HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 29, 26089-26097, July 19, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/29/26089    most recent M203997200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Muoio, D. M. Articles by Kraus, W. E. Search for Related Content PubMed PubMed Citation Articles by Muoio, D. M. Articles by Kraus, W. E. Social Bookmarking                      What's this?

Fatty Acid Homeostasis and Induction of Lipid Regulatory Genes in Skeletal Muscles of Peroxisome Proliferator-activated Receptor (PPAR)  Knock-out Mice

EVIDENCE FOR COMPENSATORY REGULATION BY PPAR^*

Deborah M. Muoio^§, Paul S. MacLean^¶, David B. Lang^¶, Shi Li, Joseph A. Houmard^¶, James M. Way, Deborah A. Winegar, J. Christopher Corton^**, G. Lynis Dohm^¶, and William E. Kraus

From the  Departments of Medicine and Cell Biology, Duke University Medical Center, Durham, North Carolina 27710, the ^¶ Department of Biochemistry and the Human Performance Laboratory, East Carolina University, Greenville, North Carolina 27858, the  Departments of Metabolic Diseases and Nuclear Receptor Biology, GlaxoSmithKline, Research Triangle Park, North Carolina 27709, and the ^** Chemical Industry Institute of Toxicology Centers for Health Research, Research Triangle Park, North Carolina 27709

Received for publication, April 24, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Ablation of peroxisome proliferator activated receptor (PPAR) , a lipid-activated transcription factor that regulates expression of -oxidative genes, results in profound metabolic abnormalities in liver and heart. In the present study we used PPAR knockout (KO) mice to determine whether this transcription factor is essential for regulating fuel metabolism in skeletal muscle. When animals were challenged with exhaustive exercise or starvation, KO mice exhibited lower serum levels of glucose, lactate, and ketones and higher nonesterified fatty acids than wild type (WT) littermates. During exercise, KO mice exhausted earlier than WT and exhibited greater rates of glycogen depletion in liver but not skeletal muscle. Fatty acid oxidative capacity was similar between muscles of WT and KO when animals were fed and only 28% lower in KO muscles when animals were starved. Exercise-induced regulation and starvation-induced regulation of pyruvate-dehydrogenase kinase 4 and uncoupling protein 3, two classical and robustly responsive PPAR target genes, were similar between WT and KO in skeletal muscle but markedly different between genotypes in heart. Real time quantitative PCR analyses showed that unlike in liver and heart, in mouse skeletal muscle PPAR is severalfold more abundant than either PPAR or PPAR. In both human and rodent myocytes, the highly selective PPAR agonist GW742 increased fatty acid oxidation about 2-fold and induced expression of several lipid regulatory genes, including pyruvate-dehydrogenase kinase 4 and uncoupling protein 3, responses that were similar to those elicited by the PPAR agonist GW647. These results show redundancy in the functions of PPARs  and  as transcriptional regulators of fatty acid homeostasis and suggest that in skeletal muscle high levels of the -subtype can compensate for deficiency of PPAR.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Peroxisome proliferator activated receptors (PPARs)¹ , , and  comprise a family of nuclear hormone receptors that regulate systemic fatty acid metabolism via ligand-dependent transcriptional activation of target genes (1). Strong evidence indicates that their endogenous ligands consist of fatty acids and/or lipid metabolites and that they function to mediate adaptive metabolic responses to changes in systemic fuel availability (1, 2). PPAR, which is expressed most abundantly in tissues that are characterized by high rates of fatty acid oxidation (FAO), is considered the primary subtype that mediates lipid-induced activation of FAO genes (3). This premise is based largely on studies of PPAR knockout (KO) mice, which, compared with wild type (WT) littermates, exhibit low rates of -oxidation and abnormal accumulation of neutral lipids in both cardiac and hepatic tissues (4, 5). The metabolic phenotype of KO mice is associated with decreased expression of FAO genes and failure of liver and heart to induce -oxidative pathways in response to physiological or pharmacological perturbations in lipid metabolism (4-6). Taken together, these studies indicate that, at least in rodents, PPAR plays an essential role in maintaining lipid homeostasis in liver and heart by modulating both constitutive and inducible expression of genes that regulate fatty acid catabolism.

Skeletal muscle is also a major site of fatty acid catabolism in mammals. Similar to other oxidative organs, mRNA expression of muscle genes that promote selective utilization of lipid substrates is augmented during physiological states that are associated with increased systemic delivery of free fatty acids, such as exercise and starvation (7-10). Furthermore, many of these same muscle genes are also up-regulated by in vivo administration of PPAR-selective drugs (11, 12), prompting widespread speculation that fatty acid-induced activation of PPAR plays a critical role in mediating the adaptive response of muscle to starvation and exercise. PPAR protein expression is increased by exercise training (13, 14) and induced during myocyte differentiation, coincident with increased -oxidative capacity (15). Additionally, we recently showed that PPAR regulates fatty acid utilization and mRNA expression of several FAO genes in primary human skeletal muscle cells (HSkMC) (15).

We hypothesized that deficiency of PPAR might have profound consequences on skeletal muscle fuel metabolism and gene regulation. Pyruvate-dehydrogenase kinase 4 (PDHK4) and uncoupling protein 3 (UCP3) represent two muscle target genes that are robustly induced by PPAR agonists (11, 12), starvation (8, 10), and exercise (7, 9) and that are proposed to play key roles in mediating adaptive adjustments in muscle substrate selection. To investigate the requirement for PPAR in regulating muscle fatty acid metabolism and transcriptional activation of PDHK4 and UCP3, we evaluated metabolic and gene regulatory responses to 24 h of starvation and endurance exercise, as well as in vitro FAO, in muscles from PPAR KO mice and WT littermates. Contrary to our hypothesis, here we report that skeletal muscles from KO mice exhibited only minor changes in fatty acid homeostasis and, moreover, that neither constitutive nor inducible mRNA expression of known PPAR target genes was negatively affected by its absence. We also found that skeletal muscle expressed high levels of PPAR and that in both rodent and human skeletal muscle cells, activation of the -subtype increased FAO as well as mRNA levels of several classical PPAR target genes. These results, which are the first to show significant overlap in the functions of PPARs  and , indicate that both subtypes play important roles in mediating lipid-induced regulation of -oxidative pathways. We propose that high levels of PPAR might compensate for the lack of PPAR in the skeletal muscles of KO mice.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Bovine serum albumin, carnitine, and sodium oleate were from Sigma. Fetal bovine serum and Hanks' balanced salt solution were from Invitrogen. Heat-inactivated horse serum was from Hyclone (Logan, UT). Dulbecco's low glucose modified Eagle's medium was from Invitrogen. Human skeletal muscle cell SingleQuots® were from BioWhittaker Inc. (Walkersville, MD). Biocoat® tissue culture plates were from BD PharMingen. PCR reagents were from PerkinElmer Life Sciences. GW742, GW647, and GW929 were obtained from Dr. Peter Brown at GlaxoSmithKline (16, 17).

Animals-- All of the protocols were approved by the Institutional Animal Care and Use Committee at East Carolina University. 4-5-month-old female homozygous PPAR KO mice and aged matched WT littermates on an SV/129 background were obtained from a colony maintained at the Chemical Industry Institute of Toxicology (Research Triangle Park, NC). The original breeding pairs were obtained from Dr. F. Gonzalez (National Institutes of Health, Bethesda, MD) (18). The animals were housed under controlled temperature and lighting (20-22 °C; 12-h light-dark cycle) with free access to food and water. For starvation experiments, the food was removed at 10:00 a.m. the morning prior to collection of blood and tissue samples, which were harvested 24 h later along with samples from fed/rested and exercised mice.

Exercise Protocol-- The mice were accustomed to the treadmill (Stanhope SAT 2000) with 5-min bouts of mild exercise (8 m/min) on three consecutive days prior to the experiment. The exercise test consisted of an incremental treadmill regimen during which mice ran at 10 m/min for the first 60 min. The speed was then increased 0.75 m/min at 15-min intervals, up to 13 m/min at 2 h. Mice in the 2-h exercise group were removed and immediately sacrificed for tissue and blood collection. The remaining mice continued running, and the treadmill speed was increased 1.0 m/min at 15-min intervals until the animals could no longer sustain the exercise. The exhausted mice were removed and immediately sacrificed for tissue and blood collection.

In Vitro Fatty Acid Oxidation Studies-- Intact soleus and extensor digitorum longus muscles from the fed mice were removed between 9:00 and 11:00 a.m. under anesthesia (100 mg/kg ketamine and 10 mg/kg xylazine), cleaned free of adipose and connective tissue, and added to 1.0 ml of a modified Krebs-Ringer bicarbonate buffer containing 1.0 mM [1-¹⁴C]oleate (1.0 µCi/ml), 1.0 mM carnitine, and 1.0% bovine serum albumin as described previously (19). After 90 min the incubation medium was transferred to new dishes, and the oleate oxidation rates (nmol/mg muscle weight/h) were determined by measuring production of ¹⁴C-labeled acid-soluble metabolites (ASM), a measure of tricarboxylic acid cycle intermediates and acetyl esters (incomplete oxidation) (20), and [¹⁴C]CO₂ (complete oxidation) trapped in 200 µl of 1 N sodium hydroxide using a modified 48-well microtiter plate (Costar, Cambridge, MA) (21).

Mixed gastrocnemius muscles were removed from mice that were fed or starved for 24 h. Approximately 90 mg of tissue was minced thoroughly with scissors in 300 µl of a modified sucrose-EDTA medium containing 250 mM sucrose, 1 mM EDTA, 10 mM Tris-HCl, pH 7.4, as described previously (22). The reactions were initiated by adding 40 µl of whole homogenates to 160 µl of the incubation buffer, pH 7.4, yielding final concentrations of 0.2 mM oleate ([1-¹⁴C]oleate at 0.5 µCi/ml), 100 mM sucrose, 10 mM Tris-HCl, 5 mM potassium phosphate, 80 mM potassium chloride, 1 mM magnesium chloride, 2 mM L-carnitine, 0.1 mM malate, 2 mM ATP, 0.05 mM coenzyme A, 1 mM dithiothreitol, 0.2 mM EDTA, and 0.5% bovine serum albumin. After 60 min at 37 °C, the reactions were terminated by adding 50 µl of 70% perchloric acid. The CO₂ and ASM produced during the incubation were measured as described previously (21).

Northern Analyses-- RNA was isolated from quick frozen muscle samples using the TRIzol (Invitrogen) reagent according to the manufacturer's instructions as described previously (23). Total RNA (10 µg/sample) was fractionated on a 1.25% agarose, 2 M formaldehyde gel and then electrotransferred to a Hybond N1 membrane (Amersham Biosciences). Following UV cross-linking, the filters were prehybridized for 30 min at 68 °C in ExpressHyb (CLONTECH Laboratories, Inc., Palo Alto, CA) and then hybridized 2 h at 68 °C in Express Hyb buffer with random primed [-³²P]dATP-labeled cDNA probes for PDHK4 (24) or UCP3 (9) synthesized with Strip-EZ DNA kit (Ambion, Austin, TX) and purified with a G-50 Nick column (Amersham Biosciences). After stripping and prehybridization, the blots were then hybridized sequentially with glyceraldehyde-3-phosphate dehydrogenase and -actin for normalization. The Northern blots were visualized with a PhosphorImager and quantified with Imagequant software (Molecular Dynamics, Sunnyvale, CA).

Cultures of Primary Human Skeletal Muscle Cells and Rat L6 Cells-- Protocols for use of human specimens were approved by the Institutional Review Board at East Carolina University. Muscle samples weighing ~50 mg were obtained from vastus lateralis by needle biopsy and immediately transferred to ice-cold Dulbecco's modified Eagle's medium and cleaned free of adipose and connective tissues. Satellite cells were isolated by trypsin digestion (25) preplated for 1-3 h in 3.0 ml of growth medium (15) on an uncoated T-25 tissue culture flask to remove fibroblasts and then transferred to a type I collagen-coated T25 flask for attachment. Myoblasts were grown at 37 °C in a humidified atmosphere of 5% CO₂ and subcultured onto 6-, 12-, and 24-well type I collagen-coated plates as described previously (15). When HSkMC reached 80-90% confluence, differentiation was induced by changing to low serum differentiation medium (DFM; Dulbecco's modified Eagle's medium, 2% horse serum, 4.0 mM glutamine, 50 mg/ml gentamycin) (15). The medium was changed every 2 days, and PPAR-selective compounds or Me₂SO vehicle (0.1% v/v) were added to mature myotubes for 48 h on days 6-7. GW647 (16) and GW742 (a close analog of GW501516 (17) with equivalent activity) exhibit 1000-fold selectivity for PPARs  and , respectively. Day 8 myotubes were harvested in 1.0 ml of TRIzol reagent for RNA extraction.

Early passages of rat L6 myoblasts (CRL-1458) from the American Tissue Culture Collection (Manassas, VA) were grown in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 4.0 mM glutamine, and 50 mg/ml gentamycin in a humidified incubator at 37 °C with 5% CO₂. The myoblasts were grown on 100-mm dishes to 50-60% confluence and then subcultured onto 6- and 24-well plates for experiments. When the cells were 70% confluent, they were induced to differentiate into myotubes by changing to low serum DFM. By day 6, the cells were fully confluent and had differentiated into multinucleated, contracting myotubes. Day 8 myotubes were treated for 48 h with vehicle and PPAR-selective compounds and then harvested as described for HSkMC.

Determination of Fatty Acid Oxidation in Cultured Myocytes-- Following treatments with vehicle or PPAR-selective compounds, the myotubes were incubated at 37 °C in sealed 12- or 24-well plates containing 500 or 750 µl of DFM plus 12.5 mM HEPES, 0.25% bovine serum albumin, 1.0 mM carnitine, 100 µM sodium oleate, 50 µg/ml gentamycin, and 1.0 µCi/ml [¹⁴C]oleate (PerkinElmer Life Sciences ). After 3 h the incubation medium was transferred to new dishes and assayed for labeled oxidation products (CO₂ and ASM) (21). The cells were placed on ice, washed twice with phosphate-buffered saline, scraped into a 1.5-ml Eppendorf tube in two additions of 0.30 ml of 0.05% SDS lysis buffer, and then stored at 80 °C. All of the assays were performed in triplicate.

Real Time Quantitative PCR-- Total RNA was prepared using the TRIzol reagent, treated with DNase I (Ambion) and quantified using the RiboGreen® RNA quantitation kit (Molecular Probes, Eugene, OR). RTQ-PCR was performed using an ABI PRISM 7700 sequence detection system instrument and software (PerkinElmer Life Sciences). Primer/probe sets were designed using the manufacturer's software and the sequences available in the GenBank^TM data base. The sequences for the rat genes were: CPT1, F: GCTTATTAAGAACACGAGCCAACAA, R: AGTTTGCGGCGATACATGATC, P: TTGGGAAACACCGTTCACGCCA; PDHK4, F: TCTAACGTCGCCAGAATTAAAGC, R: GGAACGTACACGATGTGGATTG, P: ACACAAGTCAATGGAAAATTTCCAGGCCAA; UCP3, F: TGGCCTCCCCAGTGGAT, R: GGGCTTCGGTACCTGCCT, P: TAAAGACCCGATACATGAACGCTCCC. The sequences for the mouse genes were: PPAR, F: ACGATGCTGTCCTCCTTGATG, R: GTGTGATAAAGCCATTGCCGT, P: ACAAAGACGGGATGCTGATCGCG; PPAR, F: GCTGCTGCAGAAGATGGCA, R: CACTGCATCATCTGGGCATG, P: ACCTGCGGCAGCTGGTCACTGA; PPAR, F: CCATTCTGGCCCACCAAC, R: AATGCGAGTGGTCTTCCATCA, P: TCGGAATCAGCTCTGTGGACCTCTCC. The sequences used for analysis of human genes were published previously (15). RNA samples were normalized for comparison by determining 18 S rRNA levels by RTQ-PCR. PPAR subtype expression in mouse tissues was analyzed by generating six-point serial standard curves using total RNA from heart, liver, and skeletal muscle. Estimates of relative mRNA abundance (arbitrary units) were determined by the ratio of calculated units of RNA from each tissue. The calculations were made using the portion of the curve for which the plot of the log input amount versus the C_T (cycle threshold) differences resulted in a slope of approximately 0, indicating that the amplicon efficiencies were approximately equal. Relative quantitation of PPAR target genes in cultured myocytes was calculated by using the 2^CT formula, in which C_T equals the difference between C_T values for vehicle (Me₂SO) and drug-treated cells. This formula was validated for each primer/probe set using six-point serial standard curves as described previously (24).

Statistics-- Statistical analyses were performed using JMP Statistical Software (SAS, Cary, NC). Two- and three-way ANOVAs were performed using a standard least squares model to test both the main and interaction effects of genotype × starvation or exercise × time (where appropriate) on serum parameters and mRNA expression. In HSkMC and L6 myocytes differences in FAO rates and mRNA expression (C_T values) were analyzed by Student's t test for paired data.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Metabolic Responses to Exercise and Starvation Are Altered in PPAR KO Mice-- Consistent with earlier reports (4), we found that the body weights of older KO mice (23.4 ± 0.73 g) were greater than their WT littermates (21.7 ± 0.98 g). The effects of PPAR ablation on muscle fuel metabolism were first evaluated during in vivo studies that compared the metabolic responses to 24 h of starvation with that of endurance exercise. We found that when KO mice were challenged by 24 h of starvation, they exhibited increased serum nonesterified fatty acids (NEFA) and hypoketonemia (Fig. 1, A and B) but showed no changes in serum glycerol (not shown) compared with WT. These results are consistent with previous studies (4) and support the premise that ablation of PPAR severely impairs the capacity of the liver to clear and oxidize fatty acids. Moreover, because starvation fully depletes liver glycogen levels (Fig. 2), gluconeogenesis becomes the primary pathway for sustaining blood glucose. KO mice exhibited hypoglycemia, consistent with reduced liver gluconeogenic capacity, and lower serum lactate levels, suggesting increased dependence on this substrate as a gluconeogenic precursor (Fig. 1, C and D). These metabolic abnormalities observed in KO mice after 24 h of starvation were remarkably similar to those exhibited in response to exercise, and as predicted, time to exhaustion (180 ± 35 versus 150 ± 15 min; p < 0.05) and total distance run (1.80 versus 1.37 km; p < 0.01) were greater in WT compared with KO, respectively, indicating that KO mice are less tolerant of endurance exercise. Notably, depletion of liver rather than muscle glycogen corresponded with exhaustion in both groups (Fig. 2). Moreover, estimated rates of liver glycogen depletion were ~50% greater in null compared with WT mice, whereas in contrast, muscle glycogen depletion rates were similar between genotypes. These findings suggested that, contrary to our prediction, PPAR ablation might not increase the reliance of muscle on glucose substrate.

View larger version (12K): [in this window] [in a new window]   Fig. 1.   Metabolic responses to exercise and starvation are altered in KO mice. Serum parameters were measured in PPAR KO mice and age-matched WT littermates that were fed/rested, exercised for 2 h, or starved for 24 h. A, NEFA. B, -OH butyrate; C, glucose; D, lactate. The values are the means ± S.E. from 6-8 animals, and the significant differences (p < 0.05) between WT versus KO mice () and fed/rested versus starved/exercised mice (*) were analyzed by two-way ANOVA.

View larger version (15K): [in this window] [in a new window]   Fig. 2.   Glycogen depletion in skeletal muscle and liver. Glycogen content was measured in liver (A) and muscle (B) from WT and KO mice that were fed/rested, exercised for 2 h, exercised to exhaustion, or starved for 24 h. The values are the means ± S.E. from 6-8 animals, and the significant differences (p < 0.05) between WT versus KO mice () and fed/rested versus starved/exercised mice (*) were analyzed by two-way ANOVA.

In Vitro Fatty Acid Oxidation Rates in Muscles of PPAR KO Compared with WT Mice-- To evaluate changes in muscle fatty acid oxidative capacity directly, we performed in vitro experiments using skeletal muscles comprised of red (soleus), white (extensor digitorum longus), or mixed (gastrocnemius) fiber types. In the fed state, rates of muscle FAO were similar between WT and null mice (Table I), regardless of the fiber composition, implying that PPAR is not required to maintain constitutive activity of muscle FAO enzymes. When animals were starved for 24 h, FAO rates were 28% lower in muscle homogenates from KO compared with WT mice, but neutral lipid accumulation, analyzed by Oil Red O staining, was not different between genotypes (not shown). These results suggested that the metabolic consequences of PPAR deficiency in skeletal muscle are much less severe than those previously shown in liver and heart (4, 5, 9).

View this table: [in this window] [in a new window]   Table I In vitro fatty acid oxidation rates in muscles of KO versus WT mice Intact soleus and extensor digitorum longus (EDL) and whole muscle homogenates of gastrocnemius, isolated from PPAR KO mice and age-matched WT littermates, were incubated 1 h with 500 or 200 µM [14C]oleate, respectively. Oleate oxidation was determined by measuring production of 14C-labeled CO2 and ASM as described under "Experimental Procedures." The values are the means ± S.E. from six animals. The significant differences (p < 0.05) between WT and KO and fed versus starved (*) were analyzed by one- or two-way ANOVA ().

PPAR-independent Regulation of Target Genes in Skeletal Muscle-- Next, we evaluated both constitutive and inducible mRNA expression of classical PPAR target genes in mixed quadriceps muscle. In fed/rested mice, mRNA levels of PDHK4 and UCP3 were similar in muscles from KO compared with WT mice (Fig. 3). In WT, exercise increased muscle mRNA levels of UCP3 and PDHK4 86 and 60%, respectively, whereas starvation increased expression of both genes five to eight times. Surprisingly, the exercise- and/or starvation-induced up-regulation of these genes was either similar or greater (UCP3) in muscles from KO mice, indicating that PPAR is not required for these physiological responses. In comparison, PPAR gene ablation attenuated constitutive and/or inducible expression of the same transcripts in heart (Fig. 4).

View larger version (15K): [in this window] [in a new window]   Fig. 3.   Absence of PPAR does not affect expression of lipid regulatory genes in quadriceps muscle. Total RNA from quadriceps (Quad) muscle of PPAR KO mice and age-matched WT littermates was prepared as described under "Experimental Procedures." mRNA levels of PDHK4 (A) and UCP3 (B) in muscles of mice that were fed/rested (F), exercised for 2 h (E), and starved for 24 h (S) were quantified by Northern blot analysis. The values are the means ± S.E. from 7-9 animals, and the differences between WT and KO mice () and fed/rested versus exercised/starved mice (*) were analyzed by two-way ANOVA.

View larger version (16K): [in this window] [in a new window]   Fig. 4.   Absence of PPAR attenuates expression of lipid regulatory genes in heart. Total RNA from heart of PPAR KO mice and age-matched WT littermates was prepared as described under "Experimental Procedures." mRNA levels of PDHK4 (A) and UCP3 (B) in heart of mice that were fed/rested (F), exercised for 2 h (E), and starved for 24 h (S) were quantified by Northern blot analysis. The values are the means ± S.E. from 6-8 animals, and the differences between WT and KO mice () and fed/rested versus exercised/starved mice (*) were analyzed by two-way ANOVA.

PPAR Subtype Expression in Fatty Acid Oxidative Tissues-- Our results in Figs. 3 and 4, taken together with those from previous studies that investigated liver and heart, revealed tissue-specific differences in PPAR-dependent regulation of FAO and target gene expression. Using RTQ-PCR, we evaluated whether the requirement for PPAR a might be associated with distinct expression patterns of the three PPAR subtypes in various oxidative tissues (Fig. 5). RTQ-PCR detected the nonfunctional  transcript in tissues from KO mice because our mPPAR primer/probes produce an amplicon from exon 7 that occurs before the targeted disruption in exon 8 (18). We found that, compared with skeletal muscle, PPAR mRNA levels were 7- and 19-fold enriched in heart and liver, respectively, whereas PPAR mRNA abundance was similar among oxidative tissues. However, in skeletal muscle, expression level of the -subtype was severalfold greater than either PPAR or PPAR. PPAR expression decreased 68% in liver of KO, whereas PPAR, which was the least abundant subtype in all three tissues from WT mice, increased 2-3-fold in the heart and liver, but not the skeletal muscle, of KO mice.

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Relative expression of PPAR subtypes , , and  in fatty acid oxidative tissues. Total RNA from liver (L), heart (H), and quadriceps muscle (Q) of PPAR KO mice and age-matched WT littermates was prepared as described under "Experimental Procedures." Relative mRNA expression of the three PPAR subtypes was quantified by RTQ-PCR. Significant differences between WT and KO mice (*) were analyzed by one-way ANOVA. , targeted disruption of the PPAR gene in KO mice results in a nonfunctional transcript (18).

The PPAR-selective Agonist GW742 Increases Fatty Acid Oxidation in Cultured Skeletal Muscle Cells-- The present results, as well as those from other animal studies, indicate that at the mRNA level, PPAR is the most abundant subtype in rodent skeletal muscle. In human skeletal muscle we have observed high levels of PPARs  and  and low levels of PPAR.² Taken together, these findings suggest that PPAR might play a major role in regulating oxidative metabolism in both rodent and human skeletal muscle. To address this possibility we evaluated the effects of a novel PPAR agonist, GW742, on FAO and gene expression in mature myotubes derived from rat L6 myocytes or primary human myoblasts. These muscle cell systems were selected because they express PPARs  and  at levels that are comparable with rodent and human skeletal muscle in vivo (not shown). In both rodent and human myotubes, 48 h of treatment with 0-100 nM GW742 increased [¹⁴C]oleate oxidation dose-dependently up to ~2.5-fold (p < 0.001) (Fig. 6A). The maximal effect of the PPAR agonist was nearly identical to that of the  agonist GW647, whereas the PPAR agonist GW929 did not effect FAO (Fig. 6B). Treating myocytes with maximal doses of GW647 and GW742 together did not produce an effect that was greater than either compound added alone (not shown), suggesting that PPARs  and  might activate similar target genes via the same regulatory element.

View larger version (23K): [in this window] [in a new window]   Fig. 6.   Effects of PPAR agonists on fatty acid oxidation in cultured myocytes. After 6 days in DFM, mature rat L6 or primary human myotubes were treated for 48 h with vehicle (Me2SO) or 0.10-100 nM of the PPAR agonist GW742 (A) and maximal doses of GW647 (1.0 µM), GW742 (10 nM), and GW929 (100 nM), agonists selective for PPARs , , or , respectively (B). Day 8 myotubes were then incubated for 3 h at 37 °C in DFM with 100 µM [14C]oleate and 0.25% bovine serum albumin. Oleate oxidation (nmol/g/h) was determined by measuring production of 14C-labeled CO2 and ASM as described under "Experimental Procedures." All of the assays were performed in triplicate, and the values are the means ± S.E. from 3 subjects (human myocytes) or two experiments (L6 myocytes) (A) and 3-10 subjects (B) as indicated. The differences between vehicle and drug-treated cells were analyzed by Student's t test for paired data and one-way ANOVA. *, p < 0.05; **, p < 0.001 versus Me2SO-treated controls.

PPARs  and  Target Similar Lipid Regulatory Genes in Cultured Muscle Cells-- We recently reported that in primary HSkMC, PPAR activation increases mRNA expression of several genes that promote FAO (15). To investigate possible redundancy in skeletal muscle PPAR and  target genes, here we used RTQ-PCR to perform similar evaluations in human and rodent myotubes that were treated with agonists selective for either PPAR (GW742) or PPAR (GW647). The results in Table II show that PPAR-mediated increases in myotube mRNA expression of FAO genes were similar to that of PPAR. Most remarkably, activation of either  or  increased PDHK4 mRNA expression ~30-fold. Both treatments also increased mRNA expression of malonyl-CoA decarboxylase (MCD) and the muscle isoform of carnitine palmitoyltransferase 1 (CPT1), both of which encode for proteins that increase muscle fatty acid uptake and/or -oxidation. Induction of these genes in drug-treated myotubes relative to vehicle controls was highly consistent among cells obtained from different subjects and similar in myotubes treated with GW647 compared with GW742. In contrast, changes in UCP3 mRNA expression were highly variable and significant only in cells that were treated with the PPAR agonist.

View this table: [in this window] [in a new window]   Table II Selective agonists of PPARs  and  have similar effects on expression of lipid regulatory genes in primary HSkMC Total RNA was isolated and quantified by RTQ-PCR as described under "Experimental Procedures," and differences in CT values between treated and control cells were analyzed by Student's t test for paired data. Gene expression levels in day 8 myotubes that were treated for 48 h with 10 nM GW742 or 1.0 µM GW647, relative to vehicle (Me2SO) controls, are presented as the means ± S.E. of cells from nine different subjects analyzed in quadruplicates.

Similar to HSkMC, in L6 myotubes both the  (GW647) and  (GW742) agonists increased mRNA abundance of PDHK4 ~24-fold (Table III). Both agonists also increased mCPT1 and UCP3, but notably, in L6 myocytes induction of these genes was severalfold more robust than in the HSkMC. Together, these results suggest that gene- and species-specific elements modulate the physiological induction of PPAR targets. In results not shown, the PPAR agonist, GW929, did not affect the mRNA levels of any of the genes analyzed.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PPAR is expressed most abundantly in highly oxidative tissues where it plays a key role in activating pathways of -oxidation (2). Conversely, PPAR, which is expressed primarily in adipose tissue, promotes adipocyte differentiation and induces genes involved in lipogenesis (26). The function of PPAR, which is expressed ubiquitously, is less certain, although recent data implicate this subtype as a regulator of cholesterol metabolism (17) and adiposity (27). Skeletal muscle expresses all three PPAR subtypes, but their distinct roles in regulating muscle energy metabolism are unknown. In the present investigation we used PPAR KO mice to determine whether the -subtype is essential for maintaining skeletal muscle lipid homeostasis. The mice were challenged by exercise or 24 h of starvation, two physiological stresses that increase systemic delivery of fatty acid and induce adaptive changes in muscle fuel metabolism. In contrast to starvation, a long term stress in which lipid catabolism increases most markedly in the liver, exhaustive exercise represents a short term stress in which high rates of skeletal muscle FAO are critical for sustaining prolonged work. Although we found that KO mice were less tolerant of exercise, they still performed better than expected given our hypothesis that ablation of PPAR would produce severe defects in muscle fatty acid oxidative capacity. The findings that glycogen depletion rates were greater in liver but not in muscle of KO mice and that in vitro muscle FAO rates were similar between genotypes suggested that exercise intolerance was due to metabolic perturbations in liver and heart rather than skeletal muscle. Interestingly, exhaustive exercise depleted muscle glycogen only 50%, whereas depletion of liver glycogen reached nearly 100%, corresponding with the onset of hypoglycemia in both genotypes (not shown). These data implicate liver fuel metabolism as a limiting factor during exhaustive, low intensity exercise.

Previous studies using KO mice have provided convincing evidence that, in rodents, PPAR plays an obligatory role in regulating lipid homeostasis in liver and heart. In these oxidative tissues, absence of functional PPAR decreases mitochondrial FAO ~70% (28-30), a finding that is explained by reduced constitutive and/or inducible expression levels of several fatty acid catabolic enzymes including MCD (30) and PDHK4 (31). Furthermore, when KO mice are challenged by physiological or pharmacological perturbations in fatty acid metabolism, cardiac and hepatic tissues accumulate abnormally high amounts of neutral lipids (4, 32). In contrast, the present study found that skeletal muscles of KO mice exhibited minor abnormalities in FAO only when animals were starved and showed no evidence of neutral lipid accumulation. KO muscles also maintained constitutive and inducible mRNA levels of the PPAR target genes, PDHK4 and UCP3. Although exercise/starvation induced stress hormones probably contribute to the physiological regulation of these genes, PPAR is widely considered a primary mediator because administration of PPAR-selective drugs, as well as treatments that elevate serum NEFA in fed animals, mimic the effects of starvation on UCP3 and PDHK4 gene expression (10, 12, 33). Surprisingly, starvation-induced up-regulation of muscle UCP3 was actually more robust in KO mice, which corresponded with higher serum NEFA. This result is consistent with previous studies describing a tight correlation between systemic NEFA and changes in skeletal muscle UCP3 mRNA levels (33); however, it is inconsistent with speculation that PPAR is an essential mediator of these changes. In contrast, when we examined the same target genes in the heart, deficiency of PPAR decreased the constitutive levels of UCP3 and diminished exercise- and starvation-induced increases in both UCP3 and PDHK4. Thus, importantly, these results are the first to show that skeletal and cardiac muscles, both of which are highly oxidative tissues, exhibit distinct requirements for PPAR.

Tissue-specific differences in the metabolic consequences of PPAR deficiency might be related to the relative abundance of the three subtypes in various oxidative tissues. We found predominant expression of PPAR in liver, whereas PPARs  and  were similarly abundant in heart. In contrast, PPAR was the major subtype expressed in mouse quadriceps muscle. These results, obtained by RTQ-PCR, are similar to studies that used RNase protection assays to evaluate expression levels of the PPAR subtypes in mouse (34) and rat (35) tissues. Low levels of PPAR in oxidative tissues from WT are consistent with the notion that this subtype does not play a major role in regulating FAO. On the contrary, increased PPAR in liver and heart of KO mice is consistent with its function as an activator of lipogenesis and glycerolipid synthesis and, similar to other reports (36), implicates elevated  levels as an early response in the progression of hepatic and cardiac lipotoxicity.

The results from several in vivo studies have implied a role for the PPARs in mediating fatty acid-induced regulation of muscle metabolism, but only recently has direct evidence emerged showing that PPAR-selective drugs induce expression of lipid regulatory genes in cultured skeletal myocytes (15, 35, 37, 38). Still, there is little information on whether the three skeletal muscle PPAR subtypes target similar or distinct metabolic pathways. The results of our study using PPAR KO mice suggested that PPAR might play a role in regulating muscle lipid homeostasis. This hypothesis was supported by experiments in cultured myocytes showing that the highly selective PPAR agonist, GW742, increased FAO and induced expression of several lipid regulatory genes. In both human and rat myotubes the metabolic and gene regulatory effects of the  agonist were similar to those observed when cells were treated with the PPAR agonist. Our results are consistent with recent studies showing that activation of PPAR induces mRNA expression of UCP2 and UCP3 in human and L6 myotubes, respectively. Skeletal muscle UCPs, which are mitochondrial membrane proteins that uncouple oxidative phosphorylation, are proposed to facilitate FAO and/or protect muscle against damaging by-products of oxidative metabolism (39, 40). Additionally, we found that PPAR activation also increased mRNA expression of PDHK4, CPT1, and MCD. PDHK4 functions by phosphorylating and inactivating pyruvate dehydrogenase, the multienzyme complex that catalyzes the irreversible oxidation of pyruvate to acetyl-CoA (41). Increased expression and activity of PDHK4, which occurs in response to exercise (7), starvation (8), and a low carbohydrate diet (42), is thought to promote fatty acid oxidation by decreasing glucose-derived acetyl-CoA. CPT1 catalyzes the initial and rate-limiting step in the transport of fatty acid into mitochondria, whereas MCD disposes of the potent CPT1 inhibitor, malonyl-CoA. Thus, in the aggregate, activation of these genes increases catabolism of fatty acids by promoting their entry into the mitochondria and by relieving competition between carbohydrate and lipid-derived acetyl-CoA. Importantly, this study is the first to demonstrate that PPAR is capable of inducing multiple pathways that cooperatively promote FAO, a function that is generally assigned to PPAR.

Because PPAR binds to many of the same fatty acids and lipid metabolites as the other PPAR subtypes, it has been presumed to play a role in fatty acid homeostasis, although data confirming this hypothesis have remained elusive because of the absence of potent and selective agonists. The results of the present study, which used a novel agonist that is 1000-fold selective for the  subtype, demonstrate that activation of PPAR promotes fatty acid catabolism in skeletal muscle, thus supporting a role for this subtype in regulating whole body lipid metabolism. Consistent with our findings, a close analog of GW742 with equivalent PPAR activity was recently shown to decrease serum triglycerides and insulin and increase HDL cholesterol in obese rhesus monkeys (17). Changes in serum lipid profiles were at least partly explained by induction of genes that promote reverse cholesterol transport, but our data suggest that increased skeletal muscle lipid uptake and catabolism might have contributed to the therapeutic effects of the treatment.

View this table: [in this window] [in a new window]   Table III Selective agonists of PPARs  and  have similar effects on expression of lipid regulatory genes in L6 myocytes Total RNA was isolated and quantified by RTQ-PCR as described under "Experimental Procedures," and differences in CT values between treated and control cells were analyzed by Student's t test for paired data. Gene expression levels in day 8 myotubes that were treated for 48 h with 10 nM GW742 or 1.0 µM GW647, relative to vehicle (Me2SO) controls, are presented as the means ± S.E. of cells from two separate experiments analyzed in quadruplicates.

All three PPAR subtypes bind to DNA as obligate heterodimers with the retinoic acid receptor RXR, and the preferred DNA-binding site, referred to as the DR-1 motif, is the same for each of the PPAR/RXR heterodimer pairs (1). Because PPARs  and  bind to the same response element within a given target promoter, conceivably, full activation of these two distinct transcription factors, as occurs when the receptor binds to its chemically engineered agonist in vitro, might produce nearly identical responses. However, considerable data, including phenotypic differences between PPAR- and PPAR-null mice (43), indicate that these transcription factors play distinct physiological roles in vivo. Our studies in KO mice showed that PPAR is indispensable for UCP3 regulation in heart, despite high expression levels of PPAR, indicating that properties other than mRNA abundance contribute to the tissue-specific roles of these transcription factors. In addition to tissue distribution, specificity of function might be conferred by mechanisms that impart subtype-specific regulation of receptor activity, such as differences in their binding affinities for endogenous ligands (44, 45). Transcriptional activity of PPARs  and  is also regulated by phosphorylation of their transcriptional activation domains (44, 46-48) and by tissue-specific interactions with co-activators/repressors (47). Less is known about PPAR, but the activity of this subtype is likely to exhibit similar mechanisms of regulation.

In summary, the results from our experiments using cultured myocytes show overlap in the functions of PPARs  and  as transcriptional regulators of FAO. Taken together with previous studies, our data from PPAR KO mice indicate that the essential and/or permissive roles of each subtype in controlling expression FAO genes in vivo depend on complex physiological interactions that exhibit tissue and target gene specificity. A full accounting of the distinct and cooperative roles of PPARs  and  in regulating lipid homeostasis, and perhaps other metabolic pathways, will require combined loss of function experiments in both cell culture and tissue-specific knockout mouse models. Information from such studies should have important implications for treating energy metabolic diseases such as obesity, hyperlipidemia, and type 2 diabetes.

	ACKNOWLEDGEMENTS

We thank Jennifer Bennett and Donghai Zheng for technical assistance.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants 46121-06 (to G. L. D.), F32DK 10017-01 (to D. M. M.) and HL57354 (to W. E. K.) and a grant from the North Carolina Institute of Nutrition (to D. M. M. and J. A. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: P.O. Box 3327, Duke University Medical Center, Durham, NC 27710. Tel.: 919-684-3644; Fax: 919-684-8907; E-mail: muoio@duke.edu.

Published, JBC Papers in Press, May 6, 2002, DOI 10.1074/jbc.M203997200

² D. M. Muoio, P. S. MacLean, D. B. Lang, S. Li, J. A. Houmard, J. M. Way, D. A. Winegar, J. C. Corton, G. L. Dohm, and W. E. Kraus, unpublished data.

	ABBREVIATIONS

The abbreviations used are: PPAR, peroxisome proliferator-activated receptor; ASM, acid-soluble metabolites; CPT1, carnitine palmitoyltransferase 1; DFM, differentiation medium; FAO, fatty acid oxidation; HSkMC, human skeletal muscle cells; KO, knockout; MCD, malonyl-CoA decarboxylase; PDHK4, pyruvate dehydrogenase kinase 4; UCP3, uncoupling protein 3; WT, wild type; ANOVA, analysis of variance; RTQ, real time quantitative; NEFA, nonesterified fatty acids.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				C. Alexanderson, E. Eriksson, E. Stener-Victorin, M. Lonn, and A. Holmang Early postnatal oestradiol exposure causes insulin resistance and signs of inflammation in circulation and skeletal muscle J. Endocrinol., April 1, 2009; 201(1): 49 - 58. [Abstract] [Full Text] [PDF]

				J. M. Maglich, D. C. Lobe, and J. T. Moore The nuclear receptor CAR (NR1I3) regulates serum triglyceride levels under conditions of metabolic stress J. Lipid Res., March 1, 2009; 50(3): 439 - 445. [Abstract] [Full Text] [PDF]

				X. Palomer, D. Alvarez-Guardia, R. Rodriguez-Calvo, T. Coll, J. C. Laguna, M. M. Davidson, T. O. Chan, A. M. Feldman, and M. Vazquez-Carrera TNF-{alpha} reduces PGC-1{alpha} expression through NF-{kappa}B and p38 MAPK leading to increased glucose oxidation in a human cardiac cell model Cardiovasc Res, March 1, 2009; 81(4): 703 - 712. [Abstract] [Full Text] [PDF]

				L. Makowski, R. C. Noland, T. R. Koves, W. Xing, O. R. Ilkayeva, M. J. Muehlbauer, R. D. Stevens, and D. M. Muoio Metabolic profiling of PPAR{alpha}-/- mice reveals defects in carnitine and amino acid homeostasis that are partially reversed by oral carnitine supplementation FASEB J, February 1, 2009; 23(2): 586 - 604. [Abstract] [Full Text] [PDF]

				A. W. Norris, M. F. Hirshman, J. Yao, N. Jessen, N. Musi, L. Chen, W. I. Sivitz, L. J. Goodyear, and C. R. Kahn Endogenous Peroxisome Proliferator-Activated Receptor-{gamma} Augments Fatty Acid Uptake in Oxidative Muscle Endocrinology, November 1, 2008; 149(11): 5374 - 5383. [Abstract] [Full Text] [PDF]

				B. Faiola, J. G. Falls, R. A. Peterson, N. R. Bordelon, T. A. Brodie, C. A. Cummings, E. H. Romach, and R. T. Miller PPAR alpha, more than PPAR delta, Mediates the Hepatic and Skeletal Muscle Alterations Induced by the PPAR Agonist GW0742 Toxicol. Sci., October 1, 2008; 105(2): 384 - 394. [Abstract] [Full Text] [PDF]

				R. M. Wynn, M. Kato, J. L. Chuang, S.-C. Tso, J. Li, and D. T. Chuang Pyruvate Dehydrogenase Kinase-4 Structures Reveal a Metastable Open Conformation Fostering Robust Core-free Basal Activity J. Biol. Chem., September 12, 2008; 283(37): 25305 - 25315. [Abstract] [Full Text] [PDF]

				C. Fernandez, O. Hansson, P. Nevsten, C. Holm, and C. Klint Hormone-sensitive lipase is necessary for normal mobilization of lipids during submaximal exercise Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E179 - E186. [Abstract] [Full Text] [PDF]

				D. J. Mazzatti, M. A. Smith, R. C. Oita, F.-L. Lim, A. J. White, and M. B. Reid Muscle unloading-induced metabolic remodeling is associated with acute alterations in PPAR{delta} and UCP-3 expression Physiol Genomics, July 1, 2008; 34(2): 149 - 161. [Abstract] [Full Text] [PDF]

				M. B. Rosen, B. D. Abbott, D. C. Wolf, J. C. Corton, C. R. Wood, J. E. Schmid, K. P. Das, R. D. Zehr, E. T. Blair, and C. Lau Gene Profiling in the Livers of Wild-type and PPAR{alpha}-Null Mice Exposed to Perfluorooctanoic Acid Toxicol Pathol, June 1, 2008; 36(4): 592 - 607. [Abstract] [Full Text] [PDF]

				Z. Nahle, M. Hsieh, T. Pietka, C. T. Coburn, P. A. Grimaldi, M. Q. Zhang, D. Das, and N. A. Abumrad CD36-dependent Regulation of Muscle FoxO1 and PDK4 in the PPAR{delta}/{beta}-mediated Adaptation to Metabolic Stress J. Biol. Chem., May 23, 2008; 283(21): 14317 - 14326. [Abstract] [Full Text] [PDF]

				J. Bastin, F. Aubey, A. Rotig, A. Munnich, and F. Djouadi Activation of Peroxisome Proliferator-Activated Receptor Pathway Stimulates the Mitochondrial Respiratory Chain and Can Correct Deficiencies in Patients' Cells Lacking Its Components J. Clin. Endocrinol. Metab., April 1, 2008; 93(4): 1433 - 1441. [Abstract] [Full Text] [PDF]

				P. J.H. Smeets, B. E.J. Teunissen, P. H.M. Willemsen, F. A. van Nieuwenhoven, A. E. Brouns, B. J.A. Janssen, J. P.M. Cleutjens, B. Staels, G. J. van der Vusse, and M. van Bilsen Cardiac hypertrophy is enhanced in PPAR{alpha}-/- mice in response to chronic pressure overload Cardiovasc Res, April 1, 2008; 78(1): 79 - 89. [Abstract] [Full Text] [PDF]

				A. H. Remels, H. R. Gosker, P. Schrauwen, R. C. Langen, and A. M. Schols Peroxisome proliferator-activated receptors: a therapeutic target in COPD? Eur. Respir. J., March 1, 2008; 31(3): 502 - 508. [Abstract] [Full Text] [PDF]

				R. T. Morris, M. J. Laye, S. J. Lees, R. S. Rector, J. P. Thyfault, and F. W. Booth Exercise-induced attenuation of obesity, hyperinsulinemia, and skeletal muscle lipid peroxidation in the OLETF rat J Appl Physiol, March 1, 2008; 104(3): 708 - 715. [Abstract] [Full Text] [PDF]

				R. Rodriguez-Calvo, L. Serrano, E. Barroso, T. Coll, X. Palomer, A. Camins, R. M. Sanchez, M. Alegret, M. Merlos, M. Pallas, et al. Peroxisome Proliferator-Activated Receptor {alpha} Down-Regulation Is Associated With Enhanced Ceramide Levels in Age-Associated Cardiac Hypertrophy J. Gerontol. A Biol. Sci. Med. Sci., December 1, 2007; 62(12): 1326 - 1336. [Abstract] [Full Text] [PDF]

				B. M. Jucker, D. Yang, W. M. Casey, A. R. Olzinski, C. Williams, S. C. Lenhard, J. J. Legos, C. T. Hawk, S. K. Sarkar, and S. J. Newsholme Selective PPAR{delta} agonist treatment increases skeletal muscle lipid metabolism without altering mitochondrial energy coupling: an in vivo magnetic resonance spectroscopy study Am J Physiol Endocrinol Metab, November 1, 2007; 293(5): E1256 - E1264. [Abstract] [Full Text] [PDF]

				N. K. LeBrasseur, T.-A. S. Duhaney, D. S. De Silva, L. Cui, P. C. Ip, L. Joseph, and F. Sam Effects of Fenofibrate on Cardiac Remodeling in Aldosterone-Induced Hypertension Hypertension, September 1, 2007; 50(3): 489 - 496. [Abstract] [Full Text] [PDF]

				S. Schiaffino, M. Sandri, and M. Murgia Activity-Dependent Signaling Pathways Controlling Muscle Diversity and Plasticity Physiology, August 1, 2007; 22(4): 269 - 278. [Abstract] [Full Text] [PDF]

				I. G. Lunde, M. Ekmark, Z. A. Rana, A. Buonanno, and K. Gundersen PPAR{delta} expression is influenced by muscle activity and induces slow muscle properties in adult rat muscles after somatic gene transfer J. Physiol., August 1, 2007; 582(3): 1277 - 1287. [Abstract] [Full Text] [PDF]

				P. Garcia-Roves, J. M. Huss, D.-H. Han, C. R. Hancock, E. Iglesias-Gutierrez, M. Chen, and J. O. Holloszy Raising plasma fatty acid concentration induces increased biogenesis of mitochondria in skeletal muscle PNAS, June 19, 2007; 104(25): 10709 - 10713. [Abstract] [Full Text] [PDF]

				D. Freyssenet Energy sensing and regulation of gene expression in skeletal muscle J Appl Physiol, February 1, 2007; 102(2): 529 - 540. [Abstract] [Full Text] [PDF]

				D. L. Sprecher, C. Massien, G. Pearce, A. N. Billin, I. Perlstein, T. M. Willson, D. G. Hassall, N. Ancellin, S. D. Patterson, D. C. Lobe, et al. Triglyceride:High-Density Lipoprotein Cholesterol Effects in Healthy Subjects Administered a Peroxisome Proliferator Activated Receptor {delta} Agonist Arterioscler. Thromb. Vasc. Biol., February 1, 2007; 27(2): 359 - 365. [Abstract] [Full Text] [PDF]

				Y. C. Long, S. Glund, P. M. Garcia-Roves, and J. R. Zierath Calcineurin Regulates Skeletal Muscle Metabolism via Coordinated Changes in Gene Expression J. Biol. Chem., January 19, 2007; 282(3): 1607 - 1614. [Abstract] [Full Text] [PDF]

				K. Chokkalingam, K. Jewell, L. Norton, J. Littlewood, L. J. C. van Loon, P. Mansell, I. A. Macdonald, and K. Tsintzas High-Fat/Low-Carbohydrate Diet Reduces Insulin-Stimulated Carbohydrate Oxidation but Stimulates Nonoxidative Glucose Disposal in Humans: An Important Role for Skeletal Muscle Pyruvate Dehydrogenase Kinase 4 J. Clin. Endocrinol. Metab., January 1, 2007; 92(1): 284 - 292. [Abstract] [Full Text] [PDF]

				L. Michalik, J. Auwerx, J. P. Berger, V. K. Chatterjee, C. K. Glass, F. J. Gonzalez, P. A. Grimaldi, T. Kadowaki, M. A. Lazar, S. O'Rahilly, et al. International Union of Pharmacology. LXI. Peroxisome Proliferator-Activated Receptors Pharmacol. Rev., December 1, 2006; 58(4): 726 - 741. [Abstract] [Full Text] [PDF]

				J. R.B. Dyck, T. A. Hopkins, S. Bonnet, E. D. Michelakis, M. E. Young, M. Watanabe, Y. Kawase, K.-i. Jishage, and G. D. Lopaschuk Absence of Malonyl Coenzyme A Decarboxylase in Mice Increases Cardiac Glucose Oxidation and Protects the Heart From Ischemic Injury Circulation, October 17, 2006; 114(16): 1721 - 1728. [Abstract] [Full Text] [PDF]

				H. J. Atherton, N. J. Bailey, W. Zhang, J. Taylor, H. Major, J. Shockcor, K. Clarke, and J. L. Griffin A combined 1H-NMR spectroscopy- and mass spectrometry-based metabolomic study of the PPAR-{alpha} null mutant mouse defines profound systemic changes in metabolism linked to the metabolic syndrome Physiol Genomics, October 11, 2006; 27(2): 178 - 186. [Abstract] [Full Text] [PDF]

				N. Pedraza, M. Rosell, J. Villarroya, R. Iglesias, F. J. Gonzalez, G. Solanes, and F. Villarroya Developmental and Tissue-Specific Involvement of Peroxisome Proliferator-Activated Receptor-{alpha} in the Control of Mouse Uncoupling Protein-3 Gene Expression Endocrinology, October 1, 2006; 147(10): 4695 - 4704. [Abstract] [Full Text] [PDF]

				D. An and B. Rodrigues Role of changes in cardiac metabolism in development of diabetic cardiomyopathy Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1489 - H1506. [Abstract] [Full Text] [PDF]

				M. I Martinelli, N. O Mocchiutti, and C. A Bernal Dietary di(2-ethylhexyl)phthalate-impaired glucose metabolism in experimental animals Human and Experimental Toxicology, September 1, 2006; 25(9): 531 - 538. [Abstract] [PDF]

				S. A. Myers, S.-C. M. Wang, and G. E. O. Muscat The Chicken Ovalbumin Upstream Promoter-Transcription Factors Modulate Genes and Pathways Involved in Skeletal Muscle Cell Metabolism J. Biol. Chem., August 25, 2006; 281(34): 24149 - 24160. [Abstract] [Full Text] [PDF]

				A. G. Smith and G. E. O. Muscat Orphan nuclear receptors: therapeutic opportunities in skeletal muscle Am J Physiol Cell Physiol, August 1, 2006; 291(2): C203 - C217. [Abstract] [Full Text] [PDF]

				J. Lopez-Soriano, C. Chiellini, M. Maffei, P. A. Grimaldi, and J. M. Argiles Roles of Skeletal Muscle and Peroxisome Proliferator-Activated Receptors in the Development and Treatment of Obesity Endocr. Rev., May 1, 2006; 27(3): 318 - 329. [Abstract] [Full Text] [PDF]

				B. Desvergne, L. Michalik, and W. Wahli Transcriptional Regulation of Metabolism Physiol Rev, April 1, 2006; 86(2): 465 - 514. [Abstract] [Full Text] [PDF]

				W. Verreth, J. Ganame, A. Mertens, H. Bernar, M.-C. Herregods, and P. Holvoet Peroxisome Proliferator-Activated Receptor-{alpha},{gamma}-Agonist Improves Insulin Sensitivity and Prevents Loss of Left Ventricular Function in Obese Dyslipidemic Mice Arterioscler. Thromb. Vasc. Biol., April 1, 2006; 26(4): 922 - 928. [Abstract] [Full Text] [PDF]

				L. Lin, M. Park, M. Hulver, and D. A. York Different metabolic responses to central and peripheral injection of enterostatin Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2006; 290(4): R909 - R915. [Abstract] [Full Text] [PDF]

				A. J. Murray, M. Panagia, D. Hauton, G. F. Gibbons, and K. Clarke Plasma Free Fatty Acids and Peroxisome Proliferator-Activated Receptor {alpha} in the Control of Myocardial Uncoupling Protein Levels Diabetes, December 1, 2005; 54(12): 3496 - 3502. [Abstract] [Full Text] [PDF]

				T. M. D'Eon, S. C. Souza, M. Aronovitz, M. S. Obin, S. K. Fried, and A. S. Greenberg Estrogen Regulation of Adiposity and Fuel Partitioning: EVIDENCE OF GENOMIC AND NON-GENOMIC REGULATION OF LIPOGENIC AND OXIDATIVE PATHWAYS J. Biol. Chem., October 28, 2005; 280(43): 35983 - 35991. [Abstract] [Full Text] [PDF]

				T. R. Koves, P. Li, J. An, T. Akimoto, D. Slentz, O. Ilkayeva, G. L. Dohm, Z. Yan, C. B. Newgard, and D. M. Muoio Peroxisome Proliferator-activated Receptor-{gamma} Co-activator 1{alpha}-mediated Metabolic Remodeling of Skeletal Myocytes Mimics Exercise Training and Reverses Lipid-induced Mitochondrial Inefficiency J. Biol. Chem., September 30, 2005; 280(39): 33588 - 33598. [Abstract] [Full Text] [PDF]

				A. I. Shulman and D. J. Mangelsdorf Retinoid X Receptor Heterodimers in the Metabolic Syndrome N. Engl. J. Med., August 11, 2005; 353(6): 604 - 615. [Full Text] [PDF]

				C L. Kien, J. Y Bunn, and F. Ugrasbul Increasing dietary palmitic acid decreases fat oxidation and daily energy expenditure Am. J. Clinical Nutrition, August 1, 2005; 82(2): 320 - 326. [Abstract] [Full Text] [PDF]

				L. E. Hammond, S. Neschen, A. J. Romanelli, G. W. Cline, O. R. Ilkayeva, G. I. Shulman, D. M. Muoio, and R. A. Coleman Mitochondrial Glycerol-3-phosphate Acyltransferase-1 Is Essential in Liver for the Metabolism of Excess Acyl-CoAs J. Biol. Chem., July 8, 2005; 280(27): 25629 - 25636. [Abstract] [Full Text] [PDF]

				L. Plum, F. T. Wunderlich, S. Baudler, W. Krone, and J. C. Bruning Transgenic and Knockout Mice in Diabetes Research: Novel Insights into Pathophysiology, Limitations, and Perspectives Physiology, June 1, 2005; 20(3): 152 - 161. [Abstract] [Full Text] [PDF]

				M. Panagia, G. F. Gibbons, G. K. Radda, and K. Clarke PPAR-{alpha} activation required for decreased glucose uptake and increased susceptibility to injury during ischemia Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H2677 - H2683. [Abstract] [Full Text] [PDF]

				B. A. Pederson, C. R. Cope, J. M. Schroeder, M. W. Smith, J. M. Irimia, B. L. Thurberg, A. A. DePaoli-Roach, and P. J. Roach Exercise Capacity of Mice Genetically Lacking Muscle Glycogen Synthase: IN MICE, MUSCLE GLYCOGEN IS NOT ESSENTIAL FOR EXERCISE J. Biol. Chem., April 29, 2005; 280(17): 17260 - 17265. [Abstract] [Full Text] [PDF]

				A. Planavila, J. C. Laguna, and M. Vazquez-Carrera Nuclear Factor-{kappa}B Activation Leads to Down-regulation of Fatty Acid Oxidation during Cardiac Hypertrophy J. Biol. Chem., April 29, 2005; 280(17): 17464 - 17471. [Abstract] [Full Text] [PDF]

				D. K. Kramer, L. Al-Khalili, S. Perrini, J. Skogsberg, P. Wretenberg, K. Kannisto, H. Wallberg-Henriksson, E. Ehrenborg, J. R. Zierath, and A. Krook Direct Activation of Glucose Transport in Primary Human Myotubes After Activation of Peroxisome Proliferator-Activated Receptor {delta} Diabetes, April 1, 2005; 54(4): 1157 - 1163. [Abstract] [Full Text] [PDF]

				R. K. Semple, A. Meirhaeghe, A. J. Vidal-Puig, J. W. R. Schwabe, D. Wiggins, G. F. Gibbons, M. Gurnell, V. K. K. Chatterjee, and S. O'Rahilly A Dominant Negative Human Peroxisome Proliferator-Activated Receptor (PPAR){alpha} Is a Constitutive Transcriptional Corepressor and Inhibits Signaling through All PPAR Isoforms Endocrinology, April 1, 2005; 146(4): 1871 - 1882. [Abstract] [Full Text] [PDF]

				M. A. Maxwell, M. E. Cleasby, A. Harding, A. Stark, G. J. Cooney, and G. E. O. Muscat Nur77 Regulates Lipolysis in Skeletal Muscle Cells: EVIDENCE FOR CROSS-TALK BETWEEN THE {beta}-ADRENERGIC AND AN ORPHAN NUCLEAR HORMONE RECEPTOR PATHWAY J. Biol. Chem., April 1, 2005; 280(13): 12573 - 12584. [Abstract] [Full Text] [PDF]

				S. N. Ramakrishnan, P. Lau, L. J. Burke, and G. E. O. Muscat Rev-erb{beta} Regulates the Expression of Genes Involved in Lipid Absorption in Skeletal Muscle Cells: EVIDENCE FOR CROSS-TALK BETWEEN ORPHAN NUCLEAR RECEPTORS AND MYOKINES J. Biol. Chem., March 11, 2005; 280(10): 8651 - 8659. [Abstract] [Full Text] [PDF]

				J. N. van der Veen, J. K. Kruit, R. Havinga, J. F. W. Baller, G. Chimini, S. Lestavel, B. Staels, P. H. E. Groot, A. K. Groen, and F. Kuipers Reduced cholesterol absorption upon PPAR{delta} activation coincides with decreased intestinal expression of NPC1L1 J. Lipid Res., March 1, 2005; 46(3): 526 - 534. [Abstract] [Full Text] [PDF]

				F. Djouadi, F. Aubey, D. Schlemmer, and J. Bastin Peroxisome Proliferator Activated Receptor {delta} (PPAR{delta}) Agonist But Not PPAR{alpha} Corrects Carnitine Palmitoyl Transferase 2 Deficiency in Human Muscle Cells J. Clin. Endocrinol. Metab., March 1, 2005; 90(3): 1791 - 1797. [Abstract] [Full Text] [PDF]

				A. Planavila, R. Rodriguez-Calvo, M. Jove, L. Michalik, W. Wahli, J. C. Laguna, and M. Vazquez-Carrera Peroxisome proliferator-activated receptor {beta}/{delta} activation inhibits hypertrophy in neonatal rat cardiomyocytes Cardiovasc Res, March 1, 2005; 65(4): 832 - 841. [Abstract] [Full Text] [PDF]

				R. R Almon, D. C DuBois, J. Y Jin, and W. J Jusko Temporal profiling of the transcriptional basis for the development of corticosteroid-induced insulin resistance in rat muscle J. Endocrinol., January 1, 2005; 184(1): 219 - 232. [Abstract] [Full Text] [PDF]

				E. A. Turvey, G. J. F. Heigenhauser, M. Parolin, and S. J. Peters Elevated n-3 fatty acids in a high-fat diet attenuate the increase in PDH kinase activity but not PDH activity in human skeletal muscle J Appl Physiol, January 1, 2005; 98(1): 350 - 355. [Abstract] [Full Text] [PDF]

				S. Nedvetzki, E. Gonen, N. Assayag, R. Reich, R. O. Williams, R. L. Thurmond, J.-F. Huang, B. A. Neudecker, F.-S. Wang, E. A. Turley, et al. RHAMM, a receptor for hyaluronan-mediated motility, compensates for CD44 in inflamed CD44-knockout mice: A different interpretation of redundancy PNAS, December 28, 2004; 101(52): 18081 - 18086. [Abstract] [Full Text] [PDF]

				J. M. Huss and D. P. Kelly Nuclear Receptor Signaling and Cardiac Energetics Circ. Res., September 17, 2004; 95(6): 568 - 578. [Abstract] [Full Text] [PDF]

				L. L. Spriet, R. J. Tunstall, M. J. Watt, K. A. Mehan, M. Hargreaves, and D. Cameron-Smith Pyruvate dehydrogenase activation and kinase expression in human skeletal muscle during fasting J Appl Physiol, June 1, 2004; 96(6): 2082 - 2087. [Abstract] [Full Text] [PDF]

				B. Desvergne, L. Michalik, and W. Wahli Be Fit or Be Sick: Peroxisome Proliferator-Activated Receptors Are Down the Road Mol. Endocrinol., June 1, 2004; 18(6): 1321 - 1332. [Abstract] [Full Text] [PDF]

				P. Ferre The Biology of Peroxisome Proliferator-Activated Receptors: Relationship With Lipid Metabolism and Insulin Sensitivity Diabetes, February 1, 2004; 53(90001): S43 - 50. [Abstract] [Full Text]

				U. Dressel, T. L. Allen, J. B. Pippal, P. R. Rohde, P. Lau, and G. E. O. Muscat The Peroxisome Proliferator-Activated Receptor {beta}/{delta} Agonist, GW501516, Regulates the Expression of Genes Involved in Lipid Catabolism and Energy Uncoupling in Skeletal Muscle Cells Mol. Endocrinol., December 1, 2003; 17(12): 2477 - 2493. [Abstract] [Full Text] [PDF]

				A. P. Russell, J. Feilchenfeldt, S. Schreiber, M. Praz, A. Crettenand, C. Gobelet, C. A. Meier, D. R. Bell, A. Kralli, J.-P. Giacobino, et al. Endurance Training in Humans Leads to Fiber Type-Specific Increases in Levels of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1 and Peroxisome Proliferator-Activated Receptor-{alpha} in Skeletal Muscle Diabetes, December 1, 2003; 52(12): 2874 - 2881. [Abstract] [Full Text] [PDF]

				H. Koutnikova, T.-A. Cock, M. Watanabe, S. M. Houten, M.-F. Champy, A. Dierich, and J. Auwerx Compensation by the muscle limits the metabolic consequences of lipodystrophy in PPAR{gamma} hypomorphic mice PNAS, November 25, 2003; 100(24): 14457 - 14462. [Abstract] [Full Text] [PDF]

				K. E. Schmid and L. A. Woollett Differential effects of polyunsaturated fatty acids on sterol synthesis rates in adult and fetal tissues of the hamster: consequence of altered sterol balance Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G796 - G803. [Abstract] [Full Text] [PDF]

				H. J. Grav, K. J. Tronstad, O. A. Gudbrandsen, K. Berge, K. E. Fladmark, T. C. Martinsen, H. Waldum, H. Wergedahl, and R. K. Berge Changed Energy State and Increased Mitochondrial {beta}-Oxidation Rate in Liver of Rats Associated with Lowered Proton Electrochemical Potential and Stimulated Uncoupling Protein 2 (UCP-2) Expression: EVIDENCE FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR-{alpha} INDEPENDENT INDUCTION OF UCP-2 EXPRESSION J. Biol. Chem., August 15, 2003; 278(33): 30525 - 30533. [Abstract] [Full Text] [PDF]

				C.-H. Lee, P. Olson, and R. M. Evans Minireview: Lipid Metabolism, Metabolic Diseases, and Peroxisome Proliferator-Activated Receptors Endocrinology, June 1, 2003; 144(6): 2201 - 2207. [Abstract] [Full Text] [PDF]

				M. C. Sugden and M. J. Holness Recent advances in mechanisms regulating glucose oxidation at the level of the pyruvate dehydrogenase complex by PDKs Am J Physiol Endocrinol Metab, May 1, 2003; 284(5): E855 - E862. [Abstract] [Full Text] [PDF]

				K. Bae and D. R. Weaver Light-Induced Phase Shifts in Mice Lacking mPER1 or mPER2 J Biol Rhythms, April 1, 2003; 18(2): 123 - 133. [Abstract] [PDF]

				A. J. Gilde, K. A.J.M. van der Lee, P. H.M. Willemsen, G. Chinetti, F. R. van der Leij, G. J. van der Vusse, B. Staels, and M. van Bilsen Peroxisome Proliferator-Activated Receptor (PPAR) {alpha} and PPAR{beta}/{delta}, but not PPAR{gamma}, Modulate the Expression of Genes Involved in Cardiac Lipid Metabolism Circ. Res., March 21, 2003; 92(5): 518 - 524. [Abstract] [Full Text] [PDF]

				E. A. Turvey, G. J. F. Heigenhauser, M. Parolin, and S. J. Peters Elevated n-3 fatty acids in a high-fat diet attenuate the increase in PDH kinase activity but not PDH activity in human skeletal muscle J Appl Physiol, January 1, 2005; 98(1): 350 - 355. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/29/26089    most recent M203997200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Muoio, D. M. Articles by Kraus, W. E. Search for Related Content PubMed PubMed Citation Articles by Muoio, D. M. Articles by Kraus, W. E. Social Bookmarking                      What's this?