 |
INTRODUCTION |
Prostate cell growth, development, and homeostasis are critically
dependent upon the androgen receptor
(AR),1 an androgen-responsive
transcription factor that activates expression of target genes in
response to hormonal signals derived from the testis. The AR is a
member of the nuclear hormone receptor (NHR) family and, in common with
other family members, is a modular protein composed of numerous
independently functioning domains (1-3). Upon binding to androgens
within the cytoplasm, the AR translocates to the nucleus (4) where it
recognizes and binds specific promoter elements and activates
transcription of target genes through the concerted action of two
transcriptional activation domains, namely activation function-1 (AF-1)
and -2 (AF-2) (5).
The AF-2 domain of NHRs plays a fundamental role in receptor-mediated
transcriptional activation. Upon ligand-binding, the C-terminal AF-2
undergoes a shift in conformation generating a platform suitable for
protein-protein interaction with co-activator molecules (6, 7). To
date, numerous co-activator molecules have been identified that
function to enhance the transcriptional potential of NHRs (8). The
majority of co-activators identified share the capacity to elicit
histone acetyltransferase (HAT) activity, a catalytic process heavily
implicated in target gene activation via chromatin remodeling (9, 10).
Of the identified HAT-containing co-activators, several have emerged to
play significant roles in NHR activity, including the p160 (11-13) and
CBP (CREB-binding protein)/p300 families (14, 15) and PCAF
(p300/CBP-associating factor) (16).
Whereas histone acetylation is important for initiating and maintaining
transcriptionally active genes, the recruitment of factors involved in
deacetylating target promoters is deemed to be a requisite for gene
silencing. Numerous co-repressor molecules have been identified, such
as Sin3 (17) and SMRT (18), which play an active role in
transcriptional repression by numerous transcription factors such as
unliganded class II NHRs (19). These repressors are found in complex
with histone deactylases (HDACs); enzymes that actively reduce the
level of histone acetylation. To date, three groups of histone
deacetylases have been identified. The class I family is composed of 4 members, HDAC1-3 and HDAC8, and are homologues of the yeast protein
RPD3 (20). Six class II HDACs have been characterized, HDAC4-7, -9, and -10, which bear significant homology to the HDA protein of yeast
(20). Class III HDACs are homologous to the yeast Sir2 protein, but as
yet, are not well characterized.
The finding that several transcription factors, such as p53 (21, 22)
and MyoD (23, 24), are targets for direct acetylation and deacetylation
suggests that factor acetyltransferase (FAT) and HDAC proteins,
respectively, play an active role in regulating transcription factor
function, in which the status of acetylation at both the histone and
transcription factor level heavily influences gene expression profiles.
Recently, the AR has been found to be a substrate for p300- and
PCAF-mediated FAT activity (25). Acetylation of three lysine residues
in the short lysine-rich motif KLKK, flanking the DNA-binding domain
(DBD), increases transcriptional activity of the AR, implicating this
post-translational modification as a mechanism for regulating AR activity.
Tip60 (Tat-interactive protein, 60 kDa) was first identified in complex
with the Tat protein of human immunodeficiency virus-1 (26) and
was later demonstrated to directly acetylate histones H2A, H3, and H4
via a C-terminal HAT domain (27). We previously identified Tip60 as an
AR-interacting protein and showed Tip60 as a bona fide
co-activator for the AR (28). Moreover, we have recently demonstrated
that Tip60 is a class I NHR-specific co-activator implicating an
important role for Tip60 in steroid hormone receptor function (29). To
further define the role of Tip60 in AR-mediated gene expression, we
provide evidence that Tip60 directly acetylates the AR in
vivo, which is a requisite for Tip60-mediated AR
co-activation. We next investigated the potential for HDACs to
influence AR transcriptional activity. Here we demonstrate that the AR
is specifically down-regulated by the histone deacetylase activity of
HDAC1, the effect of which can be reversed by the HAT activity of
Tip60. In mammalian two-hybrid and immunoprecipitation experiments, we
show that HDAC1 interacts directly with the AR. Using chromatin
immunoprecipitation assays, we demonstrate that Tip60 and HDAC1
associate with the endogenous AR-responsive PSA promoter in LNCaP
cells, implicating an important physiological role for acetylation and
deacetylation in AR regulation. Together, the data suggests that the
acetylation status of the AR is a dominant factor in regulating
transcriptional activity, and is the first evidence that HDAC1 can
down-regulate a member of the class I nuclear hormone receptor family.
| |
EXPERIMENTAL PROCEDURES |
Plasmids and Antibodies--
The following plasmids have been
described previously: pPSALuc, UASTKLuc, pCMV-
-gal, pcDNA3-AR
(28), pM-AR-DS (29), pBJ5-FLAG-HDAC1 and
pBJ5-FLAG-HDAC1H141A (gifts from Stuart Schreiber, Harvard Medical School) (30, 31), pME18S-FLAG-HDAC2 (gift from Robert Eisenman,
Fred Hutchinson Cancer Research Centre and Research Institute) (32),
pCMV-FLAG-HDAC3 (gift from Cheng-Wen Wu, Institute of Biomedical
Sciences, Academia Sinica) (22), pcDNA-His-HDAC5 and
pcDNA-His-HDAC6 (gifts from Saadi Khochbin, Institut Albert Bonniot) (33, 34), pcDNA3-AR630 and
pcDNA3-AR632/633 (gifts from Richard Pestell, the
Albert Einstein Cancer Centre, Albert Einstein College of Medicine)
(25).
The full-length Tip60 construct was generated by PCR, incorporating
TipF (ATGGACTACAAAGACGACGATGACAAAGCGGAGGTGGGGGAGATAATCGAG (anneals to the start codon of Tip60 and incorporates a FLAG tag)) and
TipR (TCAACCACTTCCCCCTCTTGCTCCA (anneals to the stop codon of Tip60)),
using POZ-Tip60 (gift from Yoshihiro Nakatani, Dana-Farber Cancer
Research Institute) (35) as template and Bio-Taq DNA polymerase enzyme
(Bioline). The product was cloned into the TA-vector (Invitrogen) and
then subcloned into pCMV vector via the EcoRI site.
The Tip60 HAT-defective mutant, Tip60Q377E/G380E,
was generated by PCR using POZ-Tip60Q377E/G380E (gift from
Tsuyoshi Ikura) (35) as template and Bio-Taq DNA polymerase enzyme,
incorporating TipF and TipR. The product was cloned into the TA-vector
and then subcloned into the pCMV vector via the EcoRI site.
To generate pVP16AD-HDAC1, PCR was performed with HDAC1F,
GAATTCATGGCGCAGACGCAGGGCACCCGG (anneals to the start codon of HDAC1), and HDACR, GGATCCTCAGGCCAACTTGACCTCCTCCTTGAC (anneals to the stop codon
of HDAC1), incorporating pBJ5-FLAG-HDAC1 as template and Bio-Taq DNA
polymerase. The product was cloned into the TA-vector system as before
and then subcloned into pVP16AD (CLONTECH), via the
BamHI and EcoRI sites. All constructs were fully
sequenced to confirm integrity. Tip60-specific antibody was
generated by injecting rabbits with a Tip60 peptide (amino acids
283-297) and then the antibody was affinity purified.
Cell Culture and DNA Transfection--
Cell culture and DNA
transfection were performed as described previously (28). COS-7 cells
were maintained in RPMI 1640 media containing 10% fetal calf serum
(FCS) (Invitrogen), 1% penicillin, and 1% streptomycin. 1 × 104 COS-7 cells were routinely plated per well in
24-microtiter plates (Corning). After 24 h, the cells were
transfected using Superfect (Qiagen) according to the manufacturer's
recommendations. After 2 h, cells were washed and incubated either
in FCS-containing media prior to treatment with 100 nM
trichostatin A (TSA), or in RPMI 1640 media containing 10% FCS that
had been stripped of steroids by treatment with dextran-coated charcoal
prior to experimentation with 10 nM R1881 (synthetic
androgen analogue). After 48 h, cells were harvested and assayed
for luciferase activity according to the manufacturer's guidelines
(Promega). Luciferase activity was corrected for the corresponding
-galactosidase activity to give relative activity as described
previously (28). In general, TSA treatment lasted 12 h prior to
cell harvesting, whereas treatment with R1881 lasted the duration of transfection.
The prostate cancer cell line LNCaP was cultured as above. For
transfections, a superfect:DNA ratio of 3:1 for COS-7 cells was
increased to 5:1 for LNCaP cells and the incubation period for
transfection mixtures was increased from 2 h for COS-7 cells to
3 h for LNCaP cells.
In general, co-transfection experiments using both COS-7 and LNCaP
cells incorporated 50 ng of each expression vector and 200 ng of each
reporter construct. Fold increases were determined for 50 ng of
expression vector by comparing the activity with empty pCMV-driven
vector. Each experiment was performed in triplicate and repeated a
minimum of three times.
Western Blotting--
COS-7 cell lysates were boiled in SDS
sample buffer (100 mM dithiothreitol, 125 mM
Tris-HCl (pH 6.8), 2% SDS, 20% glycerol, 0.005% bromphenol blue) for
10 min and equivalent amounts of protein were resolved on 12%
polyacrylamide gels. Proteins were subsequently transferred to
HybondTM membrane (Amersham Biosciences) and detected by
specific antibodies (see Figs. 1, 3, and 6) using the ECL system
(Amersham Biosciences) according to the manufacturer's recommendations.
In Vivo 3H Labeling and AR
Immunoprecipitation--
COS-7 cells were transfected with 3 µg of
pcDNA3-AR and 3 µg of pCMV-Tip60 or empty pCMV for control per
90-mm dish. 1 h prior to harvesting, cells were incubated in
FCS-containing media supplemented with 100 nM TSA and 1 µM [3H]acetic acid (ICN). Samples were
subjected to immunoprecipitation, as described in Ref. 28, using a
polyclonal anti-AR antibody (Santa Cruz). Immunoprecipitates were
resolved on a 12% polyacrylamide gel, soaked in Amplify (Amersham
Biosciences), and then exposed to x-ray film at 
80 °C for 72 h.
To determine a direct role for Tip60 HAT activity in AR acetylation,
COS-7 cells were transfected with 2 µg of pcDNA3-AR, pCMV-Tip60,
or pCMV-Tip60Q377E/G380E per 90-mm dish and lysates were
subjected to immunoprecipitation using a polyclonal anti-AR antibody
(as described before) and immunoblotting with an anti-acetyllysine
antibody (Upstate Biotechnology) to detect the acetylated AR
species. To examine a potential AR-HDAC1 interaction, COS-7
cells transfected with 2 µg of pcDNA3-AR and pJB5-FLAG-HDAC1 per
90-mm dish were subjected to immunoprecipitation as before using an
anti-FLAG antibody to immunoprecipitate HDAC1-associated complexes and
immunoblotting using a polyclonal anti-AR antibody.
Chromatin Immunoprecipitation Assays--
LNCaP cells were grown
on 150-mm dishes in FCS-containing media for 2 days until ~5 × 106 cells were present. 16 h prior to androgen
treatment, cells were transferred to steroid-depleted media (RPMI
supplemented with 10% dextran-coated charcoal-stripped FCS). After
16 h, the media was replaced with FCS-stripped media supplemented
with or without 10 nM R1881 for the specified time period
(see Fig. 8). Following treatment, LNCaP cells were treated with
formaldehyde, added directly to culture medium (to a final
concentration of 1%), at room temperature for 10 min to cross-link
histone proteins to DNA. Soluble chromatin was made as follows: cells
were washed and detached by scraping following addition of ice-cold
phosphate-buffered saline supplemented with 25 µg/ml leupeptin, 25 µg/ml aprotinin, and 25 µg/ml pepstatin, and pelleted by
centrifugation for 4 min at 700 × g. The latter two
steps were repeated. The cell pellet was then subjected to immunoprecipitation by resuspending in lysis buffer (50 mM
Tris (pH 8.1), 1% SDS, 10 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride, 0.8 µg/ml pepstatin, 0.6 µg/ml
leupeptin, and 0.6 µg/ml aprotinin), followed by sonication. Samples
were then centrifuged at 13,000 rpm for 10 min and the supernatant was
decanted and diluted 10-fold in dilution buffer (25 mM Tris
(pH 8.1), 140 mM NaCl, 1% SDS, 3 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 0.8 µg/ml pepstatin, 0.6 µg/ml leupeptin, and 0.6 µg/ml aprotinin). To pre-clear
chromatin solution, 60 µl of salmon sperm DNA/protein A-agarose beads
(Upstate Biotechnology) was added to each sample and agitated for 30 min at 4 °C. Beads were pelleted by brief centrifugation and the
supernatant was collected. For immunoprecipitation, 2 µg of
polyclonal AR antibody, monoclonal HDAC1 antibody (Upstate
Biotechnology), or Tip60 polyclonal antibody (see above) were added to
1 ml of the purified chromatin sample and incubated overnight at
4 °C. Immunocomplexes were recovered by adding 60 µl of salmon
sperm/protein A-agarose for 1 h at 4 °C with agitation. Beads
were washed sequentially for 5 min each in 10 ml of TSE buffers I-III
and TE (pH 8), as described previously (36). Immunocomplexes were
eluted by adding 250 µl of elution buffer (1% SDS and 0.1 M NaHCO3) to beads and subsequently heated for
4 h at 64 °C to reverse formaldehyde-induced cross-links. DNA
were then recovered by phenol/chloroform extraction, ethanol
precipitation, and resuspended in 50 µl of TE. Semiquantitative PCR
was performed with 10 µl of DNA, Bio-Taq DNA polymerase, and [
-32P]dATP, using primers P1F (GTGGAGCTGGATTCTGGG) and
P4R (TGGGTACGATCCCCGATT), to amplify the 235 bp of the PSA promoter,
encompassing the ARE2 (see Fig. 8). PCR products were resolved, dried,
and then exposed to x-ray film for 2-12 h.
| |
RESULTS |
Tip60 Mediates Direct Acetylation of the AR in Vivo--
The AR
has been demonstrated to be directly acetylated by p300 and PCAF.
Acetylation of the AR was shown to enhance inherent transcriptional
activity of the AR, suggesting that acetylation plays a significant
role in AR regulation (25).
We previously identified Tip60 as a bona fide co-activator
for the AR (28). Considering that Tip60 contains a HAT domain, which
has been shown to acetylate free histones H4, H3, and H2A (27), we
sought to examine if, like p300 and PCAF, Tip60 directly acetylated the
AR to increase transcriptional activity. To determine whether the AR is
a target for Tip60-mediated acetylation in vivo, COS-7 cells
were transiently transfected with wild-type AR and either Tip60 or
empty vector for control, and incubated for 1 h in
[3H]acetic acid prior to immunoprecipitation with an
anti-AR antibody. The level of AR acetylation was determined by
measuring [3H]acetate incorporation into the AR protein
using autoradiography. Previous work has shown that addition of the
HDAC inhibitor TSA greatly enhances AR activity, suggesting that the AR
is a potential target for direct deacetylation and down-regulation by
HDACs (25). We incorporated 100 nM TSA into our system to
block the action of deacetylase enzymes. As shown in Fig.
1A, a, in the
presence of Tip60, the level of AR acetylation was increased
substantially over that in the absence of Tip60 (compare lanes
1 and 2), indicating that Tip60 may directly acetylate
the AR, presumably through the activity of the HAT domain. Our results
also indicate that in the absence of overexpressed Tip60, endogenous
factors within COS-7 cells have the capacity to induce AR acetylation
(lane 1). Whether this modification is through the HAT
activity of endogenous Tip60, or other potential HAT-containing
proteins, such as p300 and PCAF, remains to be determined. Using
Western blotting, incorporating an anti-AR antibody, we confirmed that
the difference in acetylation observed was not from variation in
transfection efficiencies between the samples (Fig. 1A,
b).
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 1.
Tip60 directly acetylates the AR.
A: a, 5 × 106 COS-7 cells
were transiently transfected with 5 µg of pcDNA3-AR and 5 µg of
pCMV-Tip60 or pCMV for control. Cells were treated 1 h with
[3H]acetic acid prior to immunoprecipitation with a
polyclonal anti-AR antibody. b, transfected cell extracts
were immunoblotted with a monoclonal anti-AR antibody to establish
equal loading between the two samples. B, COS-7 cells were
transiently transfected as above with the inclusion of
pCMV-Tip60Q377E/G380E. 48 hours after transfection, cell
lysates were immunoprecipitated (IP) with an anti-AR
antibody and then immunoblotted (IB) with an
anti-acetyllysine antibody to detect acetylated AR species.
|
|
To establish that the HAT activity of Tip60 was responsible for
directly acetylating the AR, the ability of wild-type Tip60, and a
HAT-defective Tip60 mutant (Tip60Q377E/G380E) (25),
to acetylate the AR was investigated. COS-7 cells transiently transfected with full-length AR and wild-type Tip60 or
Tip60Q377E/G380E were immunoprecipitated using an anti-AR
antibody followed by immunoblotting incorporating an anti-acetyllysine
antibody, to compare the levels of AR acetylation in the presence of
either wild-type Tip60 or Tip60Q377E/G380E. We figured that
if AR hyperacetylation is a result of Tip60-mediated HAT activity, then
overexpression of the Tip60 HAT mutant, which lacks a functional HAT
domain through the substitution of two residues (Glu-377 and Gly-380)
required for acetyl-CoA binding (35), would fail to generate the
acetylated form of the AR. As shown in Fig. 1B, in the
absence of wild-type Tip60, no acetylated species of the AR was
detected (lane 1), whereas in the presence of wild-type
Tip60, the AR was clearly demonstrated to be in an acetylated form
(lane 3). In contrast, overexpression of
Tip60Q377E/G380E resulted in no change to the acetylation
status of the AR (compare lanes 5 and 1),
indicating that the HAT-defective Tip60 mutant is unable to acetylate
the AR. Together, the data provide evidence that Tip60 is capable of
directly acetylating the AR, and thus implicate Tip60 as a potential
FAT protein.
The HAT Activity of Tip60 and the KLKK Acetylation Motif of AR Are
Necessary for Tip60-mediated AR Up-regulation--
We next sought to
determine the functional significance of Tip60-mediated acetylation
upon AR activity. The demonstration that the HAT domain of PCAF is
important for up-regulating AR activity suggested that direct
PCAF-mediated acetylation is a requisite for full induction of AR
function (25). We therefore hypothesized that acetylation of the AR by
the HAT domain of Tip60 is necessary to enhance transcriptional
activity of the AR.
To test this, we compared the ability of wild-type Tip60 and a
HAT-defective mutant Tip60 to stimulate AR-mediated gene expression. COS-7 cells were transiently transfected with AR and wild-type Tip60 or Tip60Q377E/G380E, together with the pPSALuc
reporter that contains a 600-bp fragment of the androgen-responsive PSA
promoter sequence upstream from the luciferase gene. As
illustrated in Fig. 2B, in the
presence of the synthetic androgen R1881, wild-type Tip60
augmented AR-mediated reporter expression 4.5-fold, whereas
Tip60Q377E/G380E enhanced AR activity ~2-fold,
implicating the importance of the HAT activity of Tip60 for full
induction of the receptor. This result is in line with the previous
report that AR induction was compromised in the presence of a HAT
mutant of PCAF, which was suggested to be because of the failure for
complete AR acetylation (25). Therefore, we speculate that
Tip60-mediated AR acetylation contributes to the full induction of the
receptor.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 2.
Tip60-mediated AR acetylation is important
for up-regulating AR activity. A, schematic
representation of the domains of AR including: DBD, AF-1,
ligand-binding domain (LBD), hinge domain (HD),
and KLKK, acetylation motif. The acetylation motifs of the AR mutants
AR630 and AR632/633 are also shown.
B, the effect of a HAT-defective Tip60 mutant,
Tip60Q377E/G380E, on AR activity was examined in COS-7
cells. Briefly, 50 ng each of pcDNA3-AR and pCMV-Tip60 or
pCMV-Tip60Q377E/G380E were co-transfected together with 200 ng of pPSALuc and pCMV--gal reporters as indicated, in the presence
and absence of 10 nM R1881. After 48 h, cells were
harvested and assayed for luciferase activity and corrected for
-galactosidase activity to give relative luciferase activity.
C, to examine the effect of Tip60 on AR mutants
AR630 and AR632/633, 50 ng of pCMV-Tip60,
pcDNA3-AR, -AR630, and -AR632/633 were
transfected into COS-7 cells together with 200 ng of both pPSALuc and
pCMV--gal reporters per well, in the presence and absence of 10 nM R1881. Relative luciferase was determined as
above.
|
|
Edman degradation of a p300-acetylated AR fragment, containing residues
623-640, revealed that the AR was preferentially acetylated on three
lysine residues (Lys-630, Lys-632, and Lys-633) within the short
KLKK motif of the hinge domain (25) (Fig. 2A). Substitution of these amino acids with alanine abolished AR acetylation and abrogated p300- and PCAF-mediated enhancement of AR activity, further
strengthening the importance of direct acetylation for modulation of AR activity.
To confirm the importance of Tip60-mediated AR acetylation for
enhancement of AR transcriptional activity, we sought to determine the
effect of Tip60 upon two mutant AR proteins which, through the
substitution of lysine residues by alanine within the KLKK motif, do
not undergo full acetylation. Using AR630, which lacks the
Lys-630, and AR632/633, which lacks both Lys-632 and
Lys-633 (Fig. 2A), we figured that Tip60, like p300 and
PCAF, would fail to fully augment mutant AR-mediated gene expression
and thus further implicate Tip60-mediated acetylation as important for
AR induction. Briefly, wild-type AR and both AR mutants were
transfected into COS-7 cells with wild-type Tip60 together with the PSA
reporter, in the presence and absence of R1881. As shown in Fig.
2C, wild-type AR activity was activated 2-fold by R1881
(lane 2 versus lane 1), whereas both
AR630 and AR632/633 were relatively
unresponsive to androgen (lane 6 versus
5 and lane 10 versus 9), a
result in line with a previous report (25). As expected,
co-transfection of Tip60 augmented R1881-induced wild-type AR activity
from 2- to ~5-fold (lane 4 versus
2). In contrast, Tip60-mediated up-regulation of both
AR630 and AR632/633 was ~2-fold, indicating
that the two AR lysine mutants do not undergo full co-activation by
Tip60 (compare lanes 6 with 8 and lanes
10 with 12), a result similar to that previously found
for p300 and PCAF (25).
Together, these findings implicate Tip60-mediated AR acetylation as an
important step in up-regulating AR activity. Considering that Tip60
failed to enhance both AR mutants, which combined lack all three lysine
residues, we speculate that the HAT activity of Tip60 may target each
of the lysine residues of the KLKK sequence to generate the
hyperacetylated, active AR.
HDAC1 Specifically Down-regulates AR Activity--
The
demonstration that HDACs down-regulate the transcriptional activity of
numerous transcription factors, including MyoD (23) and p53 (22, 37),
implicate deacetylation as a mechanism of transcriptional regulation.
For example, the acetylated KSKK sequence of p53 is directly
deacetylated by the class I deacetylases, HDAC1, -2, and -3 (22).
Knowing that the AR is a direct target for acetylation, and shares a
similar acetylation motif to p53, we hypothesized that AR is a
potential target for HDAC activity. Indeed, the previous demonstration
that AR activity is greatly up-regulated by the HDAC inhibitor TSA was
the first evidence to suggest that AR activity may be effected, and
down-regulated by HDACs (25).
To assess the possibility of a role for HDACs in AR function, we
determined the effect of various HDACs on transcriptional activity of
the AR in reporter assays using the pPSALuc reporter. We figured that
using a natural androgen receptor-responsive promoter element within
the reporter, we would gain greater support to the notion that the
effects observed in this experiment may be physiologically important.
Briefly, members of both class I and II HDAC families were transiently
transfected into COS-7 cells, maintained in FCS-containing media, in
the absence and presence of AR, together with pPSALuc. As shown in Fig.
3A, in the absence of AR
(open bars), class I and class II HDACs showed variable effects upon basal promoter activity, with only HDAC1 failing to
influence basal reporter expression. It is interesting to note that
HDAC3, -5, and to a lesser extent -6, up-regulated luciferase expression in the absence of the AR. Although these proteins may influence recruitment of another promoter-binding protein thus leading
to a putative up-regulation of basal activity, it is likely to be an
artifact of protein overexpression in our transfection system.
View larger version (15K):
[in this window]
[in a new window]
|
Fig. 3.
HDAC1 represses AR-mediated
transactivation. A, the effect of class I and class II
HDACs on AR activity was assessed in transient transfection experiments
in COS-7 cells maintained in FCS-containing media. DNA included 50 ng
of each HDAC construct, 50 ng of pcDNA3-AR, and 200 ng each of the
reporters pPSALuc and pCMV--gal per well. Relative luciferase
activity was determined. B, cell extracts from A
were immunoblotted with a monoclonal anti-AR antibody to determine
relative protein levels of AR in each sample.
|
|
As expected, in the presence of AR (black bars), PSA
promoter activity was stimulated 5-fold over basal level in the absence of HDACs (compare lanes 1 and 7). In the presence
of HDAC1 and -2, AR activity was repressed 5- and 6-fold, respectively
(compare lanes 8 and 9 with 7),
suggesting a potential down-regulatory role for these two deacetylases
in AR-mediated transcription. Unlike HDAC1 however, the ability of
HDAC2 to repress basal promoter expression implicates an indirect role
for AR repression by HDAC2 and is likely to occur independently of the
AR. In the presence of HDAC5 and -6, AR activity was not effected,
whereas co-transfection of HDAC3 enhanced AR activity a further
1.6-fold. Overall, from the various deacetylases tested, the ability of
HDAC1 to down-regulate AR activity without effecting basal promoter
activity implicates HDAC1 as the sole repressor of AR activity upon the
PSA promoter.
To eliminate the possibility that relative levels of AR are effected
upon co-transfection of HDACs, therefore resulting in either reduced or
enhanced transcriptional activity, AR protein levels were determined
following transient transfection experiments performed above, using an
anti-AR antibody. As shown in Fig. 3B, AR protein levels in
both the presence and absence of the various transfected HDACs were
comparable, suggesting that variation in AR activity between the
different samples is not through changes to receptor protein levels.
The Histone Deacetylase Activity of HDAC1 Is Required for
Inhibition of AR Function--
Down-regulation of p53 and MyoD is
dependent upon the deacetylase activity of class I HDACs (22, 23, 37).
The demonstration that AR-mediated transcription is repressed by HDAC1
also suggests an involvement of the deacetylase function of HDAC1. To
test this, we incorporated deacetylase-defective mutant
HDAC1H141A into transient transfection experiments and
compared its effects upon AR against wild-type HDAC1.
As shown in Fig. 4A, reporter
activity was up-regulated ~5-fold in the presence of AR (lane
2 versus lane 1), whereas addition of wild-type HDAC1
resulted in an approximate 5-fold reduction in AR activity (lane
4 versus lane 2), without effecting basal promoter
expression (lane 1 versus lane 3).
HDAC1H141A stimulated basal reporter activity 3.5-fold
(compare lanes 1 and 5); an effect similar to
that observed with HDAC3 and HDAC5 (as shown in Fig. 3A). In
the presence of AR, HDAC1H141A failed to down-regulate
AR-mediated transactivation, but instead enhanced AR activity a further
2-fold (compare lanes 2 and 6). The inability of
the deacetylase-deficient mutant to repress AR-mediated reporter
expression therefore suggests that the deacetylase activity of HDAC1 is
required to down-regulate AR activity.
View larger version (10K):
[in this window]
[in a new window]
|
Fig. 4.
The deacetylase activity of HDAC1 is required
for AR repression. A, to determine the influence of
HDAC1-mediated deacetylase activity on down-regulation of AR activity,
the effect of the deacetylase-defective HDAC1 mutant,
HDAC1H141A, on the AR was compared with that of wild-type
HDAC1. COS-7 cells, maintained in FCS-containing media, were
transiently transfected with 50 ng of pcDNA3-AR, 50 ng of both
pJB5-HDAC1 and pJB5-HDAC1H141A, together with 200 ng of the
reporters pPSALuc and pCMV--gal per well. B, the
influence of TSA on HDAC1-mediated AR repression was assessed in
transient transfection experiments in COS-7 cells. DNA included 50 ng
of pcDNA3-AR and 50 ng of pJB5-HDAC1 or empty pCMV for control, and
200 ng of the two reporters pPSALuc and pCMV--gal per well. 12 hours
before cell harvesting, cells were incubated in FCS-containing media in
the presence and absence of 100 nM TSA. Relative luciferase
activity was determined as before.
|
|
The phenomenon of HDAC1H141A-mediated reporter enhancement
has also been reported in a similar study on the effects of
deacetylation upon MyoD (23). In this case, HDAC1H141A
increased both basal activity of the muscle creatine kinase promoter and the inherent activity of MyoD, suggesting that our result is not a
promoter-specific nor AR-specific artifact.
To confirm the above observation, we incorporated the histone
deacetylase inhibitor TSA into our transfection system containing both
wild-type AR and HDAC1 together with the pPSALuc reporter construct.
TSA has been demonstrated to reversibly repress enzymatic activity of
members of the two HDAC families and has been used extensively to
define the mechanism of action of numerous co-repressor molecules. We
figured that if the deacetylase activity of HDAC1 is a requisite for AR
repression, the addition of TSA should reverse HDAC1-mediated
down-regulation of AR function and induce AR activity.
Previous reports have shown that TSA causes AR hyperactivity, which is
suggested to be the result of the AR being in a hyperacetylated state
(25). As depicted in Fig. 4B, the addition of 100 nM TSA caused an approximate 13-fold increase in AR
activity confirming previous data. As before, in the presence of HDAC1,
AR activity was down-regulated ~5-fold (lane 2). Upon
addition of TSA, the repressive effect of HDAC1 was abolished,
resulting in a 13-fold increase in AR activity (lane 4),
comparable with the effect of TSA upon AR in the absence of HDAC1.
Together, these experiments indicate that inherent deacetylase activity
of HDAC1 is required for repression of AR-mediated transactivation.
HDAC1-mediated Down-regulation of AR Activity Is Dependent upon the
Ligand-binding Domain of AR--
We next sought to determine the
domain of AR required for HDAC1-mediated repression. Considering that
the acetylation motif of the AR is located within the hinge region,
between residues 630 and 633, and direct acetylation of the KLKK motif
by p300 and PCAF and potentially Tip60 (25) is deemed important for AR-mediated transcriptional activation, we hypothesized that HDAC1 could function through this region to induce AR down-regulation. To
test this, we tethered a Gal4-DBD fusion containing both DBD and the
ligand-binding domain of the AR (Gal4-AR-DS), encompassing the KLKK
acetylation site, to a Gal4-responsive reporter (UASTKLuc) and tested
the effects of HDAC1 upon inherent transcriptional activity of the
truncated receptor in FCS-containing media.
As shown in Fig. 5, in the absence of
AR-DS (AR), both HDAC1 and HDAC1H141A showed minimal
effects upon basal UASTKLuc reporter activity (lane 1 versus 2 and 3). Tethering Gal4-AR-DS
to the UASTKLuc reporter (+AR-DS) resulted in a 2.5-fold induction of
transcriptional activity (lane 4), indicating that the
C-terminal portion of the AR, which contains the weakly active AF-2,
retains the capacity to modulate gene expression. In the presence of
HDAC1, but not the deacetylase defective HDAC1H141A mutant,
Gal4-AR-DS activity was down-regulated to near basal level (lanes
5 and 6), suggesting that HDAC1 acts through the C-terminal DS domain to repress AR activity. The failure of
HDAC1H141A to down-regulate AR-DS implies that the
deacetylase activity of HDAC1 is necessary for repression.
View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5.
The DBD and ligand-binding domain of AR are
required for HDAC1-mediated AR transcriptional inhibition. To
define the target site for HDAC1 action within AR, we incorporated a
Gal4DBD-AR fusion containing a fragment of AR, encompassing both DBD
and ligand-binding domain (AR-DS), into transient
transfection experiments in COS-7 cells maintained in FCS-containing
media, and tested the influence of HDAC1 compared with
HDAC1H141A on AR activity. DNA comprised 50 ng each of
pJB5-HDAC1, -HDAC1H141A, and pM-AR-DS (encoding the
Gal4DBD-AR-DS fusion) together with 200 ng of both the Gal4-responsive
UASTKLuc reporter and pCMV--gal reporter, per well. Relative
luciferase activity was determined.
|
|
HDAC1 Interacts with the AR in Vivo and in Vitro--
Following
the above demonstration that HDAC1 functions through the
DNA-binding/steroid-binding domains of the receptor, we next examined,
using the mammalian two-hybrid system, the potential of an HDAC1-AR
interaction. COS-7 cells were transiently transfected with the UASTKLuc
reporter together with Gal4-AR-DS and VP16AD-HDAC1, which contains
HDAC1 fused downstream from the VP16 activation domain. For positive
control, we incorporated the AR-DS interacting protein Tip60, as a
VP16AD fusion protein, into our experiment. To maintain consistency
between our experiments, and the fact that we have shown HDAC1 to
repress AR activity in COS-7 cells maintained in FCS-containing media,
we performed mammalian two-hybrid analysis under the same conditions.
One concern in this experiment is the potential of HDAC1 to repress
inherent activity of the acidic transcriptional activator VP16AD,
thereby reducing reporter expression, even in the presence of a strong
interaction between AR and HDAC1. However, it has been previously
demonstrated that HDAC1 does not actively repress the activity of
Gal4-VP16 (30), and thus we speculate that the values obtained are
indicative of the avidity of interaction between AR-DS and HDAC1.
As illustrated in Fig. 6A,
co-transfection of VP16AD-HDAC1 and Gal4-AR-DS resulted in a 3-fold
increase in promoter activity over basal levels. Similarly,
co-transfection of the positive control VP16AD-Tip60 with Gal4-AR-DS
increased promoter activity ~3-fold over basal promoter activity.
This finding indicates that HDAC1 interacts with the DS domain of AR to
levels equivalent to Tip60.
View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
AR and HDAC1 interact in vivo
and in vitro. A, using the
mammalian two-hybrid system, the potential of an AR-HDAC1 interaction
was investigated. COS-7 cells were transfected with 50 ng of pM-AR-DS
and 50 ng of the VP16AD fusion constructs pVP16AD-HDAC1, -Tip60, or
empty pVP16AD for control, as well as 200 ng of UASTKLuc and
pCMV--gal per well. Relative luciferase activity was determined.
B, COS-7 cells were transiently transfected with 2 µg of
pcDNA3-AR and pJB5-FLAG-HDAC1 per 90-mm dish. Cell lysates were
immunoprecipitated (IP) with an anti-FLAG antibody and
immunoblotted with an anti-AR antibody. WB, Western
blot.
|
|
To further investigate the interaction between the AR and HDAC1, COS-7
cells transiently transfected with full-length AR and FLAG-tagged HDAC1
were immunoprecipitated with an anti-FLAG antibody and then
immunoblotted with an anti-AR antibody to detect potential AR·HDAC1 complexes. As shown in Fig. 6B,
co-transfection of HDAC1 and AR resulted in immunoprecipitation of the
AR (lane 1), whereas in the presence of AR alone, no AR was
immunoprecipitated (lane 3), indicating that the interaction
between HDAC1 and AR is specific to transfected HDAC1 and AR. Together,
the data suggest that AR and HDAC1 interact, but whether the
interaction is direct remains to be addressed.
The HAT Activity of Tip60 Abrogates the Repressive Effects of HDAC1
upon the AR--
Because Tip60 and HDAC1 act to induce antagonistic
effects upon AR-mediated transcription, we asked whether variation in
the relative levels of these proteins influences the activity of the AR. Furthermore, to ascertain a role for acetylation/deacetylation in
AR regulation, we incorporated increasing amounts of the HAT-defective Tip60 mutant, Tip60Q377E/G380E, into our system. We
hypothesized that whereas increasing amounts of wild-type Tip60 may
overcome HDAC1-mediated repression through catalyzing AR
hyperacetylation, Tip60Q377E/G380E may be unable to reverse
the effects of HDAC1 and thus implicate a potential role for
deacetylation in AR silencing. COS-7 cells were transfected with HDAC1
and increasing amounts of either wild-type Tip60 or
Tip60Q377E/G380E, together with wild-type AR and pPSALuc
(Fig. 7). As expected, HDAC1 repressed AR
activity ~3.5-fold (compare lanes 2 and 3). Co-transfection of 25 ng of wild-type Tip60 caused a negligible increase in AR-mediated transcription (lane 4), whereas
transfection of 50 and 100 ng of Tip60 completely de-repressed the
effects of HDAC1, reactivating the AR 3-fold over basal levels (compare lanes 5 and 6 with 1), indicating that
increasing amounts of Tip60 can compete and overcome the effects of
HDAC1. Unlike wild-type Tip60, however, increasing amounts of the
HAT-defective Tip60 mutant failed to counteract the inhibitory effect
of HDAC1 (compare lanes 7-9 with 3), implicating
a role for acetylation in overcoming HDAC1 activity. Moreover,
considering that the HAT activity of Tip60 is a requisite for
abolishing HDAC1 activity, it is interesting to speculate that HDAC1
represses AR activity via direct deacetylation of the receptor.
View larger version (12K):
[in this window]
[in a new window]
|
Fig. 7.
The HAT activity of Tip60 de-represses
HDAC1-mediated AR down-regulation. To determine whether the HAT
activity of Tip60 can reverse the effects of HDAC1 upon the AR,
increasing amounts of either Tip60 or Tip60Q377E/G380E were
co-transfected into COS-7 cells maintained in full media, in the
presence of a fixed amount of HDAC1. DNA included 50 ng of
pcDNA3-AR and pJB5-HDAC1, and 25-100 ng of pCMV-Tip60 and
-Tip60Q377E/G380E, together with 200 ng of pPSALuc and
pCMV--gal reporters per well. Relative luciferase activity was
determined.
|
|
HDAC1 and Tip60 Associate with the Endogenous PSA Promoter in LNCaP
Cells--
The finding that Tip60 and HDAC1 both bind AR and induce
antagonistic effects upon the AR in reporter assays may suggest a role
for these molecules in regulation of AR activity in the natural context. The recruitment of co-activators and co-repressors to target
genes by various transcription factors has been shown to be a mechanism
for controlling transcriptional activity. We therefore figured that the
AR may also have the potential to recruit both positive and negative
regulating factors to responsive genes as a mechanism of
transcriptional regulation.
To assess this, we used chromatin immunoprecipitation assays in
AR-expressing LNCaP prostate cancer cells, incorporating antibodies specific for the AR, HDAC1, and Tip60, to examine the association of
these proteins with the AR-responsive PSA promoter in the presence and
absence of androgen (Fig. 8). A 20-min
exposure of cells to androgen induced robust recruitment of endogenous
AR to the PSA promoter (Fig. 8B, a, compare
lanes 1 and 2) indicating that the AR, which we
speculate is in an active state, rapidly associates with the target
gene. Surprisingly, using anti-Tip60 and anti-HDAC1 antibodies, we
detected a similar increase in promoter association of both Tip60 and
HDAC1 20 min after hormone treatment (compare lanes 1 and
2 in Fig. 8B, b and
c), suggesting that the two antagonists are recruited to the
promoter within the same time interval. The correlation between AR and
both Tip60 and HDAC1 for chromatin binding also implicates a potential
role for these two proteins in regulation of AR activity. However,
whether the proteins are active at the time of recruitment to the
promoter will need to be addressed.
View larger version (18K):
[in this window]
[in a new window]
|
Fig. 8.
HDAC1 and Tip60 associate with AR on the PSA
gene promoter under different hormone-induced states. To determine
whether HDAC1 and Tip60 complexed with AR upon the PSA promoter in
LNCaP cells, chromatin immunoprecipitation assays were performed.
A, schematic representation of a fragment of the PSA
promoter element containing androgen responsive element 2 (ARE2). Labeled arrows above and below
the PSA promoter represent primer annealing sites, and bars
and numbers indicate the length of PCR product.
B, soluble chromatin extracts from LNCaP cells treated with
or without 10 nM R1881 were immunoprecipitated with
antibodies against AR, HDAC1, and Tip60 followed by semiquantitative
PCR incorporating primers specific for ARE2 in the PSA promoter. Input
samples containing crude chromatin extracts prior to
immunoprecipitation were also analyzed. C, to examine if
HDAC1 down-regulated endogenous AR activity in LNCaP cells, transient
transfection experiments were performed. DNA included 200 ng of
pJB5-HDAC1 and 800 ng of the two reporters pPSALuc and pCMV--gal per
well. Cells were maintained in FCS-containing media for 72 h prior
to harvesting. Relative luciferase activity was determined.
|
|
The previous finding that Tip60 up-regulates the activity of endogenous
AR in LNCaP cells (28) suggests that the recruitment of Tip60 to the
AR-responsive promoter may be a mechanism for increasing AR
transcriptional activity. However, the ability for HDAC1 to associate
with the AR, at a time which sees an increase in Tip60 recruitment,
suggests that it may act to down-regulate AR activity, and thus
potentially antagonize Tip60 function. This prompted us to investigate
whether HDAC1 could repress endogenous AR activity in LNCaP cells using
transient transfection experiments. Briefly, cells maintained in
FCS-containing media were transfected with HDAC1, or empty pCMV vector
for control, together with the pPSALuc reporter. As shown in Fig.
8C, overexpression of HDAC1 resulted in an almost 50%
reduction in endogenous AR activity (compare lanes 1 and
2), implying that HDAC1 has the potential to down-regulate
AR-mediated transactivation in LNCaP cells. Together, the ability for
Tip60 and HDAC1 to both associate with the PSA promoter and cause
opposing effects upon the activity of the endogenous AR is indicative
of a role for these proteins in controlling the activity of the AR in
androgen-responsive prostate cells.
| |
DISCUSSION |
Direct co-activator-mediated acetylation of numerous transcription
factors has emerged as a major determinant in regulating transcriptional activity, akin to the role of phosphorylation in signal
transduction cascades. Whereas acetylation has been linked to
increasing transcriptional activity of targeted transcription factors,
deacetylation has been implicated as a mechanism of transcription factor down-regulation. The data presented here provides evidence that
Tip60 and HDAC1 are directly involved in the regulation of AR-mediated
gene expression by inducing potential changes to the acetylation status
of the AR. Tip60 directly acetylates the AR, which we show is necessary
for up-regulating AR activity, whereas HDAC1 down-regulates the AR
transcriptional response potentially through direct deacetylation.
Previous experiments showed that both p300 and PCAF acetylated the AR
on three lysine residues, Lys-630, Lys-632, and Lys-633 (25).
Acetylation of these amino acids induced an increase in inherent
transcriptional activity of the AR. The demonstration that Tip60 also
directly acetylates the AR in vivo, via inherent FAT
activity (Fig. 1), indicates that the AR is a common target for
co-activator-mediated acetylation. The failure of Tip60 to fully
modulate AR630 and AR632/633 activity may
suggest that Tip60 acetylates all three lysine residues within the KLKK
motif. The finding that Tip60 associates with the hormone-bound, active
AR upon the endogenous PSA promoter (Fig. 8), combined with the fact that we have identified Tip60 as a class I nuclear hormone
receptor-specific co-activator (29), may implicate an important role
for Tip60 in acetylation and activation of the AR in the physiological
context. It is intriguing that whereas Tip60, p300, and PCAF each
likely acetylate Lys-630, Lys-632, and Lys-633 of the AR, they do not share similar substrate specificities for histone acetylation. Indeed
Tip60 directly acetylates nucleosomal DNA on histone H4 (35), whereas
p300 readily acetylates all four histones (15). We speculate that
although each of the co-activators directly acetylate the AR to
up-regulate activity in reporter assays, variation in histone substrate
specificity between Tip60, p300, and PCAF may also aid in regulation of
AR activity in the cell.
The finding that Tip60 directly acetylates the AR implicates Tip60 as
one of a small subset of proteins, including PCAF and p300/CBP, capable
of eliciting FAT activity upon a wide array of transcription factor
targets. The small number of FAT proteins and the failure for other
acetylases, such as members of the p160 family of co-activators,
including SRC-1 and GRIP-1, to mediate acetylation of transcription
factors is intriguing. Direct acetylation of target proteins is
seemingly an initial event in transcription factor activation that
precedes the subsequent binding of non-FAT acetylases, such as SRC-1
and GRIP-1, which act to increase transcription by eliciting histone
acetylation. It may be that having a small number of potential
co-initiator proteins, including p300/CBP, PCAF, and Tip60, serves to
reduce the potential for other acetylase proteins to enhance
transactivation of certain transcription factors and thus prevents
spurious transcription factor-mediated gene expression.
Our studies identify the AR as the first FAT target for Tip60, however,
the ability for Tip60 to enhance transcriptional activity of both
estrogen and progesterone receptors to levels similar to AR (28),
implicates a potential role for Tip60-mediated FAT activity upon these
two nuclear hormone receptors, and may suggest an involvement of
Tip60-mediated acetylation in diverse signaling mechanisms. Indeed, the
recent demonstration that the HAT activity of Tip60 is required for
stimulating UV irradiation-induced apoptosis in HeLa cells potentially
broadens the spectrum of proteins targeted for acetylation by Tip60
(35).
A better understanding of AR down-regulation came with the observation
that HDAC1 specifically represses AR activity without effecting AR
protein levels (Fig. 3). Our results indicate the importance of the
deacetylase activity of HDAC1 for AR inhibition (Fig. 4) and suggest
that HDAC1-mediated effects are potentially through direct
deacetylation of the receptor (Fig. 7). Importantly, the demonstration
that HDAC1 interacts with and inhibits the inherent activity of the
DNA-binding and ligand-binding domains of the AR, which encompass the
KLKK acetylation motif (Figs. 5 and 6), suggests that HDAC1 influences
AR activity by binding to the AR. Whether the AR-HDAC1 interaction is
direct or requires the assistance of one of a number of
HDAC1-associated proteins, such as Sin3, remains to be determined.
However, recent evidence shows that HDAC1 has the capacity to interact
directly with both p53 and MyoD, without the presence of intermediary
proteins (22, 23). Considering that the AR shares a similar acetylation
sequence to p53, which is targeted by HDAC1, we hypothesize that HDAC1 recognizes and interacts directly with the AR, to reduce receptor activity, in a manner similar to that of p53.
Previous work has suggested that, unlike co-activator proteins,
deacetylase enzymes exhibit minimal substrate specificity. The
demonstration that p53 is repressed by HDAC1-3 upon the p53-responsive BAX promoter implicated redundancy in function between the three members of the class I HDAC family (22). However, our findings suggest
otherwise, with both HDAC2 and -3, as well as the class II HDACs,
failing to effect AR activity upon the AR-responsive PSA promoter. We
hypothesize that like co-activator proteins, HDACs have a limited
substrate specificity which is controlled by various determinants
within target proteins, such as residues flanking the acetylation motif
and/or the position of the target site within the substrate protein.
Mechanisms for AR down-regulation are as yet, poorly defined. Whereas
the effect of receptor degradation on AR-mediated gene expression
remains to be clarified, nuclear export of the active AR constitutes
one mechanism for down-regulating the androgenic response. However,
recent evidence has suggested that this process is only evident after
12 h in the absence of hormone (38), suggesting that it is
unlikely to be the definitive mechanism for AR down-regulation in
real-time. The ability of HDAC1 to repress AR activity indicates a
novel mechanism for down-regulating AR-mediated transcription, which we
speculate constitutes a more rapid mechanism for controlling the
androgenic response. Indeed, the ability of HDAC1 to rapidly associate
with the endogenous PSA promoter, which correlates with the recruitment
of the AR to the promoter (Fig. 8B), suggests that HDAC1 has
the potential to down-regulate AR activity early in the transcriptional
process. The failure for HDAC1 to reduce AR protein levels (Fig.
3B), combined with the ability of HDAC1 to down-regulate
endogenous AR activity in LNCaP cells (Fig. 8C), implicates
a role for HDAC1 in an acute and reversible mechanism for AR
repression. We speculate that HDAC1-mediated deacetylation of the AR
results in the generation of an inactive AR which has the capacity to
be reactivated upon further ligand exposure and acetylation. Indeed,
the demonstration that the AR undergoes both numerous cycles of
activation and inactivation together with the respective
nuclear-cytoplasmic shuttling, before succumbing to proteosomal
degradation (38), suggests that a mechanism of transient AR
inactivation exists. Although these authors proposed that hormone inactivation or degradation may result in the transient deactivation of
AR activity prior to receptor export from the nucleus, we suggest a
role for HDAC1 in this system as changes to the acetylation status of
the AR is a dominant factor in AR transcriptional activity.
The observations that HDAC1 and Tip60 have the potential to interact
with the AR and are both associated with the AR-bound PSA promoter
within the same time interval is suggestive of the existence of a
trimeric complex containing the AR, Tip60, and HDAC1 upon the PSA
promoter. The presence of both an acetylase and a deacetylase upon the
same promoter was intriguing considering that they act to oppose the
funcion of each other. Indeed, the demonstration that the HAT activity
of Tip60 abrogated HDAC1-mediated repression of AR activity (Fig. 7)
indicates competition between the two proteins; each sharing the
ability to counteract the effect of the other upon the AR, potentially
via acetylation and deacetylation. However, the recent demonstration
that glucocorticoid receptor interacts with both p300/CBP and HDAC2 to
repress p65-mediated granulocyte-macrophage colony-stimulating factor
expression (39) suggests that the presence of antagonistically
functioning proteins within the same complex is not uncommon and may
arise to finely tune the transcriptional response. Also, the recent
finding that both Tip60 and the class II HDAC, HDAC7, interact with the
endothelin receptor, ETA (40), provides greater evidence that a
co-activator and deacetylase protein can co-interact with a target
protein. We speculate that the presence of HDAC1 on the promoter at the onset of the androgenic response may act to overcome or reduce Tip60-mediated effects upon the receptor and thus maintain the AR in a
semiactive state, thereby preventing excessive androgen-responsive gene expression.
In summary, the results suggest the existence of a reversible and rapid
mechanism for regulating AR activity that does not involve a reduction
in AR protein levels: Tip60-mediated acetylation of the AR up-regulates
the transcriptional response, whereas down-regulation of
transcriptional activity occurs as a result of HDAC1, potentially via
deacetylation of the AR. The ability of Tip60 to counteract the
activity of HDAC1 suggests that the acetylation status of the AR is a
dominant factor in AR functioning, and variation to the levels of FAT
proteins and HDAC1 may give rise to fluctuating AR activity. Further
investigation may focus upon the relative levels of these proteins in
different stages of prostate cancer to identify if changes to the flux
of acetylation and deacetylation of the AR exerts an influence upon
cellular transformation.
TOP
ABSTRACT
INTRODUCTION
To whom all correspondence should be addressed. Tel.:
44-191-222-7076; Fax: 44-191-222-8514; E-mail:
c.n.robson@ncl.ac.uk.
