![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 29, 26444-26451, July 19, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
,
,
,
, and
From the
Department of Biochemical Genetics, Medical
Research Institute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo 113-8510, the § Medical Institute
of Bioregulation, Kyushu University and Core Research for Evolutional
Science and Technology (CREST), Japan Science and Technology
Corporation, 3-1-1, Maidashi, Higashi-ku, Fukuoka 812-8582, and the
Departments of ¶ Chemistry and
Pathology, Faculty of
Medicine, Kochi Medical School, Kohasu, Oko-cho, Nankoku,
Kochi 783-8505, Japan
Received for publication, March 25, 2002, and in revised form, May 1, 2002
| |
ABSTRACT |
|---|
|
|
|---|
The Elongin complex stimulates the rate of
transcription elongation by RNA polymerase II by suppressing the
transient pausing of the polymerase at many sites along the DNA
template. Elongin is composed of a transcriptionally active A subunit
and two small regulatory B and C subunits, the latter binding stably to
each other to form a binary complex that interacts with Elongin A and strongly induces its transcriptional activity. To further understand the role of Elongin A in transcriptional regulation by RNA polymerase II, we are attempting to identify Elongin A-related proteins. Here, we
report on the molecular cloning, expression, and biochemical characterization of human Elongin A3, a novel transcription elongation factor that exhibits 49 and 81% identity to Elongin A and the recently
identified Elongin A2, respectively. The mRNA of Elongin A3 is
ubiquitously expressed, and the protein is localized to the nucleus of
cells. Mechanistic studies have demonstrated that Elongin A3 possesses
similar biochemical features to Elongin A2. Both stimulate the rate of
transcription elongation by RNA polymerase II and are capable of
forming a stable complex with Elongin BC. In contrast to Elongin A,
however, their transcriptional activities are not activated by Elongin
BC. Structure-function analyses using fusion proteins composed of
Elongin A3 and Elongin A revealed that the COOH-terminal region of
Elongin A is important for the activation by Elongin BC.
The synthesis of messenger RNA in eukaryotes is a complex
biochemical process controlled by the concerted action of a set of
general transcription factors that regulate the activity of RNA
polymerase II during the initiation and elongation stages of
transcription. At least six general transcription initiation factors
(TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and
TFIIH)1 have been identified
in eukaryotic cells and found to promote the selective binding of RNA
polymerase II to promoters and to support a basal level of
transcription (1). In addition to the general initiation factors, at
least 16 elongation factors have been defined biochemically and found
to increase the efficiency of transcription elongation by RNA
polymerase II (2-5).
Among the elongation factors, SII and P-TEFb prevent RNA polymerase II
from prematurely arresting transcription. SII does this by promoting
passage of the polymerase through a variety of transcriptional
impediments, including DNA sequences that act as intrinsic arrest sites
and DNA-bound proteins and drugs (6). P-TEFb catalyzes the conversion
of early, termination-prone elongation complexes into productive
elongation complexes (7). The rest of the elongation factors such as
TFIIF (8), Elongin A (9), Elongin A2 (10), ELL (11), and the Cockayne
syndrome group B protein (CSB) (12), act to increase the overall rate
of RNA chain elongation by RNA polymerase II by decreasing the
frequency and/or duration of transient pausing of the polymerase at
sites along the DNA template.
Elongin was initially identified as a heterotrimer composed of A, B,
and C subunits of ~770, 118, and 112 amino acids, respectively (9,
13-15). Elongin A is the transcriptionally active component of the
Elongin complex, whereas Elongins B and C are positive regulatory
subunits. Biochemical studies have shown that Elongins B and C form a
stable Elongin BC complex that binds to Elongin A and strongly induces
its transcriptional activity (9, 16). Elongin C functions as the
inducing ligand and activates transcription through interaction with a
short conserved motif (consensus sequence (T/S)LXXXCXXX(V/L/I)) in the elongation
activation domain of Elongin A (16). Elongin B, a member of the
ubiquitin homology protein family, appears to play a chaperone-like
role in the assembly of the Elongin complex by binding to Elongin C and
facilitating its interaction with Elongin A (9, 15). Notably, Elongins B and C are also found as integral components of a multisubunit complex
containing the product of the von Hippel-Lindau (VHL) tumor suppressor
gene (17, 18). Elongin A and the VHL protein share the Elongin BC
binding site motif, and, consistent with the assumption of a role for
Elongin BC in tumor suppression, >70% of VHL mutations found in VHL
families and sporadic clear cell renal carcinomas are associated with a
mutation or deletion at this site, and in all the cases tested these
mutant VHL proteins exhibited substantially reduced binding to
Elongin BC (17, 19).
As part of our effort to understand the function, mechanism of action,
and regulation of the Elongin complex, we are attempting to identify
members of the Elongin family. In this report, we describe the
identification and biochemical characterization of Elongin A3, a novel
Elongin A-related RNA polymerase II elongation factor from human cells.
Materials--
Unlabeled ultrapure ribonucleoside
5'-triphosphate and [ Isolation of Human Elongin A3 cDNA--
The data base of
human expressed sequence tags (ESTs) was searched with the human
Elongin A cDNA sequence (20) and a 589-base pair sequence
(accession no. AW090822), part of which had exhibited homology to the
5'-end of the coding regions of both Elongin A and Elongin A2 cDNAs
(10), was found in a human brain EST data base. The genomic data base
was then searched with this 589-base pair cDNA sequence as the
query, and it was revealed that part of the sequence on human
chromosome 18 (accession no. AC011814) contained this fragment and
sequences that have homology to the rest of the regions of both Elongin
A and Elongin A2 cDNAs. The full-length human Elongin A3 cDNA
was obtained by PCR of the Marathon-Ready placenta cDNA
(CLONTECH) with an Elongin A3-specific 5'-primer (5'-ATGGCGGCAGGGTCCACTACGCTG-3') and 3'-antisense primer
(5'-TTATCGTCGGGAGAATCTTCCCTTG-3') using KOD DNA polymerase (TOYOBO).
DNA Sequencing and Northern Blot Analysis--
DNA sequencing
was performed using an automated sequencer (ABI Prism 310, Applied
Biosystems). Human multiple tissue Northern blots I and II
(CLONTECH) containing 2 µg of poly(A)+ RNA per sample were hybridized using ExpressHyb solution
(CLONTECH) under stringent conditions as
recommended by the manufacturer. The Elongin A3 probe contained
sequences encoding amino acids 1-546, and the Elongin A probe
contained sequences encoding amino acids 263-772. The Elongin A3 and
Elongin A signals were quantitated by densitometry of autoradiograms,
and the blot was stripped and reprobed using Plasmids for the Expression of Wild-type and Mutant Elongin
A3--
The coding region of human Elongin A3 was amplified by KOD
DNA polymerase using the primers
5'-AAGGTCGCTAGCATGGACTACAAGGACGACGATGACAAGGCGGCAGGGTCCACTACGCTGCG and 5'-CGGAATTCTTATCGTCGGGAGAATCTTCCCTTG. The amplified 1.65-kb fragment was digested with NheI and EcoRI and
cloned into the vector pBacPAK-His2 (CLONTECH) to
generate a plasmid (pBacPAK-hEloA3) for the expression of a wild-type
Elongin A3 containing hexahistidine and FLAG tags at its
NH2 terminus. For expression in mammalian cells, the same
fragment was subcloned into the pCI-neo vector (Promega) to generate
pCI-hEloA3. Constructs expressing Elongin A3 mutants (A3 M and A3-A-A3)
were generated by oligonucleotide-directed mutagenesis of
pBacPAK-hEloA3 using the QuikChange site-directed mutagenesis kit
(Stratagene). Constructs expressing Elongin A-Elongin A3 chimeric
proteins (A3-A (532) and A3-A (490)) were generated by overlap
extension PCR using KOD DNA polymerase.
Expression of Recombinant Proteins in Insect
Cells--
Spodoptera frugiperda (Sf9) cells were
cultured as monolayers in Grace's insect medium (Invitrogen)
supplemented with 10% fetal bovine serum (JRH Biosciences) at
27 °C. A recombinant transfer plasmid containing either wild-type or
mutant Elongin A3 cDNA was cotransfected with
Bsu36I-digested BacPAK6 virus DNA
(CLONTECH) into Sf9 cells by
Lipofectin-mediated (Invitrogen) transfection, and the resultant viral
pool was collected 4 days later and amplified three times. For
expression of the recombinant proteins, Sf9 cells were seeded at
a density of 2 × 107 cells per 175-cm2
flask and infected with recombinant baculoviruses at a multiplicity of
infection (m.o.i.) of 10-20. At 60-72 h after infection, the cells
were gently dislodged from the culture flasks, collected by
centrifugation at 1000 × g for 10 min at 4 °C, and
washed once with 10 ml of ice-cold buffer A (20 mM
Tris-HCl, pH 7.9, 500 mM NaCl, 0.1% Nonidet P-40, and 1 mM dithiothreitol). The cell pellets were
resuspended in 5 ml of lysis buffer (20 mM Tris-HCl, pH
7.9, 500 mM NaCl, 0.1% Nonidet P-40, 0.5 mM
PMSF, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 mM
benzamidine) and lysed by brief sonication. The cell lysates were then
clarified by centrifugation for 20 min at 100,000 × g
to remove insoluble materials. Recombinant proteins were purified from
the soluble fraction of lysates using Ni2+-agarose and
anti-FLAG M2-agarose (Sigma) affinity chromatography. Each supernatant
(5 ml) was applied to a 1-ml Ni2+-agarose column
pre-equilibrated in lysis buffer containing 5 mM imidazole
(pH 7.9) and incubated for 30 min at 4 °C. The column was then
washed with 20 ml of lysis buffer containing 10 mM
imidazole (pH 7.9). The recombinant proteins were eluted with 10 ml of
lysis buffer containing 300 mM imidazole (pH 7.9), and the
peak fractions of each eluate were dialyzed against the IP buffer (20 mM Tris-HCl, pH 7.9, 300 mM NaCl, and 0.1%
Nonidet P-40). The dialyzed samples were then applied to anti-FLAG
M2-agarose beads (200 µl) and incubated for 3-6 h at 4 °C. The
beads were washed five times with 1 ml of IP buffer, and bound proteins
were eluted with a buffer containing 20 mM Tris-HCl, pH
7.9, 100 mM NaCl, 0.1% Nonidet P-40, and 200 µg/ml of
FLAG peptide. Aliquots of the eluates were used for SDS-PAGE and
in vitro transcription elongation assay.
Oligo(dC)-tailed Template Assay of Transcription Elongation by
RNA Polymerase II--
RNA polymerase II was purified as described
from rat liver nuclear extracts (21). Pulse-chase assays were carried
out essentially as reported previously (9). RNA polymerase II (0.01 units) and 100 ng of pCpGR220S/P/X were incubated at 28 °C in the
presence of 20 mM Hepes-NaOH, pH7.9, 20 mM
Tris-HCl, pH 7.9, 2% (w/v) polyvinyl alcohol, 0.5 mg/ml of bovine
serum albumin, 60 mM KCl, 50 µM
ZnSO4, 7 mM MgCl2, 0.2 mM dithiothreitol, 3% (v/v) glycerol, 3 units of
recombinant ribonuclease inhibitor, 50 µM ATP, 50 µM GTP, 2 µM CTP, and 10 µCi
[ Assay of Runoff Transcription--
Pre-initiation complexes were
assembled by pre-incubation of 50 ng of the
EcoRI-NdeI fragment from pDN-AdML (9) and 10 ng
of TFIIB, 10 ng of TFIIF, 7 ng of TFIIE, 40 ng of TFIIH, 50 ng of yeast
TBP, and 0.01 units of RNA polymerase II. Transcription was
initiated by the addition of 7 mM MgCl2, 50 µM ATP, 2 µM UTP, 10 µM CTP,
50 µM GTP, and 10 µCi [ In Vitro Protein-Protein Interaction Assays--
Recombinant
baculoviruses expressing human Elongin A3 or rat Elongin A with both
polyhistidine and FLAG epitope tags at their NH2 termini
were introduced into Sf9 cells either with or without baculoviruses expressing untagged rat Elongins B and C. The cells were
harvested 60-72 h postinfection, resuspended in lysis buffer (20 mM Tris-HCl, pH 7.9, 500 mM NaCl, 0.1% Nonidet
P-40, 0.5 mM PMSF, 5 µg/ml of leupeptin, 5 µg/ml of
aprotinin, and 1 mM benzamidine), and lysed by brief
sonication. The cell lysates were incubated for 2 h at 4 °C
with ~100 µl of Ni2+-agarose pre-equilibrated in lysis
buffer containing 20 mM imidazole (pH 7.9) and then
centrifuged for 1 min at 2000 rpm. Following centrifugation, the
supernatants containing the unbound proteins were collected, and the
Ni2+-agarose was washed four times by resuspension in 1 ml
of lysis buffer containing 20 mM imidazole (pH 7.9) and
centrifuged for 1 min at 2000 rpm. Finally, bound proteins were eluted
with 200 µl of lysis buffer containing 300 mM imidazole
(pH 7.9). Aliquots of loaded and bound fractions were subjected to
SDS-PAGE, transferred to a polyvinylidene difluoride membrane
(Millipore), and probed with the appropriate antibody.
Immunostaining of Cells--
COS7 cells were cultured in
Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum and transiently transfected with the pCI-hEloA3 DNA using
SuperFect (Qiagen) according to the manufacturer's protocol. The cells
grown in a chamber slide were fixed by immersion in cold
acetone/methanol (1:1) for 10 min and then rinsed with 70% ethanol,
50% ethanol, and finally phosphate-buffered saline (PBS). After
blocking in PBS containing 2% bovine serum albumin, 0.2% Tween 20, and 6.7% glycerol at 4 °C overnight, the cells were incubated with
anti-FLAG antibody (1:1000) for 1 h, washed with PBS, and
sequentially incubated with fluorescence-labeled anti-mouse
immunoglobulin G antibody (1:5000) for 30 min. For staining of nuclei,
cells were treated with 4',6-diamidino-2-phenylindole dihydrochloride
(DAPI) from Nacalai Tesque.
Isolation of a cDNA Clone for Human Elongin A3--
To study
the possible existence of a novel member of the Elongin protein family,
a data base of human expressed sequence tags was searched with the
human Elongin A sequence (20) as the query. One expressed sequence tag
clone (accession no. AW090822) found in a brain data base showed 56%
identity to the 5'-end of the coding region of human Elongin A at the
amino acid level. Subsequent searches using this fragment as a query
identified not only DNA sequences that contained this entire fragment
but also sequences with homology to the rest of the coding region of
both Elongin A and Elongin A2. The full-length human Elongin A3
cDNA was obtained by PCR amplification of pooled human placenta
cDNAs using an Elongin A3-specific 5'-sense primer and 3'-antisense primer.
The Elongin A3 cDNA contained an open reading frame encoding a
protein of 546 amino acids with a calculated molecular mass of 59,759 Da (Fig. 1). As determined by the
MegAlign program of the Lasergene (Madison, WI) system, Elongin A3 is
49 and 81% identical to Elongin A and Elongin A2, respectively.
Predicted amino acid sequences of Elongin A3 revealed several notable
structural features. First, like Elongins A and A2, the
NH2-terminal ~110 amino acids of Elongin A3 resembled the
NH2 terminus of transcription elongation factor SII (29%
identity to human SII) (9, 10, 22). Second, Elongin A3 also possesses
the Elongin BC binding sequence (residues 336-347) at its COOH
terminus. This ~10 amino acid consensus sequence (T/S)LXXXCXXX(V/L/I) has been found not only in
the Elongin A family but also in VHL, MUF1, Rad7, and the suppressor of
cytokine signaling (SOCS) family of proteins (9, 16, 23-25). Third, the COOH-terminal region of Elongin A3 contains the sequence LGDGDGGSV (residues 496-504), which perfectly match the consensus ATP-binding motif LGXGXXGXV often found in
serine/threonine kinases (26, 27).
Expression of Elongin A3 in Various Human Tissues--
To examine
the tissue distribution of Elongin A3, Northern blots containing
poly(A)+ RNA from various human tissues were hybridized with Elongin
A3-specific probe. As shown in Fig. 2,
the Elongin A3 probe hybridized to a single band of ~5.0 kb and,
consistent with previous studies, the Elongin A-specific probe
hybridized to two mRNA species of ~5.2 and ~2.8 kb (10, 28). To
correct for the amount of RNA loaded in each lane, we measured the
intensity of each of the bands on the blot after the hybridization with the Elongin A3 Forms a Stable Complex with Elongin BC--
Because of
the high degree of conservation of the putative Elongin BC-binding
residues in Elongin A3, we expected Elongin A3 to also interact with
Elongins B and C. To investigate this interaction, a DNA fragment
containing the open reading frame of Elongin A3 was introduced into the
baculovirus expression vector. Recombinant Elongin A3 with
hexahistidine and FLAG tags at the NH2 terminus was
expressed in insect cells and purified from the soluble fraction of the
cell lysates by sequential Ni2+-agarose and anti-FLAG
M2-agarose affinity chromatography. Recombinant Elongin A3 had an
apparent molecular mass of 75 kDa (Fig.
3A, left panel),
and polyclonal antisera raised against a synthetic peptide
corresponding to amino acids 491 to 509 of Elongin A3 recognized this
protein (Fig. 3A, right panel).
To assess the ability of Elongin A3 to bind with Elongins B and C to
form an Elongin A3-Elongin BC complex, we assayed human Elongin A3
containing hexahistidine and FLAG tags for its ability to retain the
untagged Elongins B and C on Ni2+-agarose. In this
experiment, Elongin A3 was coexpressed with Elongins B and C in
Sf9 cells, and cell lysates were subjected to
Ni2+-agarose chromatography. Bound protein fractions were
collected, and equivalent amounts of loaded and bound fractions were
subjected to SDS-polyacrylamide gel electrophoresis and analyzed by
Western blotting. As shown in Fig. 3B, untagged Elongins B
and C did not bind to Ni2+-agarose (lanes 3 and
4), but were retained on the column in the presence of
hexahistidine-tagged Elongin A3 (lanes 5 and 6).
Thus, as predicted by the sequence homology, Elongin A3 can stably bind to Elongin BC.
Elongin A3 Stimulates Transcription Elongation--
In previous
studies, we demonstrated that both Elongin A and Elongin A2 are capable
of stimulating the rate of RNA chain elongation by RNA polymerase II
(9, 10). To investigate whether Elongin A3 is also capable of this, we
employed two different assays of transcription elongation, the
oligo(dC)-tailed template assay and the AdML runoff transcription
assay, and measured the kinetics of accumulation of the long
transcripts and the distribution of RNA intermediates in the presence
or absence of Elongin A3.
To examine the direct effect of Elongin A3 on the rate of RNA chain
elongation by RNA polymerase II in the absence of other transcription
factors, an oligo(dC)-tailed template assay was performed. In the
experiment shown in Fig. 4A,
transcription was initiated by the addition of RNA polymerase II to
reaction mixtures containing ATP, GTP, and [
The specific activity of Elongin A3 was then compared with that of
Elongin A using the same assay. In the experiment shown in Fig.
4B, the ~135-nucleotide transcripts (lane 1)
were chased for 3 min with a limiting concentration of UTP in the
presence or absence of equivalent amounts of purified Elongin A3 or
Elongin A. In the presence of Elongin A3, a higher proportion of the
~135-nucleotide transcripts had been chased into the
~250-nucleotide transcripts than in the presence of Elongin A,
suggesting that Elongin A3 possesses slightly more specific activity
than Elongin A.
Next, to examine the ability of Elongin A3 to increase the rate of RNA
chain elongation by RNA polymerase II in the presence of general
initiation factors, an AdML runoff transcription assay was performed.
In the experiment shown in Fig. 4C, preinitiation complexes
were assembled by preincubation of purified RNA polymerase II, TBP,
TFIIB, TFIIF, TFIIE, and TFIIH with a DNA template containing the AdML
promoter. Then, the purified Elongin A3 protein was added to the
reaction mixtures, and transcription was initiated by the addition of
limiting concentrations of ribonucleoside triphosphates. Under these
conditions the rate of RNA chain elongation is very slow, and
full-length runoff transcripts were not detectable even 30 min after
the addition of ribonucleoside triphosphates unless Elongin A3 was
present (lanes 1 to 6). However, with the
addition of Elongin A3 transcripts accumulated more rapidly, with the
first full-length runoff transcripts appearing within ~18 min
(lanes 7 to 12).
The results of these experiments indicate that Elongin A3 is an RNA
polymerase II elongation factor that can function either during
promoter-independent transcription on an oligo(dC)-tailed template or
during promoter-specific transcription in the presence of general
initiation factors.
The COOH-Terminus of Elongin A Is Required for the Transcriptional
Activation by Elongin BC--
In a previous study we demonstrated that
the transcriptional activity of Elongin A but not Elongin A2 is
triggered by Elongin BC (9, 10, 16). To examine the effect of Elongin
BC on the transcriptional activity of Elongin A3, a purified Elongin BC
complex at increasing concentrations was preincubated at 4 °C for 30 min in the presence of purified Elongin A3, and their activities were
then measured using the oligo(dC)-tailed template assay (Fig.
5B). As we have reported
previously, purified Elongin BC complex strongly increased the
elongation activity of Elongin A (lanes 2-4). However, the
addition of increasing concentrations of Elongin BC had no detectable
effect on the activity of Elongin A3 (lanes 5-7).
Therefore, to identify the sequences important for the transcriptional
activation by Elongin BC, several Elongin A3 mutants were constructed
(Fig. 5A). A3M is a mutant Elongin A3 that contains valine
and alanine in place of two glycine residues (Gly-499 and Gly-502)
within the ATP-binding motif at its COOH terminus. These amino acid
substitutions were actually effective in abolishing the kinase activity
of one of the serine/threonine kinases, TIP30 (29). A3-A-A3 is a mutant
protein in which residues 330-354 of Elongin A3 containing the Elongin
BC binding motif have been replaced by the corresponding region,
residues 544-568, of Elongin A. Both A3-A (532) and A3-A (490) are
chimeric proteins in which the NH2-terminal regions of
Elongin A3 have been fused to the COOH-terminal regions of Elongin A. The former includes residues 1-317 of Elongin A3 and residues 532-772
of Elongin A, whereas the latter includes residues 1-276 of Elongin A3
and residues 490-772 of Elongin A. These mutant proteins were then
expressed in insect cells, purified, and tested for transcriptional
activity and responsiveness to Elongin BC. As shown in Fig.
5C, all of the mutant proteins possessed comparable levels
of transcriptional activity to the wild-type Elongin A3 in the absence
of Elongin BC. Among the mutants tested, A3M, A3-A-A3, and A3-A (532)
were unresponsive to Elongin BC (lanes 1-7). In contrast,
A3-A (490) was significantly activated by Elongin BC (lanes
8-10).
The results described above suggest that the potential ATP binding site
is unlikely to be required for the transcriptional activity of Elongin
A3, although this region may play an in vivo regulatory role
not yet revealed by in vitro assays. Moreover, they
demonstrate that the COOH-terminal region between residues 490 and 772 of Elongin A, which contains the Elongin BC-binding motif and the
sequences outside this region, is responsible for the transcriptional
activation by Elongin BC. In a previous study, we demonstrated that
residues 520-680 of Elongin A are essential for its transcriptional
activity by a systematic structure-function analysis (16). In those
experiments, because most of the assays were performed in the presence
of Elongins B and C, we could not clarify whether the activity
represents that of Elongin A itself or induction by Elongin BC. At the
present time, we do not know whether the entire region from residues
490 to 772 or some portion of this region is required for the
induction. Further investigation is necessary to determine the most
critical sequence substitutions in Elongins A2 and A3 for the loss of
responsiveness to Elongin BC.
What is the mechanism by which Elongin A is activated by Elongin BC?
Although information concerning the structure of mammalian Elongin A is
lacking, Koth et al. (30), using circular dichroism, recently analyzed the structures of the Elongin A and C subunits from
yeast Saccharomyces cerevisiae in which Elongin A possesses no transcriptional activity and no Elongin B subunit is present. According to them, yeast Elongin A is unfolded in the absence of
Elongin C, and there is a large increase in helical content upon
formation of the Elongin AC heterodimer. If this is also the case in
mammalian Elongins, the activation of Elongin A might be induced by an
allosteric mechanism in which the binding of Elongin BC causes the
Elongin A elongation activation domain to adopt a more
transcriptionally active conformation.
Elongin A3 and Elongin A Do Not Act in a Synergistic
Manner--
The results of Northern blot analysis and studies from
other laboratories suggest that both Elongin A and Elongin A3 are
expressed in most mammalian tissues and cell types (10, 28, 31-33). It has also been reported that Elongin A is predominantly localized in the
nucleus (25, 34). Thus, to investigate the subcellular localization of
Elongin A3 we performed immunostaining assays. COS7 cells were
transfected with a construct expressing FLAG-tagged Elongin A3 and
stained with anti-FLAG antibody. As shown in Fig. 6A, Elongin A3 was clearly
localized to the nucleus and displayed a dot-like distribution pattern.
These results suggest that Elongin A3 and Elongin A might coexist in
the cells.
Therefore, we next tested the effect of Elongin A3 on the
transcriptional activity of Elongin A using an oligo(dC)-tailed template assay (Fig. 6B). In this experiment, we used a
limiting concentration of purified RNA polymerase II compared with
Elongins A3 and A. In the absence of Elongin, a substantial portion of the ~135-nucleotide transcripts persisted for at least 7 min after the addition of UTP and nonradioactive CTP (lanes 1). In the
presence of either 4 nM purified Elongin A3 or 8 nM purified Elongin A (lanes 2 and 3), nearly
all of the ~135-nucleotide transcripts had been chased into the
longer transcripts. Notably, the transcripts synthesized in the
presence of Elongin A were substantially longer than those synthesized
in the presence of Elongin A3. However, the addition of Elongin A3 to
Elongin A resulted in a substantial inhibition of Elongin A activity,
and RNA chain elongation progressed at an intermediate rate (lane
4). These results suggest that Elongin A3 and Elongin A act not in
a complementary way but rather via a similar mechanism. Although we do
not know the mechanism of this action, the two may share the surface of
RNA polymerase II.
What might be the roles of members of the Elongin A family in
vivo? Because Elongin A is capable of stimulating the rate of elongation through a wide variety of DNA templates tested in
vitro, this factor has been considered to be a general elongation
factor. However, cDNA microarray analyses using the
wild-type and Elongin A-deficient ES cells indicate that the expression
of only a small percentage of genes is significantly reduced in the
mutant cells.2 These findings
suggest that members of the Elongin A family are not general elongation
factors and that each factor regulates the expression of a distinct set
of genes. Furthermore, it is also possible that Elongins A2 and A3 work
as negative regulators of Elongin A in vivo by binding to
Elongin BC and inhibiting its ability to activate the transcriptional
activity of Elongin A. Alternatively, the Elongin A family could have
some other cellular functions. It was recently reported that the
Elongin A-Elongin BC complex is capable of assembling with known
components of the ubiquitin ligase, Cul5 and Rbx1 (23). We have also
found that both Elongins A2 and A3 are capable of assembling with these
proteins as efficiently as Elongin A (data not shown). These findings
raise the intriguing possibility that at least one of the functions of
the Elongin A family may be to participate in
ubiquitin-dependent degradation of components of the RNA
polymerase II elongation machinery.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES
-32P]CTP (>400 Ci/mmol) were
purchased from Amersham Biosciences. Bovine serum albumin,
phenylmethylsulfonyl fluoride (PMSF), aprotipain, leupeptin, and
benzamidine were obtained from Sigma, placental ribonuclease inhibitor
from Promega, and Ni2+-nitrilotriacetic acid agarose
(Ni2+-agarose) from Qiagen.
-actin cDNA. The
-actin signal was quantitated and used to normalize the signals of
Elongin A3 and Elongin A. In the case of heart and skeletal muscle, the
standard
-actin transcript (2 kb), not the overexpressed, smaller
transcript (1.7 kb), was used.
-32P]CTP. After 20 min of labeling, 100 µM nonradioactive CTP, 2 µM UTP, and
specific amounts of Elongin preparations were added, and the reactions
were incubated for the times indicated in Figs. 4, 5, and 6.
Transcripts were analyzed by electrophoresis through 6%
polyacrylamide, 7.0 M urea gels.
-32P]CTP either
in the absence or presence of purified Elongin A3. After incubation for
given periods at 28 °C, runoff transcripts were analyzed by
electrophoresis through 6% polyacrylamide, 7.0 M urea gels.
![]()
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

View larger version (95K):
[in a new window]
Fig. 1.
Comparison of the deduced amino acid
sequences of human Elongin A, Elongin A2, and Elongin A3.
Identical amino acids are shown as white letters
on a black background. The Elongin BC binding
site motif is indicated by a dashed underline.
The protein kinase ATP binding motif present in Elongin A3 is
underlined. Numbers indicate amino acid positions in each
protein. EloA, Elongin A; EloA2, Elongin A2;
EloA3, Elongin A3.
-actin probe. The results of Northern blot analyses indicate that the Elongin A3 and Elongin A mRNAs are expressed in many of
the same tissues, although the expression level of each mRNA varies
among tissues. Notably, the highest level of expression of Elongin A3
and Elongin A was observed in skeletal muscle and in testis,
respectively.

View larger version (54K):
[in a new window]
Fig. 2.
Expression of Elongin A3 and Elongin A
mRNA in human tissue. Multiple tissue Northern blots
(CLONTECH) containing Poly(A)+ RNA of
the indicated human tissues were hybridized with an Elongin A3
(upper), Elongin A (middle), or
-actin
cDNA probe (lower). The signals of Elongins A3 and A
were normalized against
-actin, and the expression level of Elongin
A3 in skeletal muscle or that of Elongin A in testis was arbitrarily
set to 100. The size of the RNA standards is indicated on the
left. PBL, peripheral blood leukocyte;
EloA3, Elongin A3; EloA, Elongin A.

View larger version (24K):
[in a new window]
Fig. 3.
Elongin A3 forms a complex with Elongins B
and C. A, left panel, Elongin A3 expressed in and
purified from insect cells as described under "Experimental
Procedures" was subjected to 8% SDS-PAGE. The protein was visualized
by silver staining. Right panel, Elongin A3 expressed in and
purified from insect cells was subjected to 8% SDS-PAGE, transferred
to a polyvinylidene difluoride membrane (Millipore), and analyzed by
Western blotting using rabbit antiserum raised against the nonconserved
amino acid sequences located in the COOH-terminal portion of Elongin
A3. B, insect cells infected with recombinant baculoviruses
expressing the indicated combinations of proteins were lysed, and
the proteins were precipitated with Ni2+-agarose
resin. Loaded and bound fractions were subjected to SDS-PAGE followed
by Western blotting using anti-FLAG (upper), anti-Elongin B
(middle), or anti-Elongin C (lower)
antibody.
-32P]CTP
and the pCpGR220 S/P/X template. In this template, the first non-template strand (dT) residues are located 136, 137, and 138 nucleotides from the oligo(dC)-tail; the next run of (dT) residues is
located 244 to 256 nucleotides from the oligo(dC)-tail. After a 20-min
incubation, transcripts of ~135 nucleotides were synthesized on the
T-less cassette of the template. These transcripts were then chased
with a limiting concentration of UTP and an excess of nonradioactive
CTP in the presence or absence of baculovirus expressing recombinant
Elongin A3. In the absence of Elongin A3, a substantial portion of the
~135-nucleotide transcripts persisted for at least 10 min after the
addition of UTP, and nearly all had been chased into longer transcripts
at ~20 min (lanes 1 to 4). In the presence of
Elongin A3, RNA chain elongation progressed more rapidly, with nearly
all of the ~135-nucleotide transcripts disappearing within 5 min
after the addition of UTP (lanes 5 to 8).

View larger version (39K):
[in a new window]
Fig. 4.
Transcriptional elongation activity of
Elongin A3. A, effect of Elongin A3 on the kinetics of
promoter-independent transcription. After a 20 min incubation of RNA
polymerase II and oligo(dC)-tailed template, the transcripts of 135 nucleotides were chased for the indicated times (top, in
minutes) in the absence (lanes 1-4) or presence of 4 nM purified Elongin A3 (lanes 5-8).
B, left panel, comparison of the specific
activities of Elongin A3 and Elongin A in oligo(dC)-tailed template
assays. Reaction mixtures in lanes 3 to 5 contained 1, 2, and 4 nM purified Elongin A3. Reactions in
lanes 6 to 8 contained 1, 2, and 4 nM
purified Elongin A. Right panel, the amounts of
~135-nucleotide transcripts and ~250-nucleotide transcripts were
quantitated using a BAS2000 image analyzer (Fuji), and the ratios of
~250-nucleotide transcripts to ~135-nucleotide transcripts were
presented in the bar graph. C, effect
of Elongin A3 on the kinetics of AdML (arrowhead) runoff
transcript synthesis. After a 30 min preincubation of RNA polymerase
II, initiation factors, and DNA template, transcription was carried out
for the indicated times (top, in minutes) in the absence
(lanes 1-6) or presence of 4 nM purified
Elongin A3 (lanes 7-12).

View larger version (32K):
[in a new window]
Fig. 5.
COOH-terminal region of Elongin A is required
for the induction of transcriptional activation by Elongin BC.
A, structures of the Elongins A, A3, A3 mutant, and A3-A
chimera proteins used in this study. On the right, the
results of transcription assays in (B) and (C)
are shown. B, the oligo(dC)-tailed template assays were
performed in the absence (lane 1) or presence of 3 nM purified Elongin A (lanes 2-4) or 3 nM purified Elongin A3 (lanes 5-7). Elongin BC
was present in reaction mixtures at 1.5 nM (lanes
3 and 6) or 3 nM (lanes 4 and
7). C, the oligo(dC)-tailed template assays were
performed in the absence (lanes 1 and 8) or
presence of 3 nM purified Elongin A3 mutant (lanes
2 and 3) or 3 nM purified Elongin A3-A
chimeras (lanes 4-7, 9 and 10).
Elongin BC was present in reaction mixtures at 3 nM
(lanes 3, 5, 7, and
10).

View larger version (35K):
[in a new window]
Fig. 6.
Elongin A3 and Elongin A act not in a
complementary way but via a similar mechanism. A,
subcellular localization of Elongin A3. COS7 cells were
transfected with FLAG-tagged Elongin A3. After 12 h, the cells
were stained for Elongin A3 using anti-FLAG antibody (green;
left panel), and doubly stained for Elongin A3 and nuclei
using anti-FLAG antibody (green) and DAPI (blue),
respectively (right panel). B, the oligo(dC)-tailed template
assays were performed in the absence (lane 1) or presence of
4 nM purified Elongin A3 (lane 2), 8 nM purified Elongin A (lane 3), or 8 nM purified Elongin A plus 4 nM purified
Elongin A3 (lane 4).
| |
ACKNOWLEDGEMENTS |
|---|
We thank Drs. Joan W. Conaway and Ronald C. Conaway for providing the anti-Elongin B antibody.
| |
FOOTNOTES |
|---|
* This work was supported in part by grants from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, the Takeda Science Foundation, the National Space Development Agency of Japan, and the Japan Space Forum.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB076840.
** To whom correspondence should be addressed: Dept. of Chemistry, Faculty of Medicine, Kochi Medical School, Kohasu, Oko-cho, Nankoku, Kochi 783-8505, Japan. Tel.: 81-88-880-2279; Fax: 81-88-880-2281; E-mail: asot@kochi-ms.ac.jp.
Published, JBC Papers in Press, May 6, 2002, DOI 10.1074/jbc.M202859200
2 K. Yamazaki, T. Aso, S. Kitajima, and Y. Nakabeppu, unpublished data.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: TF, transcription factor; VHL, von Hippel-Lindau; PMSF, phenylmethylsulfonyl fluoride; EST, expressed sequence tag; Ni2+-agarose, Ni2+-nitrilotriacetic acid-agarose; AdML, adenovirus 2 major late; PBS, phosphate-buffered saline; TBP, TATA-binding protein; DAPI, 4',6-diamidino-2-phenylindole dihydrochloride.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Roeder, R. G. (1996) Trends Biochem. Sci. 21, 327-335[CrossRef][Medline] [Order article via Infotrieve] |
| 2. | Aso, T., Conaway, J. W., and Conaway, R. C. (1995) FASEB J. 9, 1419-1428[Abstract] |
| 3. | Reines, D., Conaway, J. W., and Conaway, R. C. (1996) Trends Biochem. Sci. 21, 351-355[CrossRef][Medline] [Order article via Infotrieve] |
| 4. | Uptain, S. M., Kane, C. M., and Chamberlin, M. J. (1997) Annu. Rev. Biochem. 66, 117-172[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Conaway, J. W., Shilatifard, A., Dvir, A., and Conaway, R. C. (2000) Trends Biochem. Sci. 25, 375-380[CrossRef][Medline] [Order article via Infotrieve] |
| 6. | Wind, M., and Reines, D. (2000) Bioessays 22, 327-336[CrossRef][Medline] [Order article via Infotrieve] |
| 7. |
Marshall, N. F.,
and Price, D. H.
(1995)
J. Biol. Chem.
270,
12335-12338 |
| 8. |
Price, D. H.,
Sluder, A. E.,
and Greenleaf, A. L.
(1989)
Mol. Cell. Biol.
9,
1465-1475 |
| 9. |
Aso, T.,
Lane, W. S.,
Conaway, J. W.,
and Conaway, R. C.
(1995)
Science
269,
1439-1443 |
| 10. |
Aso, T.,
Yamazaki, K.,
Amimoto, K.,
Kuroiwa, A.,
Higashi, H.,
Matsuda, Y.,
Kitajima, S.,
and Hatakeyama, M.
(2000)
J. Biol. Chem.
275,
6546-6552 |
| 11. | Shilatifard, A., Lane, W. S., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1996) Science 271, 1873-1876[Abstract] |
| 12. |
Selby, C. P.,
and Sancar, A.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
11205-11209 |
| 13. |
Bradsher, J. N.,
Jackson, K. W.,
Conaway, R. C.,
and Conaway, J. W.
(1993)
J. Biol. Chem.
268,
25587-25593 |
| 14. |
Garrett, K. P.,
Tan, S.,
Bradsher, J. N.,
Lane, W. S.,
Conaway, J. W.,
and Conaway, R. C.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5237-5241 |
| 15. |
Garrett, K. P.,
Aso, T.,
Bradsher, J. N.,
Foundling, S. I.,
Lane, W. S.,
Conaway, R. C.,
and Conaway, J. W.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
7172-7176 |
| 16. | Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996) EMBO J. 15, 5557-5566[Medline] [Order article via Infotrieve] |
| 17. |
Duan, D. R.,
Pause, A.,
Burgess, W. H.,
Aso, T.,
Chen, D. Y. T.,
Garrett, K. P.,
Conaway, R. C.,
Conaway, J. W.,
Linehan, W. M.,
and Klausner, R. D.
(1995)
Science
269,
1402-1406 |
| 18. |
Kibel, A.,
Iliopoulos, O.,
DeCaprio, J. A.,
and Kaelin, W. G.
(1995)
Science
269,
1444-1446 |
| 19. |
Kishida, T.,
Stackhouse, T. M.,
Chen, F.,
Lerman, M. I.,
and Zbar, B.
(1995)
Cancer Res.
55,
4544-4548 |
| 20. | Aso, T., Haque, D., Fukudome, K., Brower, C. S., Conaway, J. W., and Conaway, R. C. (1996) Gene (Amst.) 168, 277-278[CrossRef][Medline] [Order article via Infotrieve] |
| 21. |
Conaway, J. W.,
and Conaway, R. C.
(1990)
Science
248,
1550-1553 |
| 22. | Chen, H. C., England, L., and Kane, C. M. (1992) Gene 116, 253-258[CrossRef][Medline] [Order article via Infotrieve] |
| 23. |
Kamura, T.,
Burian, D.,
Yan, Q.,
Schmidt, S. L.,
Lane, W. S.,
Querido, E.,
Branton, P. E.,
Shilatifard, A.,
Conaway, R. C.,
and Conaway, J. W.
(2001)
J. Biol. Chem.
276,
29748-29753 |
| 24. | Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson, I., Schandorff, S., Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, C., Dewar, D., Lin, Z., Michalickova, K., Willems, A. R., Sassi, H., Nielsen, P. A., Rasmussen, K. J., Andersen, J. R., Johansen, L. E., Hansen, L. H., Jespersen, H., Podtelejnikov, A., Nielsen, E., Crawford, J., Poulsen, V., Sorensen, B. D., Matthiesen, J., Hendrickson, R. C., Gleeson, F., Pawson, T., Moran, M. F., Durocher, D., Mann, M., Hogue, C. W., Figeys, D., and Tyers, M. (2002) Nature 415, 180-183[CrossRef][Medline] [Order article via Infotrieve] |
| 25. |
Kamura, T.,
Sato, S.,
Haque, D.,
Liu, L.,
Kaelin, W. G.,
Conaway, R. C.,
and Conaway, J. W.
(1998)
Genes Dev.
12,
3872-3881 |
| 26. |
Hanks, S. K.,
Quinn, A. M.,
and Hunter, T.
(1988)
Science
241,
42-52 |
| 27. | Bossemeyer, D. (1994) Trends Biochem. Sci. 19, 201-205[CrossRef][Medline] [Order article via Infotrieve] |
| 28. | Aso, T., Amimoto, K., Takebayashi, S., Okumura, K., and Hatakeyama, M. (1999) Cytogenet. Cell Genet. 86, 259-262[CrossRef][Medline] [Order article via Infotrieve] |
| 29. | Xiao, H., Palhan, V., Yang, Y., and Roeder, R. G. (2000) EMBO J. 19, 956-963[CrossRef][Medline] [Order article via Infotrieve] |
| 30. |
Koth, C. M.,
Botuyan, M. V.,
Moreland, R. J.,
Jansma, D. B.,
Conaway, J. W.,
Conaway, R. C.,
Chazin, W. J.,
Friesen, J. D.,
Arrowsmith, C. H.,
and Edwards, A. M.
(2000)
J. Biol. Chem.
275,
11174-11180 |
| 31. |
Kroll, S. L.,
Paulding, W. R.,
Schnell, P. O.,
Barton, M. C.,
Conaway, J. W.,
Conaway, R. C.,
and Czyzyk-Krzeska, M. F.
(1999)
J. Biol. Chem.
274,
30109-30114 |
| 32. | Stuhlmüller, B., Ungethüm, U., Scholze, S., Martinez, L., Backhaus, M., Kraetsch, H., Kinne, R. W., and Burmester, G. (2000) Arthritis Rheum. 43, 775-790[CrossRef][Medline] [Order article via Infotrieve] |
| 33. | Warskulat, U., Kreuels, S., Müller, H. W., and Haussinger, D. (2001) 35, 358-366 |
| 34. | Conaway, J. W., and Conaway, R. C. (1999) Annu. Rev. Biochem. 68, 301-319[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
Y. Ling, A. J. Smith, and G. T. Morgan A sequence motif conserved in diverse nuclear proteins identifies a protein interaction domain utilised for nuclear targeting by human TFIIS. Nucleic Acids Res., January 1, 2006; 34(8): 2219 - 2229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gerber, K. Tenney, J. W. Conaway, R. C. Conaway, J. C. Eissenberg, and A. Shilatifard Regulation of Heat Shock Gene Expression by RNA Polymerase II Elongation Factor, Elongin A J. Biol. Chem., February 11, 2005; 280(6): 4017 - 4020. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gerber, J. C. Eissenberg, S. Kong, K. Tenney, J. W. Conaway, R. C. Conaway, and A. Shilatifard In Vivo Requirement of the RNA Polymerase II Elongation Factor Elongin A for Proper Gene Expression and Development Mol. Cell. Biol., November 15, 2004; 24(22): 9911 - 9919. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Sims III, R. Belotserkovskaya, and D. Reinberg Elongation by RNA polymerase II: the short and long of it Genes & Dev., October 15, 2004; 18(20): 2437 - 2468. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Yamazaki, T. Aso, Y. Ohnishi, M. Ohno, K. Tamura, T. Shuin, S. Kitajima, and Y. Nakabeppu Mammalian Elongin A Is Not Essential for Cell Viability but Is Required for Proper Cell Cycle Progression with Limited Alteration of Gene Expression J. Biol. Chem., April 4, 2003; 278(15): 13585 - 13589. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||