HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 28, 25791-25797, July 12, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/28/25791    most recent M202659200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Que, X. Articles by Reed, S. L. Search for Related Content PubMed PubMed Citation Articles by Que, X. Articles by Reed, S. L. Social Bookmarking                      What's this?

The Cathepsin B of Toxoplasma gondii, Toxopain-1, Is Critical for Parasite Invasion and Rhoptry Protein Processing^*

Xuchu Que, Huân Ngô^§, Jeffrey Lawton^¶, Mary Gray, Qing Liu^§, Juan Engel, Linda Brinen^**, Partho Ghosh^¶, Keith A. Joiner^§, and Sharon L. Reed^§§

From the  Departments of Pathology and Medicine, University of California, San Diego, California 92103-8416, the ^§ Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut 06520-8022, the ^¶ Departments of Chemistry and Biochemistry, University of California, San Diego, California 92093-0314, the  Department of Pathology, University of California, San Francisco, Veterans Administration Medical Center, San Francisco, California 94121, and the ^** Department of Pathology, University of California, San Francisco, California 94143

Received for publication, March 19, 2002, and in revised form, May 8, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cysteine proteinases play a major role in invasion and intracellular survival of a number of pathogenic parasites. We cloned a single copy gene, tgcp1, from Toxoplasma gondii and refolded recombinant enzyme to yield active proteinase. Substrate specificity of the enzyme and homology modeling identified the proteinase as a cathepsin B. Specific cysteine proteinase inhibitors interrupted invasion by tachyzoites. The T. gondii cathepsin B localized to rhoptries, secretory organelles required for parasite invasion into cells. Processing of the pro-rhoptry protein 2 to mature rhoptry proteins was delayed by incubation of extracellular parasites with a cathepsin B inhibitor prior to pulse-chase immunoprecipitation. Delivery of cathepsin B to mature rhoptries was impaired in organisms with disruptions in rhoptry formation by expression of a dominant negative µ1-adaptin. Similar disruption of rhoptry formation was observed when infected fibroblasts were treated with a specific inhibitor of cathepsin B, generating small and poorly developed rhoptries. This first evidence for localization of a cysteine proteinase to the unusual rhoptry secretory organelle of an apicomplexan parasite suggests that the rhoptries may be a prototype of a lysosome-related organelle and provides a critical link between cysteine proteinases and parasite invasion for this class of organism.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The protozoan, Toxoplasma gondii, is an obligate intracellular parasite that can invade and replicate within any nucleated cell of vertebrate hosts, including humans (1-3). Invasion by T. gondii tachyzoites is mediated by the sequential regulated release of specialized secretory organelles of the parasite including the micronemes, rhoptries, and dense granules (4). In early observations, the penetration of host cells by tachyzoites was enhanced by the addition of partially purified lysosomal enzymes (5). In addition, proteinases have been implicated in host cell invasion in other members of the Apicomplexa such as Plasmodium (6) and Eimeria tenella (7). We now show that a cathepsin B, toxopain-1, is strongly implicated in T. gondii invasion and that infection can be interrupted with specific cathepsin B inhibitors.

Another unusual feature of Toxoplasma is the absence of a morphologically identifiable lysosomal system. In higher eukaryotic cells, acidic cathepsins in lysosomes are important in protein processing and breakdown. The mammalian precursor of cathepsin B is targeted to the lysosomal compartment by mannose 6-P for proteolytic activation (8). Thus, the apparent lack of a lysosomal system in Toxoplasma raises a number of questions regarding cellular proteinase functions within the parasite. The rhoptries are club-shaped organelles located at the apical end of the parasites with no known counterpart outside of the phylum Apicomplexa (9). Although nine rhoptry proteins (ROP1-9)¹ have been identified to date (10), a definitive function has only been determined for ROP2, which mediates binding of host mitochondria to the parasitophorous membrane (11). How rhoptry proteins directly contribute to the invasion process is still not clear. T. gondii rhoptry proteins are synthesized as prepro proteins that are subject to proteolytic cleavage to remove the presequence and the proregion at the N terminus and then processed to their mature forms (11-14). Rhoptries and pre-rhoptries are the only acidified organelles identified in the parasite (15), contain a high lipid to protein ratio (16), and scavenge sterols from the host cell (17). We now show that the T. gondii cathepsin B, toxopain-1, localizes to the rhoptries, and inhibition of cathepsin B activity or disruption of ROP protein targeting leads to mislocalization of toxopain-1 and abnormal rhoptry biogenesis. This is the first evidence for localization and function of any proteinase to the unusual rhoptry secretory organelle of an apicomplexan parasite.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Reagents-- All reagents were purchased from Sigma Chemical Co. unless otherwise specified. All AMC and synthetic AMC peptide substrates were obtained from Enzyme System Products (Livermore, CA). Synthetic peptide inhibitors were a gift from Prototek Inc. (Dublin, CA).

Parasite and Host Cell Cultures-- Human foreskin fibroblasts (HFF) were initially cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Irvine Scientific, Irvine, CA) and 2 mM glutamine and maintained subsequently in the same medium with 2% fetal bovine serum. The RH strain of T. gondii was obtained from Dr. John Boothroyd (Stanford University, CA). Tachyzoites of the RH strain were maintained in confluent monolayers of HFF cells.

Cloning of the Cathepsin B Gene-- A cathepsin B family proteinase gene, tgcp1, was amplified from cDNA with primers based on conserved sequences of eukaryotic cathepsins (18) and on partial Expressed Sequence Tag (EST) sequence data from the Toxoplasma genome project (EST clone: TgESTzy53g12r.1) (19). The lambda phage clone was obtained from Genome Systems (St. Louis, MO) in vivo excised with ExAssist (Stratagene, La Jolla, CA) as helper phage and sequenced. The remaining sequence was obtained by 3'- and 5'-RACE (Invitrogen). Total cellular RNA from T. gondii was isolated using RNAzol reagent and transcribed into single-stranded cDNA using Superscript II reverse transcriptase and tgcp1-specific reverse primer R1 (5'-GAG TCA TCA TAT CTC TCT TGA CG-3'). Excess dNTPs and primer were removed from single-stranded cDNA, and a homopolymeric tail of dCs was added to the end of single-stranded cDNAs using terminal deoxynucleotidyl transferase. The 5'-end of tgcp1 cDNA was then amplified from dC-tailed cDNA using the abridged anchor primer and a specific nested primer F2 (5'-CTT CTG TGC TGG CGA AG-3'). For 3'-RACE, cDNA was synthesized from total RNA using the oligo(dT) primer. The 3'-end of the tgcp1 cDNA was PCR-amplified with the tgcp1-specific forward primer F5 (5'-GTG TCG GGG GCC TTC ATG GTC-3') and the oligo(dT) primer. Finally, the complete gene for T. gondii cathepsin B was amplified by RT-PCR with specific primers against the 5'- and 3'-untranslated sequences, cloned into the TA vector (Invitrogen) and sequenced. All nucleotide sequences and predicted amino acid sequences were compared with known sequences in the data base using the BLASTX, BLASTN, and BLASTP programs at the National Center for Biotechnology Information. Southern hybridization of Toxoplasma genomic DNA with a tgcp1 gene probe was performed according to previously described protocols (20).

Homology Modeling of Toxoplasma Cathepsin B-- The sequence of toxopain-1 was aligned with human liver lysosomal cathepsin B, rat cathepsin B, and rat procathepsin B. Existing x-ray crystal structures of human liver lysosomal cathepsin B with CA030 inhibitor (PDB ID: 1CSB), human liver lysosomal cathepsin B with no inhibitor (PDB ID: 1HUC), and rat cathepsin B (PDB ID: 1CTE) were used as three-dimensional templates for the modeling of Toxoplasma cathepsin B. MODELLER, a module of the Quanta software package, was used to generate homology-based models of the enzyme.

Expression and Refolding of Recombinant Toxopain-1-- To express recombinant enzyme, the sequence of the pro- and mature toxopain-1 was amplified and subcloned into pBAD/Thio TOPO (Invitrogen). The plasmid was transformed into Escherichia coli codon plus cells (Stratagene) in SOB media and induced with 0.02% arabinose with 100 µg/ml ampicillin. The cell pellet was solubilized in 6 M GdnHCl, 0.1 M NaH₂PO₄, 0.01 M Tris, pH 8.0, 10 mM -mercaptoethanol, sonicated, and the soluble proteins applied to a nickel affinity column (Invitrogen ProBond), washed with the same buffer at pH 6.3, and eluted at pH 4.5. The protein in the fractions was determined by the Bradford reaction and the fractions screened by SDS-PAGE. One liter of culture yielded ~30 mg of the thioredoxin-TgCP1 fusion protein. Thioredoxin-TgCP1 fusion protein (74.5 mg or 1 µM) was slowly added to 1 liter of 50 mM MES, pH 6.0, 30 mM NaCl, 10 mM MgCl₂, 10 mM CaCl₂, 750 mM arginine, 500 mM GdnHCl, 5 mM reduced glutathione, and 0.5 mM oxidized glutathione and stirred in the cold for 48 h. The sample was dialyzed against Tris-buffered saline, pH 7.5 and concentrated to 30 ml. The sample was re-dialyzed against 0.01 M Tris, pH 7.5 and separated by ion exchange FPLC on a Mono Q column.

Assays of Cysteine Proteinase Activity-- Proteinase activity in column fractions or tachyzoite lysates were measured by cleavage of peptide substrates. T. gondii RH strain tachyzoites were harvested from human fibroblast monolayers, purified by filtration through 3.0-µm nucleopore filters (Costar, Cambridge, MA) and resuspended at 10⁹ cells/ml in 50 mM Tris buffer, pH 7.4. Following three freeze-thaw cycles and a 15-s sonication, the proteinase activity was measured in the soluble fraction. Substrate specificity was tested for the liberation of the fluorescent leaving group, AMC, from the synthetic peptide substrates to determine the preferred cleavage of the P1 and P2 sites (21). The initial rate of substrate hydrolysis (nmol/min/mg protein) is based on the rate of increase of fluorescence using a Labsystems Fluoroskan Spectrofluorometer.

The inhibitor profile (IC₅₀) was determined by monitoring inhibition of hydrolysis of Z-Arg-Arg-AMC substrate in the presence of serial dilutions of the inhibitors following incubation for 30 min at room temperature. The IC₅₀ was calculated as the concentration of inhibitor resulting in 50% inhibition of proteinase activity compared with non-inhibited controls. The peptidyl ketone inhibitors, PRT2005 and PRT2253 (a kind gift from Prototek), with a Phe-hPhe substitution in the P2 and P1 residues, were used in all subsequent inhibitor studies.

Antibody Production-- Recombinant toxopain-1 was expressed in E. coli and purified by nickel-nitrilotriacetic acid affinity column chromatography as above. Polyclonal antibody to recombinant toxopain-1 was produced by immunizing rabbits three times with 100 µg of recombinant protein mixed with Titermax Gold Adjuvant (Sigma). The antiserum was affinity-purified by adsorption and desorption to recombinant toxopain-1 on nitrocellulose membranes as described previously (22).

Monoclonal antibodies were produced previously by immunizing BALB/c mice with 50 µg of recombinant ACP1 (amebic cysteine proteinase 1) using RIBI adjuvant and boosted once intravenously (23). Spleens were harvested and fused with NSO myeloma cells. Three monoclonal antibodies, 1.7, 1.15, and 1.17 were subsequently found to cross-react with T. gondii lysates by immunoblots and ELISA.

Effect of Cysteine Proteinase Inhibitors on Invasion by T. gondii-- To evaluate the effect of specific proteinase inhibitors on invasion, tachyzoites (5 × 10⁴ to 1 × 10⁶) were preincubated 30 min at 37 °C in medium alone or medium containing 20 µM PRT2005 or PRT2253. They were then added directly to fibroblast monolayers on chamber slides (Lab Tek, Nunc) for 2 h. Following washing, the cells were fixed in 4% formaldehyde for 10 min, stained with acridine orange (5 µg/ml), and the number of infected cells was determined by fluorescent microscopy.

Immunofluorescence Microscopy-- HFF cells were grown overnight on coverslips and infected with 2 × 10⁵ tachyzoites per well for 24-48 h. Monolayers were washed with phosphate-buffered saline (PBS) and fixed for 15 min in 3% paraformaldehyde (w/v) in PBS at room temperature. Cells were washed in PBS, permeabilized for 5 min in 0.25% Triton X-100 in PBS, and washed three additional times in PBS. Cells were incubated for 1 h with primary antibody diluted in PBS with 3% bovine serum albumin using anti-ROP2/3/4 mAb T3 4A7 (14) or anti-hemagglutinin (HA) epitope tag monoclonal antibody for overexpressing wild-type Tgµ1-HA, dominant negative Tgµ1-HA(D176A)² or ROP2-HA mutant parasites (24). Toxopain-1 localization was performed with mAb CP1.7 (2 mg/ml) directly labeled with Alexa 594 per kit instructions (Molecular Probes, Eugene, OR) before adding the second antibody. After three washes in PBS, cells were incubated with FITC-conjugated secondary antibodies and washed in PBS. The slides were mounted and examined by epifluorescent microscopy.

Processing of Rhoptry Proteins-- To assess the effect of proteinase inhibitors on rhoptry protein processing in vivo, purified tachyzoites (2.5 × 10⁸) were washed in prewarmed methionine/cysteine-free (Met/Cys) Dulbecco's modified Eagle's medium and incubated for an additional 30 min at 37 °C in medium alone or containing 20 µM inhibitor PRT2253S. Tachyzoites were pulse-labeled with 300 µCi/ml of [³⁵S]methionine/[³⁵S]cysteine (PerkinElmer Life Sciences, Boston, MA) for 15 min in the presence or absence of 20 µM PRT2253S and chased in complete medium for 0-60 min before harvesting. Tachyzoites were washed with PBS containing 1 mM MgCl₂ and 1 mM CaCl₂ with inhibitor and lysed in 1% SDS, and the radiolabeled rhoptry proteins were immunoprecipitated with mAb T3 4A7 and protein A-Sepharose 4B beads (Amersham Biosciences). The beads were separated by 12% SDS-PAGE, the gel impregnated with fluorographic enhancement solution (Amplify, Amersham Biosciences), dried, and exposed to x-ray film for autoradiography.

Tgµ1 Mutants-- Tgµ1 mutants were produced by PCR with an HA epitope tag introduced into Tgµ1 between codons 231 and 232.² The resulting D176A mutation had been shown to alter the binding of the rat µ2-chain to tyrosine-binding motifs (25). Tgµ1-HA and the mutated Tgµ1-HA(D176A) were ligated into pNTP/Sec for transient transfection and into pDHFR-TS/C3M2M3 for stable transfection as previously described (24).

Electron Microscopy-- For cryoimmunoelectron microscopic localization, monolayers of fibroblast cells were infected with RH tachyzoites for 24 h, fixed in 0.8% paraformaldehyde in 0.25 M HEPES buffer pH 7.4, for 48 h, scraped into 1% bovine serum albumin solution, and pelleted in 10% fish skin gelatin. The pellets were infiltrated overnight with 2.3 M sucrose and frozen with liquid nitrogen, and ultrathin cryosections were transferred to grids. Sections were incubated with monospecific polyclonal antibodies to toxopain-1. After washing, sections were incubated with 5 or 10 nmol of protein A-gold conjugates. Following washing, sections were postfixed in 1% glutaraldehyde and contrasted with 0.2% uranyl acetate in 2% methyl cellulose. Images were recorded with a Philips 410 Transmission electron microscope.

For transmission electron microscopic studies, infected monolayers were grown in the presence of media with or without inhibitor for 48 h (20 µM PRT2005), fixed in 2.5% glutaraldehyde in 0.1 M sodium cacodylate, pH 7.4 for 30 min, washed and postfixed in 1% osmium tetroxide. Fixed samples were embedded in Epon and thin-sectioned for transmission electron microscopy. Images were recorded with a Philips Tcenai 10 Transmission electron microscope.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cloning of tgcp1-- A full-length cathepsin B gene, tgcp1, was amplified from RH tachyzoite cDNA based on homology to conserved sequences of eukaryotic cysteine proteinases and a partial sequence in the T. gondii EST data base (19). The completed transcript of 3236 nucleotides encodes a prepro-cathepsin B precursor of 569 amino acids (M_r = 62,165), comprising a predicted N-terminal signal sequence, a propeptide domain, and mature enzyme (Fig. 1). The predicted Met start codon conforms to a Kozak eukaryotic consensus sequence (ANNATGG) for initiation of translation. The sequences leading the ATG start codon (TTTTTTTCACCAAGGAAAAAATGG) conform closely to the T-stretches found in many T. gondii genes. The N-terminal 34 amino acids of the prepeptide region possess a putative signal sequence consisting of hydrophobic amino acids. The putative cleavage site between the signal peptide and propeptide region is predicted by the (3, 1) rule using the SignalP algorithm of von Heijne (26).

View larger version (69K): [in this window] [in a new window]   Fig. 1.   Alignment of toxopain-1 catalytic domain with that of cathepsin B family proteases. Numbering is based on human cathepsin B sequence. Dots indicate gaps introduced to maintain alignment. Identical or conserved residues in all sequences in the alignment are in bold, and the active site residues are starred. An arrow points to the start of the mature proteinase. Tox, T. gondii TgCP1; Sch, Schistosoma japonicum (28); Sar, Sarcophaga peregrina (29); Hum, human cathepsin B (30).

The prodomain of toxopain-1 is much longer (239 amino acid residues) and more diverged than those of other cathepsin B family proteases. Toxopain-1 lacks the ERFNIN motif in its prodomain, which is found in cathepsin L and H but not cathepsin B. The prodomain of toxopain-1 contains two potential sites for asparagine-linked glycosylation NX(S/T) at residue positions 5 and 186 (27). The mature enzyme (296 residues, M_r = 32,362) showed significant similarity to the cathepsin B proteases of Schistosoma japonicum (61%) (28), Sarcophaga peregrina (59%) (29), and human (60%) (30) (Fig. 1).

Like human cathepsin B, toxopain-1 contains the active site triad of cysteine, histidine, and asparagine at positions 30, 211, and 231, respectively. Toxopain-1 has 12 Cys residues at similar positions to those of human cathepsin B to participate in formation of 6 disulfide bridges. In cathepsin B family proteases, there is a conserved motif Gly-Cys-Asn-Gly-Gly (residues 70-74 in human); this motif is also present in toxopain-1 (residues 73-77). Toxopain-1 has an intact occluding loop (His¹¹⁶ and His¹¹⁷) and likely possesses exopeptidase activity in addition to its endopeptidase function. Unlike the cysteine proteinases of Trypanosoma brucei and Trypanosoma cruzi, toxopain-1 has a much shorter C-terminal extension (~30 residues) (31).

Southern blot hybridization of parasite genomic DNA with a toxopain-1 probe revealed two bands of ~5200 and 3000 base pairs when restricted with EcoRI and a single band of ~19,000 base pairs when cut with HindIII, indicating a single copy gene (data not shown).

Homology Modeling of Toxoplasma Cathepsin B-- The model structure generated for Toxoplasma cathepsin B (Fig. 2) was very similar to that of the templates, human liver lysosomal cathepsin B and rat cathepsin B. Overall, the root mean-squared deviation between the backbone of the model structures was less than 1 Å when superimposed on the template starting structures. Close examination of the active site region of the models shows a high degree of similarity. In particular, the catalytic triad residues of the models and templates are nearly perfectly superimposable. In human cathepsin B, the substrate-binding cleft located between the L and R domains of the enzyme is occluded by a loop (residues 104-114). The essential His¹¹⁰-His¹¹¹ moiety in the loop provides positively charged anchors for binding of dipeptidyl carboxylpeptidase substrates for the exopeptidase activity, which is only present in cathepsin B. 

View larger version (119K): [in this window] [in a new window]   Fig. 2.   Homology modeling of TgCP1. Model of the active site pocket of toxopain-1 based on the crystal structure of human lysosomal and rat cathepsin B shown with an inhibitor (Z-arginine-threonine-O-benzyl). The hydrophobic residues are shown in green, and the glutamic acid 255 at the base of the S2 pocket is shown in red.

Expression and Purification of Active, Recombinant Toxopain-1-- To express recombinant protein for refolding, we amplified the region encoding the promature sequence and subcloned the fragment into the pBAD/Thio vector, which optimizes expression of soluble protein and allows purification by nickel affinity chromatography of ~30 mg of toxopain-1/liter. Using a partial factorial refolding screen spanning (32), we found that maximal soluble protein was recovered (73% input protein) after 48 h in a buffer containing 50 mM MES, pH 6.0, 500 mM guanidine hydrochloride, 750 mM arginine, and a 10:1 ration of reduced and oxidized glutathione. Following dialysis against Tris-buffered saline, concentration and purification by ion exchange chromatography, proteolytic activity was associated with a single 32-kDa band, consistent with the mature enzyme (Fig. 3).

View larger version (24K): [in this window] [in a new window]   Fig. 3.   Purification of active recombinant TgCP1. Pro-toxopain-1 was purified from E. coli as a thioredoxin fusion (74.5 kDa). Following refolding and purification, proteolytic fractions contained a 32-kDa protein consistent with the mature, processed enzyme. A Coomassie-stained gel of the unfolded pro-toxopain-1 and the purified cathepsin are shown. Size markers in kDa are on the left.

We compared the substrate specificity of the soluble cysteine proteinase activity in tachyzoite lysates to the recombinant enzyme. Substrate specificity was tested by cleavage of synthetic peptide substrates containing Boc-X-X-4-amino-7-methylcoumarin, where X is a positively charged or neutral amino acid residue, to assess the preferred cleavage of the P1 and P2 sites. The initial velocity of cleavage of Z-Arg-Arg-AMC (modeling the specificity of cathepsin B) was greater than seven times that of Z-Phe-Arg-AMC (substrate of cathepsin L) (Fig. 4).

View larger version (10K): [in this window] [in a new window]   Fig. 4.   Substrate specificity of T. gondii cysteine proteinase. The cysteine proteinase activities in lysates of purified T. gondii tachyzoites (black bars) and active recombinant proteinase (gray bars) were measured with synthetic peptide substrates Boc-X-X-4-amino-7-methylcoumarin, where X = positively charged or neutral peptides. Values are shown as nmol/min/mg and represent the mean ± S.E.

Cysteine Proteinase Inhibitors Block Toxopain-1 and Parasite Invasion-- Ten new peptidyl ketone cysteine proteinase inhibitors (from Prototek) were screened for their activity against cysteine proteinases in T. gondii lysates by measuring the IC₅₀. The inhibitors are di- and tripeptides bearing activated ketones, which are irreversible and covalently modify the enzyme. Seven inhibitors were active at concentrations less than 100 µM (data not shown). PRT2005 and PRT2253, two of the most active inhibitors with an IC₅₀ < 1 µM were used in the subsequent studies.

To evaluate the effect of inhibitors on host cell invasion, tachyzoites (5 × 10⁴ to 1 × 10⁶) were incubated in medium alone or containing 20 µM PRT2005 and allowed to invade fibroblast monolayers in chamber slides for 2 h. The slides were washed, fixed in formaldehyde for 10 min, and stained with acridine orange for counting. The number of infected cells was significantly less in the presence of the inhibitor (p < 0.05 by Student's paired t test, Fig. 5).

View larger version (13K): [in this window] [in a new window]   Fig. 5.   Effect of cysteine proteinase inhibitors on host cell invasion. Tachyzoites (2.5 × 104 to 1 × 106) were preincubated in medium alone or containing 20 µM of the specific inhibitor, PRT2253, and then allowed to invade fibroblast monolayers in chamber slides for 2 h. The monolayers were washed, fixed in formaldehyde, and stained with acridine orange. Significantly fewer fibroblasts were invaded in the presence of cysteine proteinase inhibitors (black bars) than control monolayers in medium alone (white bars).

Cathepsin B Localizes to Rhoptries-- To localize toxopain-1, we performed confocal fluorescent microscopy with monoclonal and polyclonal antibodies against toxopain-1, monoclonal antibodies against rhoptry proteins 2, 3, and 4 (14), polyclonal antibodies generated against ROP2 (33), and monoclonal antibodies against micronemes and dense granules. Studies of infected monolayers revealed that toxopain-1 localized to the rhoptries and residual body, but not to micronemes and dense granules (Fig. 6). Cryoimmunoelectron microscopy using affinity-purified polyclonal antibodies to toxopain-1 confirmed that toxopain-1 is specifically localized (>90% of labeled gold particles) to the rhoptries, endosomal vesicles (34), and secreted into the parasitophorous vacuolar space (Fig. 7). Toxopain-1 was concentrated in a narrow strip down the center of the rhoptry, in contrast to other rhoptry proteins, which are diffusely distributed.

View larger version (46K): [in this window] [in a new window]   Fig. 6.   Localization of ROP2 and cathepsin B (TgCP1) by immunofluorescence microscopy. A, toxopain-1 was detected in infected monolayers with mAb CP1.7A and B, ROP2 with mAb T3 4A7. The corresponding phase image is shown in C. Similar colocalization of toxopain-1 and ROP2 to the rhoptries was also observed using the ROP2 polyclonal antibodies (data not shown).

View larger version (164K): [in this window] [in a new window]   Fig. 7.   Immunoelectron microscopy localization of toxopain-1 and ROP2. Monolayers were infected for 24 h, fixed for cryosectioning, and labeled with affinity-purified polyclonal antibodies against TgCP1. A and B, labeling of sections from a cell indicating specific labeling of toxopain-1 to rhoptries. Arrows indicate rhoptry regions that are demonstrated in insets at higher magnification. Bar = 500 nm. C-E, toxopain-1 is also localized to large endosomal vacuole (arrows, C and D) and the parasitophorous vacuole space (arrow, E). Bar = 100 nm.

Cysteine Proteinase Inhibitors Disrupt the Enzymatic Processing of ROP2-- Because rhoptry proteins are processed prior to their delivery to mature rhoptries (25), we examined whether ROP2 processing is inhibited by specific cathepsin B inhibitors. Processing of pro-rhoptry proteins, ROP2, 3, 4 to mature rhoptry proteins was delayed >60% following preincubation of extracellular parasites with 20 µM PRT2253S for 15 min at room temperature prior to pulse-chase experiments (Fig. 8).

View larger version (80K): [in this window] [in a new window]   Fig. 8.   Cysteine proteinase inhibitors block processing of proROP proteins. RH tachyzoites were pulse-labeled for 15 min with [35S]methionine/[35S]cysteine in the presence or absence of 20 µM cathepsin B-specific inhibitor, PRT2253F. Cells were washed and chased for 0-60 min in the presence or absence of inhibitor before immunoprecipitation with mAb T3 4A7, which reacts with ROP2, -3, and -4. The immunoprecipitates at the indicated time intervals were analyzed by SDS-PAGE and fluorography. Total labeled protein is shown in the left lane. Mature ROP2 is shown with an arrow.

Disruption of Tgµ1 Function Missorts Cathepsin B to Abnormal Rhoptries-- Localization of T. gondii ROP2 is dependent on a tyrosine motif (YEQL) in the cytoplasmic tail that binds to the µ1-chain of the T. gondii AP-1 clathrin adaptor (Tgµ1) (24). Tgµ1 adaptin is essential for normal biogenesis of rhoptries (24). A Tgµ1(D176A)-HA mutant with a mutation at a residue necessary for binding to the tyrosine motif functions as a dominant negative inhibitor of AP-1 function. In parasites overexpressing the dominant negative Tgµ1(D176A)-HA, rhoptry biogenesis is altered, and the labeling of ROP2 is decreased drastically in intensity and detectable only in a thin, discontinuous organelle spanning the apical half of the cell (Fig. 9). Cathepsin B was also mislocalized to both distorted rhoptries and to residual bodies in the parasitophorous vacuole space in the D176A mutant, but not in parasites stably overexpressing wild-type T. gondii µ1-HA (data not shown). These results indicate that cathepsin B is directed to the rhoptry secretory pathway. Hence, manipulations that interfere with rhoptry biogenesis also interfere with normal targeting of cathepsin B. 

View larger version (44K): [in this window] [in a new window]   Fig. 9.   Overexpressing dominant negative Tgµ1(D176A) altered rhoptry and cathepsin B trafficking. Indirect immunofluorescence of RH tachyzoites overexpressing wild-type (Tgµ1-HA) and dominant negative mutant (Tgµ1(D176A)-HA). Parasites were stained with mAb T3 4A7 to the ROP2 and monoclonal antibody mAb CP1.7 to cathepsin B. The corresponding phase image is shown on the right.

Inhibition of Cathepsin B Activity Results in Abnormal Rhoptry Morphology-- To determine the requirement of active cathepsin B for rhoptry biogenesis, infected monolayers were grown in the presence of 20 µM PRT2005 for 48 h. Electron micrographic studies revealed that the rhoptries were small and poorly developed (Fig. 10). No changes were detected in uninfected fibroblast cells incubated with 20 µM PRT2005 for 48 h (data not shown). Thus, rhoptry biogenesis is dependent on both toxopain-1 and ROP protein delivery and processing.

View larger version (132K): [in this window] [in a new window]   Fig. 10.   Cysteine proteinase inhibitors alter rhoptry structure. Infected fibroblast monolayers were grown in the presence of media alone (Control) or media containing the cysteine proteinase inhibitor, PRT2005, at a final concentration of 20 µM for 48 h (+Inhibitor), and visualized by electron microscopy. The small, distorted rhoptries (r) and enlarged Golgi (arrow) are shown in the presence of the inhibitor (×25,500).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cysteine proteinases are critical to invasion by a number of protozoan parasites, including Plasmodium (6) and Eimeria (7). Therefore, we evaluated the role of cysteine proteinases in the pathogenesis of toxoplasmosis. We first cloned a full-length cysteine proteinase gene by amplification from parasite cDNA by 3'- and 5'-RACE based on conserved sequences of eukaryotic cathepsins and a cDNA sequence from the T. gondii EST data base. The resultant cysteine proteinase gene, tgcp1, has the active site triad of cysteine, asparagine, and histidine (Fig. 1). The deduced amino acid sequence is 44-46% identical to human (30) and Schistosoma (28) cathepsin B family proteinases (Fig. 1). Toxopain-1 contains an occluding loop sequence used previously to identify cathepsin B, conferring exopeptidase activity (Fig. 1) (30) and is present as a single copy gene.

Homology modeling for toxopain-1 reveals that the overall fold of model structures is very similar to human liver lysosomal cathepsin and rat cathepsin B, particularly at the active sites (Fig. 2). Both of the Toxoplasma and human cathepsin B enzymes have a glutamic acid in the base of the S2 pocket, suggesting a substrate preference for positively charged amino acids (Fig. 2). To obtain active, recombinant enzyme, we expressed the proenzyme as a thioredoxin fusion protein in E. coli. A number of refolding protocols were evaluated (32), and the resulting purified proteolytically active fractions contained a 32-kDa band consistent with the mature enzyme. The refolded enzyme, therefore, is capable of autocatalytically removing both the prosegment and the thioredoxin fusion (Fig. 3).

The preferred substrate of toxopain-1 is for positively charged amino acids, particularly arginine, in the P1 and P2 positions, consistent with cathepsin B activity. The substrate specificities of purified rtoxopain-1 and tachyzoite lysates (Fig. 4), as well as the proteolytic activity released into the medium (data not shown) were essentially identical, suggesting that toxopain-1 is the major cathepsin B proteinase species in the parasite. To date, no other cathepsin B has been identified in the Toxo EST data base or genome project.

It is interesting to note that, in contrast to other proteases of this family, toxopain-1 shows very little specificity for Phe/Arg-containing substrates but a distinct preference for Arg/Arg substrates. The homology-based models created for the Toxoplasma protease suggest an explanation for the observed kinetic findings. If the coordinates of another rat cathepsin B structure (PDB ID: 1THE), one with a covalently bound inhibitor at the active site, are superimposed on the model structures of TgCP1, the positioning of the structure 1THE has the sequence, Z-arginine-serine-O-benzyl, with Arg in the P2 position. Superimposition upon toxopain-1 models shows that the Arg in the P2 position of the inhibitor would be ideal to form a stabilizing salt bridge with nearby Glu²⁵⁵ (Fig. 2). A Phe in P2, however, would find no stabilizing interactions, and as a result would be a less favorable substrate. The sequence of rat cathepsin B (1THE) has a nearby tyrosine at position 75 that could conceivably make constructive stacking interactions with a Phe at the P2 position of a substrate. Toxopain-1 does not have this tyrosine residue, further supporting the observed substrate profile of the enzyme.

Studies of the biologic roles of cysteine proteinases have been greatly aided by the development of specific, cell-penetrating inhibitors. The peptidyl ketone inhibitors PRT2005 and PRT2253 have an IC₅₀ for the T. gondii proteinase of <1 µM and produce no demonstrable effect on host cells. When purified tachyzoites were incubated 30 min in the presence of PRT2005 or PRT2253, invasion was significantly inhibited (Fig. 5).

Immunofluorescent and immunoelectron microscopy studies revealed that toxopain-1 localizes to the rhoptries (Figs. 6 and 7), organelles that play an essential but as yet undefined role in the invasion process of parasites. All nine rhoptry proteins are released as prepro proteins and must be processed to the mature proteins. To determine if toxopain-1 was a key enzyme for ROP processing, we first evaluated the effect of specific cysteine proteinase inhibitors on ROP processing in whole tachyzoites. Greater than 60% inhibition of processing of ROP2, 3, and 4 was detected (Fig. 8). The failure to completely block rhoptry processing might reflect incomplete penetration of the inhibitor or the possible requirement of a proteinase cascade. Ahn et al. (35) and Miller et al.³ recently reported a subtilisin-like proteinase that localized to the rhoptries and might also play a role in ROP processing.

The critical link between rhoptry biogenesis and toxopain-1 was also demonstrated in localization studies in ROP2 or transport mutants. ROP2 is targeted to rhoptries by an evolutionarily conserved YEQL sequence in its cytoplasmic tail that binds to µ-chain subunits of the adaptor complex (24). In a dominant negative mutant of the µ1-chain of the adaptor complex,² toxopain-1 localizes to distorted rhoptries and residual bodies in the parasitophorous vacuole (Fig. 9). Alternatively, when toxopain-1 is inhibited by growing infected monolayers in the presence of cell-permeant cysteine proteinase inhibitors, rhoptries are small and distorted (Fig. 10).

These studies also shed light on the cellular location of ROP protein processing. Earlier pulse-chase experiments found that processing of ROP2, 3, and 4 was completed in ~30 min (14) and likely occurred in either secretory granules or in rhoptry precursors (36). Soldati et al. (12) found that both brefeldin A and low temperatures blocked processing of ROP1, so the event was likely post-Golgi. Overexpression of a ROP1-Myc fusion suggested that processing occurred in nascent rhoptries of dividing tachyzoites (12). Similarly, processing of ROP2 was proposed to occur within the secretory pathway en route to the rhoptries (11). Earlier experiments and our findings are consistent with processing of ROP1 and 2 in the late secretory pathway or in maturing rhoptries. Lysosomes have not been identified in T. gondii, but the forming and mature rhoptries are the most acidic compartment in the parasite (15). Both the processed rhoptry proteins and toxopain-1 appear to be densely packed in the mature rhoptries, resulting in the intense signals detected by confocal microscopy (Fig. 6) and immunoelectron microscopy (Fig. 7). This is the first evidence for the localization of and the identification of function of any proteinase to the unusual rhoptry organelle. These findings suggest that the rhoptries may be one of the earliest models of a lysosome-related organelle (37). This may also prove to be an important model for rhoptry protein processing in Plasmodium as well. Similar post-translational processing occurs (38), but the exact site and proteinases involved remain to be determined.

Cathepsin Bs of higher eukaryotes are sorted to lysosomes by mannose-6-P receptors (39). Toxopain-1 does not appear to have mannose 6-P despite two potential glycosylation sites in its prodomain (data not shown). McKerrow and coworkers (40) has identified a prodomain motif in the cathepsin Ls of T. cruzi and Leishmania mexicana, which are required for targeting to lysosomes, but similar signals have not been identified in cathepsin B. We also found that toxopain-1 is released extracellularly into buffer independent of synchronized rhoptry release during invasion. The atypical location of toxopain-1 down the center of the rhoptry (Fig. 7, A and B) suggests a potential subcompartment, which might be released constitutively. Alternatively, toxopain-1 was also detected in endosomal vacuoles (Fig. 7C), which may represent an exosomal pathway of protein excretion (41). Precedence for lysosomal proteinases in a vesicle population comes from Soldati's group⁴ and the localization of cathepsin D. The exact signals that target toxopain-1 to the rhoptries or for extracellular release, independently of cell invasion, are under investigation and could lead to important insights into the biogenesis and targeting to a primitive lysosomal system.

The rhoptry organelles are parasite-specific and play a crucial function in host-cell invasion and establishment of the parasitophorous vacuole. Therefore, targeting inhibitors to the unique rhoptries is particularly attractive for blocking parasite invasion and growth. We have now shown that toxopain-1 plays a key role in cellular invasion and thus may be a target for therapeutic intervention. Protease inhibitors are proving to be potent antimicrobial drugs and may provide a strategy to prevent and/or treat Toxoplasma infections. This goal is critically important for toxoplasmosis in which the current optimal therapeutic regimens are toxic, and life-long suppression is required in severely immunocompromised AIDS patients.

	ACKNOWLEDGEMENTS

We thank Scott Herdman and Ken Hirata for excellent technical assistance, Drs. Jim McKerrow, Mohammed Sajid, Charles Davis, and Lester J. Reed for helpful discussions, Dr. Dubremetz for anti-ROP antibodies, and Ivy Hsieh (Microscopy and Advanced Imaging Core Facility, Veterans Administration Medical Center) for the transmission electron microscopy.

	FOOTNOTES

^* This work was supported in part by United States Public Health Service Grant RO1 AI41903 (to S. R.), Grant AI30060 (to K. J.), University of California, San Diego, Center for AIDS Research NIAID Grant 5 P30 AI36214 (to S. R. and X. Q.), the University-wide AIDS research program grant (to S. R.), and a scholar award in Molecular Parasitology from the Burrough's Wellcome Fund (to K. J.). This work was presented in part at the Fifth and Sixth International Congress on Toxoplasmosis (1999 at Marshall, CA and 2001 at Freising, Germany) and the Eleventh Molecular Parasitology Meeting (2000 at Woods Hole, MA).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AY071839.

Present address: Joint Center for Structural Genomics, Stanford Synchrotron Radiation Laboratory, Menlo Park, CA 94025

^§§ To whom correspondence should be addressed: Div. of Infectious Diseases, University of California, San Diego Medical Center, 200 W. Arbor Dr., San Diego, CA 92103-8416. Tel.: 619-543-6146; Fax: 619-543-6614; E-mail: slreed@ucsd.edu.

Published, JBC Papers in Press, May 8, 2002, DOI 10.1074/jbc.M202659200

² H. M. Ngô, M. Yang, M. Pypaert, H. Hoppe, and K. A. Joiner, submitted manuscript.

³ S. Miller, E. Binder, M. Blackman, V. Carruthers, and K. Kim, unpublished data.

⁴ U. Jakle, Q. Liu, C. Berry, K. Joiner, and D. Soldati, unpublished data.

	ABBREVIATIONS

The abbreviations used are: ROP, rhoptry protein; TgCP1, T. gondii cysteine proteinase 1; ELISA, enzyme-linked immunosorbent assay; RACE, rapid amplification of cDNA ends; FPLC, fast protein liquid chromatography; FITC, fluorescein isothiocyanate; Boc, t-butoxycarbonyl; mAb, monoclonal antibody; AMC, 4-amino-7-methyl coumarin; MES, 4-morpholineethanesulfonic acid; Z, carboxybenzyloxy; HA, hemagglutinin; PBS, phosphate-buffered saline.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. D. Lavine and G. Arrizabalaga Exit from Host Cells by the Pathogenic Parasite Toxoplasma gondii Does Not Require Motility Eukaryot. Cell, January 1, 2008; 7(1): 131 - 140. [Abstract] [Full Text] [PDF]

				S. G. Melendez-Lopez, S. Herdman, K. Hirata, M.-H. Choi, Y. Choe, C. Craik, C. R. Caffrey, E. Hansell, B. Chavez-Munguia, Y. T. Chen, et al. Use of Recombinant Entamoeba histolytica Cysteine Proteinase 1 To Identify a Potent Inhibitor of Amebic Invasion in a Human Colonic Model Eukaryot. Cell, July 1, 2007; 6(7): 1130 - 1136. [Abstract] [Full Text] [PDF]

				X. Que, J. C. Engel, D. Ferguson, A. Wunderlich, S. Tomavo, and S. L. Reed Cathepsin Cs Are Key for the Intracellular Survival of the Protozoan Parasite, Toxoplasma gondii J. Biol. Chem., February 16, 2007; 282(7): 4994 - 5003. [Abstract] [Full Text] [PDF]

				P. J. Bradley, C. Ward, S. J. Cheng, D. L. Alexander, S. Coller, G. H. Coombs, J. D. Dunn, D. J. Ferguson, S. J. Sanderson, J. M. Wastling, et al. Proteomic Analysis of Rhoptry Organelles Reveals Many Novel Constituents for Host-Parasite Interactions in Toxoplasma gondii J. Biol. Chem., October 7, 2005; 280(40): 34245 - 34258. [Abstract] [Full Text] [PDF]

				K. L. Carey, A. M. Jongco, K. Kim, and G. E. Ward The Toxoplasma gondii Rhoptry Protein ROP4 Is Secreted into the Parasitophorous Vacuole and Becomes Phosphorylated in Infected Cells Eukaryot. Cell, October 1, 2004; 3(5): 1320 - 1330. [Abstract] [Full Text] [PDF]

				M. Yang, I. Coppens, S. Wormsley, P. Baevova, H. C. Hoppe, and K. A. Joiner The Plasmodium falciparum Vps4 homolog mediates multivesicular body formation J. Cell Sci., August 1, 2004; 117(17): 3831 - 3838. [Abstract] [Full Text] [PDF]

				X. Que, A. Wunderlich, K. A. Joiner, and S. L. Reed Toxopain-1 Is Critical for Infection in a Novel Chicken Embryo Model of Congenital Toxoplasmosis Infect. Immun., May 1, 2004; 72(5): 2915 - 2921. [Abstract] [Full Text] [PDF]

				I. Coppens and K. A. Joiner Host but Not Parasite Cholesterol Controls Toxoplasma Cell Entry by Modulating Organelle Discharge Mol. Biol. Cell, September 1, 2003; 14(9): 3804 - 3820. [Abstract] [Full Text] [PDF]

				V. Nakaar, H. M. Ngo, E. P. Aaronson, I. Coppens, T. T. Stedman, and K. A. Joiner Pleiotropic effect due to targeted depletion of secretory rhoptry protein ROP2 in Toxoplasma gondii J. Cell Sci., June 1, 2003; 116(11): 2311 - 2320. [Abstract] [Full Text] [PDF]

				H. M. Ngo, M. Yang, K. Paprotka, M. Pypaert, H. Hoppe, and K. A. Joiner AP-1 in Toxoplasma gondii Mediates Biogenesis of the Rhoptry Secretory Organelle from a Post-Golgi Compartment J. Biol. Chem., February 7, 2003; 278(7): 5343 - 5352. [Abstract] [Full Text] [PDF]

				D. C. Greenbaum, A. Baruch, M. Grainger, Z. Bozdech, K. F. Medzihradszky, J. Engel, J. DeRisi, A. A. Holder, and M. Bogyo A Role for the Protease Falcipain 1 in Host Cell Invasion by the Human Malaria Parasite Science, December 6, 2002; 298(5600): 2002 - 2006. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/28/25791    most recent M202659200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Que, X. Articles by Reed, S. L. Search for Related Content PubMed PubMed Citation Articles by Que, X. Articles by Reed, S. L. Social Bookmarking                      What's this?