C-4-Regioselectivity has thus evolved independently three times: in the fatty acid Delta 4-desaturase (32), in the sphingolipid Delta 4-desaturases (DES family), and in the sphingolipid C-4-hydroxylase Sur2p (10-12). Convergent evolution must therefore be taken into account when viewing the whole superfamily of membrane-bound desaturases and hydroxylases.

Bifunctional Desaturase/Hydroxylase Activity-- Certain families of membrane-bound desaturases and hydroxylases seem to be predisposed to evolving a bifunctional desaturase/hydroxylase activity. These are, in particular, the sphingolipid Delta 4-desaturase (DES) and the fatty acid Delta 12-desaturase families. In the DES family, M. musculus DES2 is a bifunctional desaturase/hydroxylase. In the fatty acid Delta 12-desaturase family, all variations from a hydroxylase in Ricinus communis (33) via a bifunctional desaturase/hydroxylase in Lesquerella fendleri (34) to a desaturase in A. thaliana (35) exist. In both families, even the "pure" desaturases seem to have a minor hydroxylase activity (Ref. 36 and this study). The ease with which a fatty acid Delta 12-desaturase can be converted into a C-12-hydroxylase and vice versa by exchanging just a few amino acids shows how similar the active sites of desaturases and hydroxylases must be (36, 37).

Two amino acid residues have been identified in the A. thaliana fatty acid Delta 12-desaturase that, when exchanged with different amino acids, are sufficient to convert the desaturase into a bifunctional desaturase/hydroxylase (36). However, inspection of amino acid alignments indicates that neither of the equivalent residues in the DES family is likely to be important in determining the desaturation/hydroxylation ratio. Instead, when comparing the amino acid sequences of M. musculus DES1 (a desaturase) and DES2 (a bifunctional desaturase/hydroxylase), three single amino acid differences in the vicinity of the histidine box motifs (Ser or Ala at position 121, Ile or Thr at position 122, and Asn or Met at position 260) are striking. This indicates that rather than particular amino acid side chains, the overall architecture of the active site might determine the desaturation/hydroxylation ratio. A high resolution structural analysis of a membrane-bound desaturase would be needed to address this issue in more detail.

Cellular Functions of Sphingolipids-- Based on detailed cytological and molecular studies carried out with members of the DES family from three different organisms (19-21), it is now possible to get a first insight into the diverse cellular functions of sphingolipid Delta 4-desaturases. The human member of the DES family, DES1 (MLD), has been isolated in a yeast two-hybrid screen (21). The DES1 protein interacts physically with the epidermal growth factor (EGF) receptor. Overexpression of DES1 in 293 EBNA cells reduces expression of the EGF receptor by a post-transcriptional mechanism. EGF receptor signaling involves (E)-sphing-4-enine-1-phosphate as messenger, which itself is perceived by the EDG receptor family (2). It has recently been shown that the EGF receptor is translocated to the nucleus upon ligand binding, where the EGF receptor-ligand complex functions as transcription factor (38). Internalization of the EGF receptor is mediated by a Cbl-CIN85-endophilin complex and probably proceeds via clathrin-coated pits (39). The second well studied case is D. melanogaster, in which the des gene is inactivated in a mutant defective in spermatogenesis (19). In this mutant, the cell cycle of primary spermatocytes is blocked at the G2/M transition of meiosis I just before chromosome condensation is initiated. The mutant phenotype can be reverted to wild-type by complementation with a functional copy of the des gene (19). Finally, the expression pattern of the Des1 (Mdes) transcript from M. musculus has been studied in mouse testis and was found to be very similar to that of des-1 from D. melanogaster (20).

The phenotype of the D. melanogaster des mutant is very similar to that of four other Drosophila mutants, always early (aly), cannonball (can), meiosis I arrest (mia), and spermatocyte arrest (sa), except that in these mutants the chromosomes become partially condensed before the cell cycle is similarly arrested at the G2/M transition (40). These four mutants, as well as the des mutant fail to initiate spermatid differentiation, whereas mutants in the core cell cycle machinery such as cdc2 and twine show a cell cycle arrest at the G2/M transition, but still undergo spermatid differentiation (40). It is therefore argued that meiosis and spermatid differentiation are controlled separately, and that ALY, CAN, MIA, and SA are linked to a checkpoint triggering the simultaneous initiation of both processes (40). Because the des phenotype is very similar to that of the aly, can, mia, and sa mutants, but the cell cycle arrests before even a partial chromosome condensation can be observed, DES-1 is likely linked to the G2/M checkpoint more directly than ALY, CAN, MIA, or SA. In this context, it might well be that Delta 4-desaturated sphingolipids provide a key signal to trigger passage past this G2/M checkpoint.

It is important to note that in contrast to males, female des mutant flies are fertile, which means that meiosis is blocked only in spermatid, but not in egg cell formation. In contrast, the des phenotype is combined with semilethality (20-50% lethality) during embryonic stages in both males and females. The additional defects causing this semilethality have not been investigated in detail, but because sphingolipids are required for many different functions (structural functions as well as signaling), pleiotropic effects may be anticipated. In mice, a knock-out of the DNA mismatch repair gene Pms2 similarly leads to sterility in males, but not in females (41). In Pms2-/- mice, however, formation of the synaptonemal complex is disturbed, which becomes apparent at a later time point than the cell cycle arrest in the des mutant. In addition to male sterility, Pms2-/- mice are predisposed to certain types of cancer because of genomic instability (41, 42).

In humans, male infertility is often connected with a phenotype very similar to that of the D. melanogaster aly, can, mia, sa, and des mutants, with a cell cycle arrest at the G2/M transition and partially condensed chromosomes (40). If also in humans, Delta 4-desaturated sphingolipids can be shown to play a role in progression past the G2/M checkpoint, this will help in elucidating the molecular basis of one type of human male sterility.

C. elegans has two DES homologues (sequences 6 and 7 in Fig. 3, not functionally characterized in this study). Interestingly, in a combined analysis of 552 microarray experiments performed under diverse conditions (43), one of the DES homologues (GenBankTM accession NP_493549) was found to be coexpressed with typical lipid metabolism genes, whereas the other (NP_501256) was assigned to a functionally diverse group of genes highly expressed in the germline. This indicates that the function of D. melanogaster DES-1 in gamete formation may indeed be conserved among entirely different phyla.

Investigating DES functions in other organisms and other genetic backgrounds will provide important insights. The G2/M transition has been studied in detail with microarray experiments during meiosis (sporulation) of S. cerevisiae (44). Expression of the so-called mid-sporulation genes starting at the G2/M transition is regulated by the transcription factor Ndt80p, which controls both meiotic division and subsequent cellular differentiation (spore formation) (45). It will be interesting to see if there are similarities between the control of the G2/M transition in S. cerevisiae and D. melanogaster, because in yeast, no differentiation between male and female is possible and Delta 4-desaturated sphingolipids do not occur.

Higher plants, unlike mammals, D. melanogaster, and C. elegans, are diplohaplont organisms, in which a short haploid stage separates meiosis and mitotic gamete formation. In the plant kingdom, only certain algae, like diatoms and the brown alga Fucus, are diplonts which, except their gametes, have only diploid life stages. It is therefore of particular interest to see whether plant DES homologues have similar functions as D. melanogaster DES-1, and if their activity is required in the sporophyte (meiosis) or gametophyte (gamete formation).

As described in the beginning, (E)-sphing-4-enine derivatives do not only interfere with cell cycle control, but also with many biochemical activities not linked to cell division. A recently discovered example from plants is the control of stomatal opening, which involves (E)-sphing-4-enine-1-phosphate in the signaling cascade (6). By showing that Delta 4-desaturated sphingolipids are involved in cell cycle control during Drosophila spermatogenesis, the discovery of the DES family has unexpectedly added another item to the list of cellular activities involving (E)-sphing-4-enine derivatives. The field of research on Delta 4-desaturated sphingolipids is now open to the use of molecular and genetic tools. This will contribute to an understanding of the increasing diversity of sphingolipid signaling.

    ACKNOWLEDGEMENTS

We thank N. Kruse, P. Lange, D. Novak, and C. Ott for technical assistance, D. Warnecke for valuable discussions, T. Dunn for the kind supply of the S. cerevisiae mutant sur2Delta , the Lawrence Livermore National Laboratory, the Berkeley Drosophila Genome Project, and the Clemson University Genomics Institute for cDNA clones, and the Stanford Genome Technology Center and the Neurospora Genome Project for genomic sequence data.

    FOOTNOTES

* This work was supported by Deutsche Forschungsgemeinschaft Grant He 695/15-1. Sequencing of C. albicans was accomplished with the support of the NIDR National Institutes of Health and the Burroughs Wellcome Fund.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF466375 (H. sapiens DES1), AF466376 (M. musculus DES1), AF466377 (M. musculus DES2), AF466378 (DES homologue L. esculentum), and AF466379 (D. melanogaster DES-1).

|| To whom correspondence should be addressed. Tel.: 49-40-42816-369; Fax: 49-40-42816-254; E-mail: eheinz@botanik.uni-hamburg.de.

Published, JBC Papers in Press, April 5, 2002, DOI 10.1074/jbc.M202947200

1 Typographic rules for genes and their products differ among the species mentioned in this study. Particularly in Drosophila, genes named after a recessive mutant phenotype, as well as the mutant itself, are typeset in lowercase italics. Any item in italics should therefore be considered a gene, messenger RNA, or complementary DNA, except when it is evident from the context that it refers to a mutant. Any item in Roman characters should be considered a protein.

4 Yeast nomenclature requires gene and protein names consisting of tree letters followed by a number. The number in C. albicans Des1p does not imply that it is a mouse or human DES1 homologue. C. albicans Des1p is equally related to both DES1 and DES2, as evident from Fig. 3.

3 S. Tanksley, G. Martin, J. Giovannoni, and C. Ronning, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: des-1, Drosophila melanogaster degenerative spermatocyte; ANS, 8-anilino-1-naphthalenesulfonic acid; MDES, M. musculus degenerative spermatocyte; MLD, H. sapiens membrane lipid desaturase; DNP, 2,4-dinitrophenyl; HPLC, high performance liquid chromatography; A600, optical density at 600 nm; EGF, epidermal growth factor; contig, group of overlapping clones.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Holthuis, J. C. M., Pomorski, T., Raggers, R. J., Sprong, H., and van Meer, G. (2001) Physiol. Rev. 81, 1689-1723[Abstract/Free Full Text]
2. Pyne, S., and Pyne, N. J. (2000) Biochem. J. 349, 385-402[CrossRef][Medline] [Order article via Infotrieve]
3. Mathias, S., Peña, L. A., and Kolesnick, R. N. (1998) Biochem. J. 335, 465-480
4. Jenkins, G. M., Richards, A., Wahl, T., Mao, C., Obeid, L., and Hannun, Y. (1997) J. Biol. Chem. 272, 32566-32572[Abstract/Free Full Text]
5. Dickson, R. C., Nagiec, E. E., Skrzypek, M., Tillman, P., Wells, G. B., and Lester, R. L. (1997) J. Biol. Chem. 272, 30196-30200[Abstract/Free Full Text]
6. Ng, C. K.-Y., Carr, K., McAinsh, M. R., Powell, B., and Hetherington, A. M. (2001) Nature 410, 596-599[CrossRef][Medline] [Order article via Infotrieve]
7. Bielawska, A., Crane, H. M., Liotta, D., Obeid, L. M., and Hannun, Y. A. (1993) J. Biol. Chem. 268, 26226-26232[Abstract/Free Full Text]
8. Stoffel, W., Assmann, G., and Bister, K. (1971) Hoppe-Seyler's Z. Physiol. Chem. 352, 1531-1544[Medline] [Order article via Infotrieve]
9. Michel, C., van Echten-Deckert, G., Rother, J., Sandhoff, K., Wang, E., and Merrill, A. H., Jr. (1997) J. Biol. Chem. 272, 22432-22437[Abstract/Free Full Text]
10. Haak, D., Gable, K., Beeler, T., and Dunn, T. (1997) J. Biol. Chem. 272, 29704-29710[Abstract/Free Full Text]
11. Grilley, M. M., Stock, S. D., Dickson, R. C., Lester, R. L., and Takemoto, J. Y. (1998) J. Biol. Chem. 273, 11062-11068[Abstract/Free Full Text]
12. Sperling, P., Ternes, P., Moll, H., Franke, S., Zähringer, U., and Heinz, E. (2001) FEBS Lett. 494, 90-94[CrossRef][Medline] [Order article via Infotrieve]
13. Sperling, P., Zähringer, U., and Heinz, E. (1998) J. Biol. Chem. 273, 28590-28596[Abstract/Free Full Text]
14. Leipelt, M., Warnecke, D., Zähringer, U., Ott, C., Müller, F., Hube, B., and Heinz, E. (2001) J. Biol. Chem. 276, 33621-33629[Abstract/Free Full Text]
15. Shanklin, J., Whittle, E., and Fox, B. G. (1994) Biochemistry 33, 12787-12794[CrossRef][Medline] [Order article via Infotrieve]
16. Shanklin, J., and Cahoon, E. B. (1998) Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 611-641[CrossRef][Medline] [Order article via Infotrieve]
17. Sperling, P., and Heinz, E. (2001) Eur. J. Lipid Sci. Technol. 103, 158-180[CrossRef]
18. Altschul, S. F., Madden, T. L., Schäffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389-3402[Abstract/Free Full Text]
19. Endo, K., Akiyama, T., Kobayashi, S., and Okada, M. (1996) Mol. Gen. Genet. 253, 157-165[CrossRef][Medline] [Order article via Infotrieve]
20. Endo, K., Matsuda, Y., and Kobayashi, S. (1997) Dev. Growth Differ. 39, 399-403[Medline] [Order article via Infotrieve]
21. Cadena, D. L., Kurten, R. C., and Gill, G. N. (1997) Biochemistry 36, 6960-6967[CrossRef][Medline] [Order article via Infotrieve]
22. Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F., and Higgins, D. G. (1997) Nucleic Acids Res. 25, 4876-4882[Abstract/Free Full Text]
23. Lennon, G., Auffray, C., Polymeropoulos, M., and Soares, M. B. (1996) Genomics 33, 151-152[CrossRef][Medline] [Order article via Infotrieve]
24. Rubin, G. M., Hong, L., Brokstein, P., Evans-Holm, M., Frise, E., Stapleton, M., and Harvey, D. A. (2000) Science 287, 2222-2224[Abstract/Free Full Text]
25. Treco, D. A., and Lundblad, V. (1993) in Current Protocols in Molecular Biology (Asubel, F. M. , Brent, R. , Kingston, R. E. , Moore, D. D. , Seidman, J. G. , Smith, J. A. , Struhl, K. , Albright, L. M. , Coen, D. M. , and Varki, A., eds) , John Wiley & Sons, New York
26. Morrison, W. R., and Hay, J. D. (1970) Biochim. Biophys. Acta 202, 460-467[Medline] [Order article via Infotrieve]
27. Karlsson, K.-A. (1970) Chem. Phys. Lipids 5, 6-43[CrossRef][Medline] [Order article via Infotrieve]
28. Gupta, C. M., Radhakrishnan, R., and Khorana, H. G. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 4315-4319[Abstract/Free Full Text]
29. Kisic, A., Tsuda, M., Kulmacz, R. J., Wilson, W. K., and Schroepfer, G. J., Jr. (1995) J. Lipid Res. 36, 787-803[Abstract]
30. Crossman, M. W., and Hirschberg, C. B. (1984) Biochim. Biophys. Acta 795, 411-416[Medline] [Order article via Infotrieve]
31. Napier, J. A., Sayanova, O., Sperling, P., and Heinz, E. (1999) Trends Plant Sci. 4, 2-4[CrossRef]
32. Qiu, X., Hong, H., and MacKenzie, S. L. (2001) J. Biol. Chem. 276, 31561-31566[Abstract/Free Full Text]
33. van de Loo, F. J., Broun, P., Turner, S., and Somerville, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 6743-6747[Abstract/Free Full Text]
34. Broun, P., Boddupalli, S., and Somerville, C. (1998) Plant J. 13, 201-210[CrossRef][Medline] [Order article via Infotrieve]
35. Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., and Browse, J. (1994) Plant Cell 6, 147-158[Abstract]
36. Broadwater, J. A., Whittle, E., and Shanklin, J. (2002) J. Biol. Chem. 277, 15613-15620[Abstract/Free Full Text]
37. Broun, P., Shanklin, J., Whittle, E., and Somerville, C. (1998) Science 282, 1315-1317[Abstract/Free Full Text]
38. Lin, S.-Y., Makino, K., Xia, W., Matin, A., Wen, Y., Kwong, K. Y., Bourguignon, L., and Hung, M.-C. (2001) Nat. Cell Biol. 3, 802-808[CrossRef][Medline] [Order article via Infotrieve]
39. Soubeyran, P., Kowanetz, K., Szymkiewicz, I., Langdom, W. Y., and Dikic, I. (2002) Nature 416, 183-187[CrossRef][Medline] [Order article via Infotrieve]
40. Lin, T.-Y., Viswanathan, S., Wood, C., Wilson, P. G., Wolf, N., and Fuller, M. T. (1996) Development 122, 1331-1341[Abstract]
41. Baker, S. M., Bronner, C. E., Zhang, L., Plug, A. W., Robatzek, M., Warren, G., Elliott, E. A., Yu, J., Ashley, T., Arnheim, N., Flavell, R. A., and Liskay, R. M. (1995) Cell 82, 309-319[CrossRef][Medline] [Order article via Infotrieve]
42. Gurtu, V. E., Verma, S., Grossmann, A. H., Liskay, R. M., Skarnes, W. C., and Baker, S. M. (2002) Genetics 160, 271-277[Abstract/Free Full Text]
43. Kim, S. K., Lund, J., Kiraly, M., Duke, K., Jiang, M., Stuart, J. M., Eizinger, A., Wylie, B. N., and Davidson, G. S. (2001) Science 293, 2087-2092[Abstract/Free Full Text]
44. Chu, S., DeRisi, J., Eisen, M., Mulholland, J., Botstein, D., Brown, P. O., and Herskowitz, I. (1998) Science 282, 699-705[Abstract/Free Full Text]
45. Clancy, M. J. (1998) Curr. Biol. 8, R461-R463[CrossRef][Medline] [Order article via Infotrieve]
46. Notredame, C., Higgins, D. G., and Heringa, J. (2000) J. Mol. Biol. 302, 205-217[CrossRef][Medline] [Order article via Infotrieve]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
S. T. Pruett, A. Bushnev, K. Hagedorn, M. Adiga, C. A. Haynes, M. C. Sullards, D. C. Liotta, and A. H. Merrill Jr.
Thematic Review Series: Sphingolipids. Biodiversity of sphingoid bases ("sphingosines") and related amino alcohols
J. Lipid Res., August 1, 2008; 49(8): 1621 - 1639.
[Abstract] [Full Text] [PDF]

Home page
 J BiochemHome page
M. Kyogashima, K. Tadano-Aritomi, T. Aoyama, A. Yusa, Y. Goto, K. Tamiya-Koizumi, H. Ito, T. Murate, R. Kannagi, and A. Hara
Chemical and Apoptotic Properties of Hydroxy-Ceramides Containing Long-Chain Bases with Unusual Alkyl Chain Lengths
J. Biochem., July 1, 2008; 144(1): 95 - 106.
[Abstract] [Full Text] [PDF]