HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 29, 26136-26142, July 19, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/29/26136    most recent M200357200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wang, H. Articles by Hays, J. B. Search for Related Content PubMed PubMed Citation Articles by Wang, H. Articles by Hays, J. B. Social Bookmarking                      What's this?

Mismatch Repair in Human Nuclear Extracts

QUANTITATIVE ANALYSES OF EXCISION OF NICKED CIRCULAR MISMATCHED DNA SUBSTRATES, CONSTRUCTED BY A NEW TECHNIQUE EMPLOYING SYNTHETIC OLIGONUCLEOTIDES^*

Huixian Wang and John B. Hays

From the Department of Environmental and Molecular Toxicology, Oregon State University, Corvallis, Oregon 97331

Received for publication, January 11, 2002, and in revised form, May 8, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Mammalian mismatch repair (MMR) systems respond to broad ranges of DNA mismatches and lesions. Kinetic analyses of MMR processing in vitro have focused on base mismatches in a few sequence contexts, because of a lack of general and quantitative MMR assays and because of the difficulty of constructing a multiplicity of MMR substrates, particularly those with DNA lesions. We describe here simple and efficient construction of 11 different MMR substrates, by ligating synthetic oligomers into gapped plasmids generated using sequence-specific N.BstNBI nicking endonuclease, then using sequence-specific nicking endonuclease N.AlwI to introduce single nicks for initiation of 3' to 5' or 5' to 3' excision. To quantitatively assay MMR excision gaps in base-mispaired substrates, generated in human nuclear extracts lacking exogenous dNTPs, we used position- and strand-specific oligomer probes. Mispair-provoked excision along the shorter path from the pre-existing nick toward the mismatch, either 3' to 5' or 5' to 3', predominated over longer path excision by roughly 10:1 to 20:1. MMR excision was complete within 7 min, was highly specific (90:1) for the nicked strand, and was strongly mispair-dependent (at least 40:1). Nonspecific (mismatch-independent) 5' to 3' excision was considerably greater than nonspecific 3' to 5' excision, especially at pre-existing gaps, but was not processive. These techniques can be used to construct and analyze MMR substrates with DNA mismatches or lesions in any sequence context.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Mismatch repair (MMR)¹ protein systems were originally defined by studies that elucidated roles of MutS-homolog (MSH) and MutL-homolog (MLH/PMS) proteins in DNA replication and recombination fidelity (1-3). Both prokaryotic MutS and eukaryotic MSH2·MSH6 (MutS) proteins were shown to recognize base mispairs in short linear synthetic DNA oligoduplexes, but binding to a variety of lesions, including UV light photoproducts (4, 5), O⁶-methylguanine residues (6, 7), 8-oxo-7,8-dihydroguanine (8), and some base adducts (9-12), by mammalian and yeast (8) MutS proteins has also been reported. Mammalian cells lacking either MSH2·MSH6 or MLH1·PMS2 heterodimer proteins are resistant to agents that generate some of these lesions (7, 13-16). The elevated UV mutagenesis seen in MMR-deficient bacterial (17) and rodent cells (18) suggests that MMR processing might correct photoproduct/base mispairs. Beyond such binding experiments, exogenous circular DNA substrates containing specific base mismatches and defined nicks for initiation of excision have been used to analyze MMR error corrections in mammalian cell-free extract (19, 20). These studies have yielded important mechanistic findings, including roles for MutL-homolog proteins, and for other MMR accessory proteins such as proliferating cell nuclear antigen, and demonstration of MMR excision specificity.

Error correction end-products have typically been assayed as restored restriction endonuclease recognition sites or reverted mutations in reporter genes (19, 20). Such assays have not generally been possible with base mismatches in other sequence contexts, or with DNA lesion substrates, except in one special case where the lesion itself was removed by MMR (21), which is not necessarily the biologically relevant response. It is difficult to prepare, in high yield and purity, a multiplicity of MMR substrates, particularly those with a single specific lesion in one strand and a defined single nick for initiation of excision in the other. Here we describe a simple procedure for preparation of MMR substrates and a general but precise MMR excision assay. We quantitatively analyzed the time courses of generation of excision gaps at specific positions in these MMR substrates in human nuclear extracts lacking exogenous dNTPs. Because of the low levels of adventitious nicks in these substrates, MMR excision was highly specific for mispaired versus homoduplex DNA, nicked versus continuous strands, and shorter versus longer nick-mispair paths.

We generated a variety of MMR substrates in high yield, by a new method: direct production of defined gaps in high copy number plasmids using a sequence-specific nicking enzyme, ligation of mismatch-creating synthetic oligomers into these gaps, and introduction of a defined nick using a second such enzyme. We used base-mismatched substrates and analyzed the end-products by restriction endonuclease assay as well, so that excision and error correction endpoints could be compared. However, the MMR excision assay procedures are applicable to DNA mismatches or lesions in any sequence context.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- All oligonucleotides were synthesized by MWG Biotech (High Point, NC). T4 polynucleotide kinase was purchased from Invitrogen. [-³²P]ATP was from PerkinElmer Life Sciences, and Pfu DNA polymerase was from CLONTECH. Endonucleases AseI, AhdI, and N.BstNBI were purchased from New England BioLabs, from whom N.AlwI endonuclease was a generous gift.

Construction of Plasmids-- Plasmid pUC19X was previously derived from pUC19 by removal of all GAGTC sequences (endonuclease N.BstNBI site, see Table I from Ref. 22). The base pair corresponding to the first C:G base pair in the EarI site at position 2488 of the original pUC19 sequence is designated base pair 1 in pUC19X and in its derivative vectors described here (see Table I and Fig. 1 below). Nucleotides (nt) in the sense strands are designated 1, 2,  ... , and the complementary antisense strand nucleotides are designated 1', 2',  ... (sense and antisense strands are defined by the pUC19 bla gene). Plasmid pUC19X was further modified, by PCR-mediated site-specific mutagenesis employing Pfu DNA polymerase, so as to remove all GGATC sequences (endonuclease N.AlwI sites), changing those at nt 699, 769', 785, 866', 883, 1347, 1646', and 1668 to GGACC, GCATC, GAATC, GGATG, GCATC, GGACC, GAATC, and GGACC, respectively. In the product plasmid pUC19Y, we replaced DNA between the unique AatII and SapI sites by a staggered heteroduplex with a single mismatch (in boldface) made by annealing antisense strand oligomer 1 (5'-CATCGAGTCCGATGCGGATATTAATGTGACGGTAGCGAGTCGCTCTTCC) to sense strand oligomer 2 (5'-AGCGGAAGAGCGACTCGCTACCGTCACATTGATATCCGCATCGGACTCGATGACGT). Two new plasmids, each with only two GAGTC sites (underlined), separated by 32 nt on the antisense strand, were created by subsequent segregation of the strands during plasmid replication. The plasmid with an endonuclease AseI recognition site in the inserted sequence was designated pUC19AseI; the other was designated pUC19AseIC to indicate the T:A to C:G base change in the AseI recognition sequence AT(T  C)AAT. Next, the blunt-end homoduplex formed by annealing antisense strand oligomer 3 (5'-CTCGAGCACTCGATCCAAGCTT) to sense strand oligomer 4 (5'-AAGCTTGGATCGAGTGCTCGAG) was inserted into the unique SspI sites of pUC19AseI and pUC19AseIC to create a unique endonuclease N.AlwI site (underlined) on the sense strand, yielding plasmids pUC19CPD and pUC19CPDC, respectively. Plasmid pUC19CPDRev was constructed by inserting a blunt-end homoduplex, formed by annealing antisense strand oligomer 5 (5'-CTCGAGGATCTCGTGCACAGCTT) to sense strand oligomer 6 (5'-AAGCTGTGCACGAGATCCTCGAG) into the SspI site of pUC19AseI, again providing a unique N.AlwI site (underlined) but instead on the antisense strand. All modified sequences were confirmed by direct sequencing, and by restriction digestion where one or more diagnostic sites were available.

Preparation of Gapped Plasmid DNA and Construction of Nicked DNA Substrates-- Plasmids pUC19CPD, pUC19CPDC, and pUC19CPDRev were transferred into Escherichia coli strain SCS110 (dam, endA), which was obtained from CLONTECH. Each plasmid was prepared from 3 liters of overnight LB broth by alkaline lysis and purified by at least two rounds of isopycnic sedimentation in cesium chloride plus ethidium bromide (23). Gapped plasmids were generated from the purified plasmids as previously described (24): nicking at the closely spaced N.BstNBI sites, removal of the oligonucleotides, and purification of gapped product by chromatography on benzoylated and napthoylated DEAE-cellulose. Previously, the yield of plasmid with 22-nt gaps was 30% of input DNA (24). The yield here of plasmids with 32-nt gaps was 50%, presumably because of improved binding to benzoylated and napthoylated DEAE-cellulose by the larger gap. To construct substrates for MMR studies, we annealed a 10-fold excess of oligomer 7, 5'-GCGGATATTAATGTGACGGTAGCGAGTCGCTC, to 50 µg of gapped pUC19CPDC or pUC19CPD plasmid DNA, then purified the ligated product by isopycnic centrifugation in CsCl plus ethidium bromide as previously described (24). The boldface thymine (nt 178') thus created a G/T mismatch (substrate sCPDC(g/t)) or an A/T pair (substrate sCPD(a/t)). Similarly, a 10-fold excess of oligomer 8, 5'-GCGGATATCAATGTGACGGTAGCGAGTCGCTC, was ligated to gapped pUC19CPDRev, so the boldface cytosine (nt 179') created an A/C mismatch (substrate sCPDRev(a/c)). Endonuclease N.AlwI (25), which nicks one strand of double-strand DNA 4 nt 3' to its recognition sequence of (GGATCNNNN, unmethylated adenines only) was used to introduce site-specific nicks into the respective plasmids, yielding substrates sCPD(a/t)n, sCPDC(g/t)n, and sCPDRev(a/c)n (see Table I and Fig. 1). We constructed nine other substrates using oligomers similar to oligomer 7 but with one or two changes (the 5th through 17th base pairs are shown in Table II (lines 2-10; see footnote), which were ligated into gapped pUC19CPDC and processed as described above.

Mismatch Repair Reactions in HeLa Nuclear Extracts-- Nuclear extracts were prepared from HeLaS3 cells (purchased from the National Cell Culture Center, Minneapolis, MN) as previously described (22). Standard MMR mixtures (15 µl) contained 75 fmol (100 ng) of sCPDC(g/t)n or sCPDRev(a/c)n substrate, 100 µg of nuclear extract, and 750 ng of bovine serum albumin, plus the following components at the indicated concentrations: 20 mM Tris-HCl, pH 7.6; 1.5 mM ATP; 1 mM glutathione; 0.1 mM for each of four dNTPs; 5 mM MgCl₂; and 110 mM KCl. Mixtures were incubated at 37 °C for 15 min unless otherwise indicated. Reactions were terminated by the addition of 30 µl of Stop solution (25 mM EDTA, 0.67% sodium dodecyl sulfate, and 90 µg/ml proteinase K). After further incubation of mixture at 37 °C for 15 min, DNA was extracted twice with an equal volume of phenol and precipitated with ethanol. DNA was resuspended in H₂O and digested with 4 units of AseI endonuclease and 1 µg of RNase A at 37 °C for 2 h in 15 µl of AseI digestion buffer (50 mM Tris-HCl, pH 7.9; 100 mM NaCl; 10 mM MgCl₂; and 1 mM dithiothreitol (DTT)). The digested products were separated by electrophoresis in 1% agarose gel in 1× TAE buffer (40 mM Tris acetate, 2 mM EDTA). Correction of (G/T) or (A/C) mismatches to (A/T) restores a second site for AseI endonuclease, which thus cuts the products into 0.8- and 1.2-kb fragments. DNA bands were visualized by staining with ethidium bromide then imaged with UVP ImageStore7500 and analyzed using ImageQuaNT software. The repair yield equals the ratio of the summed intensities of the 0.8- and 1.2-kb fragments to the total of this sum plus the intensity of the 2.0-kb band corresponding to singly cut (uncorrected) DNA.

Analysis of Excision Gaps-- To freeze excision gaps generated during MMR, exogenous dNTPs were omitted from a standard reaction mixture containing nicked mismatched DNA substrate or various control substrates. Incubation was at 37 °C for 7 min, unless otherwise indicated. DNA was extracted and precipitated as described under "MMR Reactions in HeLa Nuclear Extracts" and digested at 37 °C for 2 h with 4 units of AhdI endonuclease plus 1 µg of RNase A in 15 µl of AhdI digestion buffer (20 mM Tris acetate, pH 7.9; 50 mM potassium acetate; 10 mM magnesium acetate, and 1 mM DTT). After 0.5 pmol of a particular ³²P-labeled oligomer probe (Table III) was added, the mixture was incubated at 85 °C for 5 min then slowly cooled down to room temperature. Annealed products were separated from free oligomers by electrophoresis in 1% agarose gels in 1× TAE buffer. After DNA bands from agarose gels were measured quantitatively, as described under "MMR Reactions in HeLa Nuclear Extracts," the gels were dried and the radioactivity in each sample was measured by phosphorimaging. Measurements of DNA bands from agarose gels were used to normalize radioactivity measurements for any variations in DNA recovery and loading.

To test their ability to be converted into corrected products, putative gapped intermediates were generated and purified as above (before treatment with RNase A and AhdI endonuclease) and incubated with 2 units of DNA pol I Klenow fragment (Invitrogen) plus all four dNTPs (17 µM each) in 15 µl of AseI digestion buffer (see above) for 20 min at room temperature. The gap-filling reaction was terminated by heating at 85 °C for 20 min; after cooling, 4 units of AseI endonuclease and 1 µg of RNase A were added to the mixture and the incubation continued at 37 °C for 2 h. Digestion products were separated by 1% agarose gel electrophoresis and analyzed as described under "MMR Reactions in HeLa Nuclear Extracts"; product yields were compared with those obtained from identical HeLa extract MMR reactions using standard reaction conditions.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Preparation of Mismatched DNA Substrates and Comparison of Error Correction and Excision Time Courses-- Plasmids pUC19CPD, pUC19CPDC, and pUC19CPDRev (Table I), which all contain two tandem sites for the sequence-specific nicking endonuclease N.BstNBI, separated by 32 nt on the antisense strand, were used to produce gaps into which mismatch-creating oligomers were ligated (Tables I and II). Nicking at respective sites for a recently described second such enzyme, endonuclease N.AlwI (25), provides points for initiation of 5' to 3' or 3' to 5' MMR excision along the shorter paths toward the mismatches (Table I and Fig. 1). Beginning with 400 µg of plasmid DNA, we routinely obtain 200 µg of gapped plasmid. Typically, ligation of 50 µg of gapped plasmid with excess oligomer yields 20-25 µg of purified product. In substrate sCPDC(g/t)n, 3' to 5' excision of the sense strand along the shorter nick-mispair path removes the guanine nucleotide at nt 178, and DNA resynthesis restores a recognition site for endonuclease AseI. In substrate sCPDRev(a/c)n, 5' to 3' excision of the antisense strand removes the cytosine at nt 179, and resynthesis again restores the AseI site.

View larger version (12K): [in this window] [in a new window]   Fig. 1.   Substrates and probes for MMR studies. Construction of these and other DNA substrates and plasmids is described under "Experimental Procedures," and the relevant properties are summarized in Table I. Coordinates 1 and 1' designate respective nucleotides in sense (3' to 5') and antisense (5' to 3') strands relative to the bla gene at the first base pair in the EarI endonuclease site in pUC19 and its derivatives. Numbering is clockwise as shown. Approximate sites of restriction endonucleases cleaving both DNA strands (AseI, AhdI, and EarI), or only the strand indicated (N.AlwI, N.BstNBI), are indicated. Heavy bars indicate positions and strand collinearity of probes (italicized) (see Table I). A, substrates sCPDC(g/t)n and sCPD(a/t)n. Position of nick generated by N.AlwI endonuclease at coordinate 23 for initiation of 3' to 5' excision toward the mispair region is indicated. Letters [(T), (G or A)] in regions covered by probes D and A refer to antisense-strand thymine and sense-strand guanine or adenine, respectively, creating a T/G mispair or a T/A homopair at coordinate 178. B, substrate sCPDRev(a/c)n. Position of nick generated by endonuclease N.AlwI at coordinate 30' for initiation of 5' to 3' excision toward the mispair is indicated. Non-italicized letters [(C), (A)] in the region covered by probe I refer to C/A mispair at coordinate 179'.

We compared time courses of MMR error correction and excision in HeLa extracts, with or without exogenous dNTPs. The substrate sCPDC(g/t)n contains a G/T mispair at bp 178/178', and a nick 3' to the G, at nt 23 (Table I). In repeated experiments, yields of corrected product, now cleavable by AseI endonuclease at both bp 178 and 1381, reached plateau levels of 30-45% of input substrates after 8-10 min (Fig. 2, A and D, open circles). Product yields remained constant for up to 30 min (data not shown). MMR excision, assayed as the appearance of single-strand DNA bound by radiolabeled probe A and collinear with the nicked strand at nt 170-201 (Table III and Fig. 1), preceded error correction by 50 s at half-maximal yields, reaching a plateau after ~6 min (Fig. 2, B-D, filled squares). Supercoiled DNA substrate sCPDC(g/t) showed no detectable restoration of the AseI site at bp 178 (<3% of input plasmid, data not shown) and only low background levels of excision of either strand at bp 170-201 under gap generation conditions (Table III).

View larger version (36K): [in this window] [in a new window]   Fig. 2.   Time course of MMR error correction and excision. A, standard MMR error correction. Lane 1 corresponds to reaction terminated at time zero without 37 °C incubation, and lanes 2-14 correspond to reactions terminated at 40 and 80 s, and at the times indicated in Fig. 2D (open circles). B-D, excision assay. Incubation of 900 fmol of DNA substrate sCPDC(g/t)n with 1200 µg of nuclear extract in 180 µl of standard MMR mixture lacking exogenous dNTPs at 37 °C, removal of 15-µl aliquots at indicated time points, digestion with proteinase K, DNA extraction, digestion with AhdI endonuclease, annealing to 32P-labeled probe A, analysis by gel electrophoresis, and autoradiography, as described under "Experimental Procedures." B, agarose gel stained with ethidium bromide; C, autoradiography of dried agarose gel. Lane 1, aliquot before 37 °C incubation; lanes 2-11, removal of aliquots after incubation at 37 °C with extract for times indicated in D (filled squares): 40, 80, 120, 160, 200, 240, 280, 320, 360, and 400 s, respectively. D, amounts of corrected product relative to yields at 10 min () and phosphorimaged excision-probe signals relative to plateau value at 360 s ().

To calibrate excision yields against corrected-product yields, we incubated substrate sCPDC(g/t)n for 7 min in extracts lacking exogenous dNTPs and isolated the DNA, which was insensitive to cleavage by AseI endonuclease at bp 178 (Fig. 3, lane 2). Thus, yields of corrected product in the absence of exogenous dNTPs were <0.05 of those obtained in their presence, in contrast with previous reports of as much as 0.40 of normal yields (26). Incubation of this putative gapped intermediate DNA with DNA polymerase I Klenow fragment and dNTPs produced corrected products in 38% yield (Fig. 3, lane 3), in good agreement with the 40% yield in the standard reaction (Fig. 3, lane 1). Thus, excision in the absence of dNTPs produces competent MMR intermediates, and plateau levels of both corrected products and excision intermediates correspond to the same yields, ~40%.

View larger version (43K): [in this window] [in a new window]   Fig. 3.   Treatment of gapped DNA intermediate with DNA polymerase. Incubation of 75 fmol of substrate sCPDC(g/t)n with 100 µg of nuclear extract at 37 °C in 15 µl of complete MMR reaction or in mixtures lacking exogenous dNTPs, extraction of DNA, subsequent gap-filling DNA synthesis with pol I Klenow fragment as indicated, digestion with AseI endonuclease, and electrophoresis, as described under "Experimental Procedures." Lane 1, standard 15-min MMR incubation with added exogenous dNTPs and AseI endonuclease digestion of extracted DNA. Lane 2, 7-min incubation without exogenous dNTPs, and AseI endonuclease digestion of extracted DNA. Lane 3, 7-min incubation without exogenous dNTPs, then treatment of extracted DNA with polymerase I Klenow with four dNTPs at 17 µM final concentration, before AseI endonuclease digestion and electrophoresis.

To determine whether these plateaus reflected rapid exhaustion of one or more rate-limiting components, we measured corrected product after 15-min incubation of substrates at concentrations of 2.5 to 15 nM (inputs of 37.5, 75, 150, and 225 fmol). Product yields (13.9, 29.7, 63.0, and 91.5 fmol) were ~40% in each case. In a similar experiment with substrate sCPDRev(a/c)n, in which a nick at nt 30' is 5' to an A/C mispair that disrupts an AseI endonuclease recognition site at bp 179/179' (Table I), the same amounts of input substrates resulted in product yields of 14.5, 28.8, 59.5, and 82.1 fmol, again directly proportional to substrates. Fang and Modrich (26), noting rapid conversion of nicked into full-length strands during MMR incubations, suggested that competing ligation limited product yields. In confirmation, we found that almost all (initially nicked) DNA migrated as closed circles after 15-min MMR incubation, that incubation of recovered DNA with fresh extract for another 15 min only negligibly increased product yields, and that even 20-min incubation on ice sealed roughly one-third of the nicked substrate, reducing the product yield in a subsequent 37 °C incubation by one-third (data not shown).

To illustrate the utility of these substrate preparation and excision assay techniques, we prepared nine additional MMR substrates, incorporating the other seven base mispairs and two extrahelical nucleotide (loop) substrates in virtually the same sequence context as the G/T in sCPD(g/t)n. This was achieved by using nine different oligomers but with a single preparation of gapped pUC19CPDC. We assayed 3' to 5' excision initiated at a nick ~155 nt away (Table II) using a 30-mer radiolabeled probe immediately 3' to the guanine in the G/T mispair. Excision signals, which presumably reflect efficiencies of excision initiation versus competing ligation, ranged from 0.42 to 1.14 of G/T values, in general, but not complete, agreement with previous studies (19, 20, 26-28).

Specificity of MMR Excision-- We used different oligomer probes to compare plateau (7-min) signals for excision of nicked and continuous strands, at various positions inside and outside the shorter nick-mispair paths in 3'-(G/T) and 5'-(A/C) substrates and in homoduplex substrates (Figs. 1 and 4 and Table III). Specific radioactivities of the respective probes were closely similar, and probes were designed to have similar duplex thermal stabilities and thus similar annealing efficiencies. For the nicked substrates sCPDC(g/t)n and sCPDRev(a/c)n, plateau signals for shorter path excision of nicked strands at positions most proximal to the nicks (Fig. 1 and Table III, probes C and J, respectively) were assigned relative values of 1.0 and equated with plateau error correction yields for the same substrates (~40 and 35%, respectively), based on the two-stage gap-filling experiments described above (Fig. 3 and data not shown). To estimate background signals that might arise from annealing of probes to gaps generated by excision initiated at adventitious nicks, we measured excision 1 kb away from the nick mispair region, at nt 953-986 (probe E). These very low background signals, 0.04 and 0.02, respectively, for sCPDC(g/t)n and sCPD(a/t)n, contrast with previous reports of incorporation of one-fifth as much as [-³²P]dTTP outside the shorter nick-mispair path as within (19). For substrate sCPDC(g/t)n, plateau excision signals slightly decreased along the shorter (3' to 5') path from the nick toward the mismatch (Table III, probes C, B, and A), whereas signals for excision along the 5' to 3' nick-mispair path in substrate sCPDRev(a/c)n were nearly the same (probes J and I). This may reflect limited DNA synthesis near the 3' to 5' excision end point, using residual dNTPs in the extracts. To assess the specificity of 3' to 5' excision for mispaired DNA, we compared shorter path excision signals (probes A, B, and C) for substrate sCPDC(g/t)n versus sCPD(a/t)n, respectively, 0.90 to 1.00 and 0.04 to 0.05. If the excision signals are each corrected for adventitious background (probes A, B, and C versus probe E), the final values, 0.87 to 0.97 for sCPDC(g/t)n and 0.02 to 0.03 for sCPD(a/t)n, correspond to a mismatch:homoduplex DNA specificity of roughly 40:1.

View larger version (46K): [in this window] [in a new window]   Fig. 4.   Analysis of MMR excision gap formation at different positions. Incubation of 450 fmol of DNA substrates indicated below with 600 µg of nuclear extract in 90-µl mixtures with standard MMR components but without exogenous dNTPs, for 7 min at 37 °C, extraction of DNA, treatment with AhdI endonuclease in 75 µl AhdI Digestion Buffer, annealing of 15-µl of the digested DNA to 0.5 pmole of one of the indicated probes, and electrophoresis and autoradiography, as described under "Experimental Procedures." Data are summarized in Table III. Nearly identical values were obtained from another set of independent experiments.

The signal for (G/T)-provoked shorter path excision of the continuous strand of sCPDC(g/t)n is 0.03, already near the background level of 0.02. Comparison with background-corrected signals for nicked strand excision (0.87-0.97, see above), yields a minimum nicked:continuous strand specificity of roughly 90:1.

To compare (G/T) mispair-provoked excision along the shorter (3' to 5') versus the longer (5' to 3') nick-mispair path, it is necessary to estimate the contribution of nonspecific 5' to 3' excision to the high gap signal 45 nt from the nick along the longer (5' to 3') path in sCPDC(g/t)n (probe F, Fig. 4 and Table III). Some of this signal of 1.25 presumably corresponds to nonspecific nick-initiated 5' to 3' excision, which in homoduplex DNA yields a (probe F) signal of 0.40. Much of the remainder of 5' to 3' excision of sCPDC(g/t)n might be accounted for if it were stimulated by gaps, in this case generated by mispair-provoked 3' to 5' excision in the opposite direction. Indeed, almost all (0.96) of (non-nicked) substrate sCPDgap molecules initiate 5' to 3' excision at the single pre-existing gap (probe H, Table III). Thus, for 0.96 of the (40% of total) sCPDC(g/t)n substrates showing a mispair-provoked 3' to 5' excision signal of 1.00, concomitant gap-initiated nonspecific 5' to 3' would generate a signal of 0.96. In the remaining 60% of sCPDC(g/t)n substrate, nick-initiated nonspecific 5' to 3' excision would generate a signal of 0.24 (60% of 0.40). The sum of 1.20 accounts for all but 0.05 of the probe F signal for sCPDC(g/t)n, suggesting a ratio of roughly 20 (that is, 1.00/0.05) for shorter path (3' to 5')-specific versus longer path (5' to 3')-specific mispair-provoked excision. Whatever the source, even the relatively potent longer path 5' to 3' excision appears to be non-processive (compare probe E versus probe F signals for sCPDC(g/t)n in Table III). For substrate sCPDRev(a/c)n, in which the shorter nick-mispair path lies 5' to 3', similar correction of the apparent longer path 3' to 5' excision (probe K, Table III) for nonspecific nick- and gap-initiated 3' to 5' excision, yields a shorter versus longer path specificity of roughly 10:1.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We describe here a simple and general technique to obtain, in high yield and purity, a wide variety of DNA substrates for analysis of MMR processing. Key elements are production of gapped plasmids using a commercially available sequence-specific nicking enzyme, covalent incorporation of short synthetic DNA oligomers, and subsequent nicking of the purified ligation product using a second such enzyme. Previously, a 22-nt gap/oligomer was used successfully; here we have illustrated the use of 32-nt gaps/oligomers to construct 11 different substrates with different mismatches in almost identical sequence contexts. Where correction of mismatches was assayable as restoration of restriction endonuclease sites, the nicks directed correction of 30-45% of input substrates, within the range of previous reports (7), and correction in the absence of the specific nick was essentially undetectable. The plasmids used to generate these substrates are genetically much more amenable to modification than bacteriophage genomes; thus it is simple to change the sequence context of a mismatch or DNA lesion target for MMR processing, to move the nick site from one strand to the other, or to vary its distance from the mismatch. Duckett et al. (21) previously prepared gapped circular DNA by annealing circular single-stranded phage DNA to linear double-stranded phage DNA lacking 51 bp at one end, then non-covalently incorporated a lesion-containing 51-mer, such that both 5' to 3' and 3' to 5' excision might initiate from the nearby flanking nicks.

We have assayed MMR excision of specific strands at specific points, using oligomeric probes that bind to gaps generated in the absence of exogenous dNTPs and electrophoresce in association with the respective substrates. Using this assay, which does not depend on restoration of restriction endonuclease sites or reporter gene sequences, it is now possible to kinetically analyze MMR responses to a wide range of mismatches or DNA lesions, inserted into virtually any sequence context via the new substrate construction technique. Because essentially all excised intermediates could be converted to final (corrected) products, excision and error correction time courses could be quantitatively compared here.

MMR excision measured by this assay showed high specificity. The preference for nicked versus the continuous strand along the shorter path of a 3'-(G/T) substrate was roughly 90:1, considerably higher than previous reports (19, 26), and the specificity for this mispair-provoked excision versus that for a nicked homoduplex, a parameter not quantitatively determined previously, was ~40:1. The high strand specificity may reflect lower levels of adventitious nicks in these substrates, which are one-third the size of the phage DNA molecules typically used previously and are not subjected to extensive manipulation during preparation.

After correcting the respective apparent 5' to 3' and 3' to 5' longer path excision signals in mispaired substrates sCPDC(g/t)n and sCPDRev(a/c)n, for both nonspecific nick-initiated excision and nonspecific gap-initiated excision concomitant with mispair-provoked shorter path excision, the preferences of MMR excision for the shorter nick-mispair paths were estimated to be 20:1 or 10:1. These analyses are consistent with previous mapping of MMR excision gaps: in substrates where the shorter nick-(G/T) path was 3' to 5', a broad range of endpoints for the 3' termini of the gaps, spanning several hundred nucleotides from the nick position, were detected by indirect end labeling. However, in substrates where the shorter path was 5' to 3', the range of endpoints at the 5' termini of the gaps was much narrower (26), indicating much less 3' to 5' than 5' to 3' nonspecific excision. Previous mapping of excision tracts during E. coli MMR also showed shorter path excision to be favored over longer path (29).

The potent nonspecific 5' to 3' exonuclease activity seems not to generally result in MMR-independent mispair correction. Our analyses here and in the accompanying paper (30) show shorter path 3' to 5' and 5' to 3' excision provoked by G/T or A/C mispairs to be equally efficient, despite the large disparity in the respective nonspecific excision efficiencies. Also, other workers previously showed that extracts deficient in hMSH2, hMSH6, or hMLH1 proteins showed no correction of (G/T) or other mispairs, i.e. there was little or no nonspecific 5' to 3' excision initiated at a nick 128 nt away to remove the mismatches (7, 31, 32). However, for substrates with poorly recognized mispairs or DNA lesions, especially close to nicks, nonspecific shorter path 5' to 3' excision might be relatively significant, so nick-mismatch (lesion) distances should be as long as practical if a 5'-nicked substrate is used.

The high specificity of the excision assay warrants quantitative comparison of the plateau excision signals generated by a series of mismatches in closely similar sequence contexts (Table II). Six of the eight possible base mispairs and an extrahelical thymine stimulate excision with roughly the same efficiencies (1 ± 0.13). The C/C and A/G mispairs are less than half as efficient in this context, even less than a 4-extrahelical nucleotide substrate, whose repair presumably involves recognition by hMSH2·hMSH3. Comparisons with other studies (19, 20, 26-28), which show somewhat different substrate specificities, suggest that MMR efficiency can be strongly influenced by sequence contexts, as proposed previously (33).

	ACKNOWLEDGEMENT

We thank Dr. Andrew Buermeyer for critical reading of the manuscript and helpful suggestions.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant ES09848 (to J. B. H.). This is contribution 11907 from the Oregon Agricultural Experimental Station.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Environmental and Molecular Toxicology, Oregon State University, ALS 1007, Corvallis, OR 97331. Tel.: 541-737-1777; Fax: 541-737-0497; E-mail: haysj@bcc.orst.edu.

Published, JBC Papers in Press, May 10, 2002, DOI 10.1074/jbc.M200357200

	ABBREVIATIONS

The abbreviations used are: MMR, mismatch repair; hMutS, MSH2·MSH6 heterodimer; nt, nucleotide(s); DTT, dithiothreitol.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H. Wang and J. B. Hays Human DNA mismatch repair: coupling of mismatch recognition to strand-specific excision Nucleic Acids Res., November 29, 2007; 35(20): 6727 - 6739. [Abstract] [Full Text] [PDF]

				E. W. Hou, R. Prasad, K. Asagoshi, A. Masaoka, and S. H. Wilson Comparative assessment of plasmid and oligonucleotide DNA substrates in measurement of in vitro base excision repair activity Nucleic Acids Res., September 27, 2007; 35(17): e112 - e112. [Abstract] [Full Text] [PDF]

				S.-Y. Xu, Z. Zhu, P. Zhang, S.-H. Chan, J. C. Samuelson, J. Xiao, D. Ingalls, and G. G. Wilson Discovery of natural nicking endonucleases Nb.BsrDI and Nb.BtsI and engineering of top-strand nicking variants from BsrDI and BtsI Nucleic Acids Res., July 9, 2007; 35(14): 4608 - 4618. [Abstract] [Full Text] [PDF]

				G. Plotz, C. Welsch, L. Giron-Monzon, P. Friedhoff, M. Albrecht, A. Piiper, R. M. Biondi, T. Lengauer, S. Zeuzem, and J. Raedle Mutations in the MutS{alpha} interaction interface of MLH1 can abolish DNA mismatch repair Nucleic Acids Res., December 2, 2006; 34(22): 6574 - 6586. [Abstract] [Full Text] [PDF]

				P. Modrich Mechanisms in Eukaryotic Mismatch Repair J. Biol. Chem., October 13, 2006; 281(41): 30305 - 30309. [Full Text] [PDF]

				S. J. York and P. Modrich Mismatch Repair-dependent Iterative Excision at Irreparable O6-Methylguanine Lesions in Human Nuclear Extracts J. Biol. Chem., August 11, 2006; 281(32): 22674 - 22683. [Abstract] [Full Text] [PDF]

				L. M. Karnitz, K. S. Flatten, J. M. Wagner, D. Loegering, J. S. Hackbarth, S. J. H. Arlander, B. T. Vroman, M. B. Thomas, Y.-U. Baek, K. M. Hopkins, et al. Gemcitabine-Induced Activation of Checkpoint Signaling Pathways That Affect Tumor Cell Survival Mol. Pharmacol., December 1, 2005; 68(6): 1636 - 1644. [Abstract] [Full Text] [PDF]

				Y. Yang, L. E. Sass, C. Du, P. Hsieh, and D. A. Erie Determination of protein-DNA binding constants and specificities from statistical analyses of single molecules: MutS-DNA interactions Nucleic Acids Res., August 1, 2005; 33(13): 4322 - 4334. [Abstract] [Full Text] [PDF]

				J. Kang, S. Huang, and M. J. Blaser Structural and Functional Divergence of MutS2 from Bacterial MutS1 and Eukaryotic MSH4-MSH5 Homologs J. Bacteriol., May 15, 2005; 187(10): 3528 - 3537. [Abstract] [Full Text] [PDF]

				Y.-M. Huang, S.-U. Chen, S. D. Goodman, S.-H. Wu, J.-T. Kao, C.-N. Lee, W.-C. Cheng, K.-S. Tsai, and W.-h. Fang Interaction of Nick-directed DNA Mismatch Repair and Loop Repair in Human Cells J. Biol. Chem., July 16, 2004; 279(29): 30228 - 30235. [Abstract] [Full Text] [PDF]

				D. Martik, C. Baitinger, and P. Modrich Differential Specificities and Simultaneous Occupancy of Human MutS{alpha} Nucleotide Binding Sites J. Biol. Chem., July 2, 2004; 279(27): 28402 - 28410. [Abstract] [Full Text] [PDF]

				H. Wang and J. B. Hays Mismatch Repair in Human Nuclear Extracts: EFFECTS OF INTERNAL DNA-HAIRPIN STRUCTURES BETWEEN MISMATCHES AND EXCISION-INITIATION NICKS ON MISMATCH CORRECTION AND MISMATCH-PROVOKED EXCISION J. Biol. Chem., August 1, 2003; 278(31): 28686 - 28693. [Abstract] [Full Text] [PDF]

				H. Wang and J. B. Hays Mismatch Repair in Human Nuclear Extracts. TIME COURSES AND ATP REQUIREMENTS FOR KINETICALLY DISTINGUISHABLE STEPS LEADING TO TIGHTLY CONTROLLED 5' TO 3' AND APHIDICOLIN-SENSITIVE 3' TO 5' MISPAIR-PROVOKED EXCISION J. Biol. Chem., July 12, 2002; 277(29): 26143 - 26148. [Abstract] [Full Text] [PDF]

This Article