JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M202859200 on May 6, 2002

J. Biol. Chem., Vol. 277, Issue 29, 26444-26451, July 19, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/29/26444    most recent
M202859200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamazaki, K.
Right arrow Articles by Aso, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamazaki, K.
Right arrow Articles by Aso, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Identification and Biochemical Characterization of a Novel Transcription Elongation Factor, Elongin A3*

Katsuhisa YamazakiDagger §, Limei Guo||, Kazunori Sugahara, Chun ZhangDagger , Hideaki Enzan||, Yusaku Nakabeppu§, Shigetaka KitajimaDagger , and Teijiro Aso**

From the Dagger  Department of Biochemical Genetics, Medical Research Institute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo 113-8510, the § Medical Institute of Bioregulation, Kyushu University and Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Corporation, 3-1-1, Maidashi, Higashi-ku, Fukuoka 812-8582, and the Departments of  Chemistry and || Pathology, Faculty of Medicine, Kochi Medical School, Kohasu, Oko-cho, Nankoku, Kochi 783-8505, Japan

Received for publication, March 25, 2002, and in revised form, May 1, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

The Elongin complex stimulates the rate of transcription elongation by RNA polymerase II by suppressing the transient pausing of the polymerase at many sites along the DNA template. Elongin is composed of a transcriptionally active A subunit and two small regulatory B and C subunits, the latter binding stably to each other to form a binary complex that interacts with Elongin A and strongly induces its transcriptional activity. To further understand the role of Elongin A in transcriptional regulation by RNA polymerase II, we are attempting to identify Elongin A-related proteins. Here, we report on the molecular cloning, expression, and biochemical characterization of human Elongin A3, a novel transcription elongation factor that exhibits 49 and 81% identity to Elongin A and the recently identified Elongin A2, respectively. The mRNA of Elongin A3 is ubiquitously expressed, and the protein is localized to the nucleus of cells. Mechanistic studies have demonstrated that Elongin A3 possesses similar biochemical features to Elongin A2. Both stimulate the rate of transcription elongation by RNA polymerase II and are capable of forming a stable complex with Elongin BC. In contrast to Elongin A, however, their transcriptional activities are not activated by Elongin BC. Structure-function analyses using fusion proteins composed of Elongin A3 and Elongin A revealed that the COOH-terminal region of Elongin A is important for the activation by Elongin BC.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

The synthesis of messenger RNA in eukaryotes is a complex biochemical process controlled by the concerted action of a set of general transcription factors that regulate the activity of RNA polymerase II during the initiation and elongation stages of transcription. At least six general transcription initiation factors (TFIIA, TFIIB, TFIID, TFIIE, TFIIF, and TFIIH)1 have been identified in eukaryotic cells and found to promote the selective binding of RNA polymerase II to promoters and to support a basal level of transcription (1). In addition to the general initiation factors, at least 16 elongation factors have been defined biochemically and found to increase the efficiency of transcription elongation by RNA polymerase II (2-5).

Among the elongation factors, SII and P-TEFb prevent RNA polymerase II from prematurely arresting transcription. SII does this by promoting passage of the polymerase through a variety of transcriptional impediments, including DNA sequences that act as intrinsic arrest sites and DNA-bound proteins and drugs (6). P-TEFb catalyzes the conversion of early, termination-prone elongation complexes into productive elongation complexes (7). The rest of the elongation factors such as TFIIF (8), Elongin A (9), Elongin A2 (10), ELL (11), and the Cockayne syndrome group B protein (CSB) (12), act to increase the overall rate of RNA chain elongation by RNA polymerase II by decreasing the frequency and/or duration of transient pausing of the polymerase at sites along the DNA template.

Elongin was initially identified as a heterotrimer composed of A, B, and C subunits of ~770, 118, and 112 amino acids, respectively (9, 13-15). Elongin A is the transcriptionally active component of the Elongin complex, whereas Elongins B and C are positive regulatory subunits. Biochemical studies have shown that Elongins B and C form a stable Elongin BC complex that binds to Elongin A and strongly induces its transcriptional activity (9, 16). Elongin C functions as the inducing ligand and activates transcription through interaction with a short conserved motif (consensus sequence (T/S)LXXXCXXX(V/L/I)) in the elongation activation domain of Elongin A (16). Elongin B, a member of the ubiquitin homology protein family, appears to play a chaperone-like role in the assembly of the Elongin complex by binding to Elongin C and facilitating its interaction with Elongin A (9, 15). Notably, Elongins B and C are also found as integral components of a multisubunit complex containing the product of the von Hippel-Lindau (VHL) tumor suppressor gene (17, 18). Elongin A and the VHL protein share the Elongin BC binding site motif, and, consistent with the assumption of a role for Elongin BC in tumor suppression, >70% of VHL mutations found in VHL families and sporadic clear cell renal carcinomas are associated with a mutation or deletion at this site, and in all the cases tested these mutant VHL proteins exhibited substantially reduced binding to Elongin BC (17, 19).

As part of our effort to understand the function, mechanism of action, and regulation of the Elongin complex, we are attempting to identify members of the Elongin family. In this report, we describe the identification and biochemical characterization of Elongin A3, a novel Elongin A-related RNA polymerase II elongation factor from human cells.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Materials-- Unlabeled ultrapure ribonucleoside 5'-triphosphate and [alpha -32P]CTP (>400 Ci/mmol) were purchased from Amersham Biosciences. Bovine serum albumin, phenylmethylsulfonyl fluoride (PMSF), aprotipain, leupeptin, and benzamidine were obtained from Sigma, placental ribonuclease inhibitor from Promega, and Ni2+-nitrilotriacetic acid agarose (Ni2+-agarose) from Qiagen.

Isolation of Human Elongin A3 cDNA-- The data base of human expressed sequence tags (ESTs) was searched with the human Elongin A cDNA sequence (20) and a 589-base pair sequence (accession no. AW090822), part of which had exhibited homology to the 5'-end of the coding regions of both Elongin A and Elongin A2 cDNAs (10), was found in a human brain EST data base. The genomic data base was then searched with this 589-base pair cDNA sequence as the query, and it was revealed that part of the sequence on human chromosome 18 (accession no. AC011814) contained this fragment and sequences that have homology to the rest of the regions of both Elongin A and Elongin A2 cDNAs. The full-length human Elongin A3 cDNA was obtained by PCR of the Marathon-Ready placenta cDNA (CLONTECH) with an Elongin A3-specific 5'-primer (5'-ATGGCGGCAGGGTCCACTACGCTG-3') and 3'-antisense primer (5'-TTATCGTCGGGAGAATCTTCCCTTG-3') using KOD DNA polymerase (TOYOBO).

DNA Sequencing and Northern Blot Analysis-- DNA sequencing was performed using an automated sequencer (ABI Prism 310, Applied Biosystems). Human multiple tissue Northern blots I and II (CLONTECH) containing 2 µg of poly(A)+ RNA per sample were hybridized using ExpressHyb solution (CLONTECH) under stringent conditions as recommended by the manufacturer. The Elongin A3 probe contained sequences encoding amino acids 1-546, and the Elongin A probe contained sequences encoding amino acids 263-772. The Elongin A3 and Elongin A signals were quantitated by densitometry of autoradiograms, and the blot was stripped and reprobed using beta -actin cDNA. The beta -actin signal was quantitated and used to normalize the signals of Elongin A3 and Elongin A. In the case of heart and skeletal muscle, the standard beta -actin transcript (2 kb), not the overexpressed, smaller transcript (1.7 kb), was used.

Plasmids for the Expression of Wild-type and Mutant Elongin A3-- The coding region of human Elongin A3 was amplified by KOD DNA polymerase using the primers 5'-AAGGTCGCTAGCATGGACTACAAGGACGACGATGACAAGGCGGCAGGGTCCACTACGCTGCG and 5'-CGGAATTCTTATCGTCGGGAGAATCTTCCCTTG. The amplified 1.65-kb fragment was digested with NheI and EcoRI and cloned into the vector pBacPAK-His2 (CLONTECH) to generate a plasmid (pBacPAK-hEloA3) for the expression of a wild-type Elongin A3 containing hexahistidine and FLAG tags at its NH2 terminus. For expression in mammalian cells, the same fragment was subcloned into the pCI-neo vector (Promega) to generate pCI-hEloA3. Constructs expressing Elongin A3 mutants (A3 M and A3-A-A3) were generated by oligonucleotide-directed mutagenesis of pBacPAK-hEloA3 using the QuikChange site-directed mutagenesis kit (Stratagene). Constructs expressing Elongin A-Elongin A3 chimeric proteins (A3-A (532) and A3-A (490)) were generated by overlap extension PCR using KOD DNA polymerase.

Expression of Recombinant Proteins in Insect Cells-- Spodoptera frugiperda (Sf9) cells were cultured as monolayers in Grace's insect medium (Invitrogen) supplemented with 10% fetal bovine serum (JRH Biosciences) at 27 °C. A recombinant transfer plasmid containing either wild-type or mutant Elongin A3 cDNA was cotransfected with Bsu36I-digested BacPAK6 virus DNA (CLONTECH) into Sf9 cells by Lipofectin-mediated (Invitrogen) transfection, and the resultant viral pool was collected 4 days later and amplified three times. For expression of the recombinant proteins, Sf9 cells were seeded at a density of 2 × 107 cells per 175-cm2 flask and infected with recombinant baculoviruses at a multiplicity of infection (m.o.i.) of 10-20. At 60-72 h after infection, the cells were gently dislodged from the culture flasks, collected by centrifugation at 1000 × g for 10 min at 4 °C, and washed once with 10 ml of ice-cold buffer A (20 mM Tris-HCl, pH 7.9, 500 mM NaCl, 0.1% Nonidet P-40, and 1 mM dithiothreitol). The cell pellets were resuspended in 5 ml of lysis buffer (20 mM Tris-HCl, pH 7.9, 500 mM NaCl, 0.1% Nonidet P-40, 0.5 mM PMSF, 5 µg/ml leupeptin, 5 µg/ml aprotinin, and 1 mM benzamidine) and lysed by brief sonication. The cell lysates were then clarified by centrifugation for 20 min at 100,000 × g to remove insoluble materials. Recombinant proteins were purified from the soluble fraction of lysates using Ni2+-agarose and anti-FLAG M2-agarose (Sigma) affinity chromatography. Each supernatant (5 ml) was applied to a 1-ml Ni2+-agarose column pre-equilibrated in lysis buffer containing 5 mM imidazole (pH 7.9) and incubated for 30 min at 4 °C. The column was then washed with 20 ml of lysis buffer containing 10 mM imidazole (pH 7.9). The recombinant proteins were eluted with 10 ml of lysis buffer containing 300 mM imidazole (pH 7.9), and the peak fractions of each eluate were dialyzed against the IP buffer (20 mM Tris-HCl, pH 7.9, 300 mM NaCl, and 0.1% Nonidet P-40). The dialyzed samples were then applied to anti-FLAG M2-agarose beads (200 µl) and incubated for 3-6 h at 4 °C. The beads were washed five times with 1 ml of IP buffer, and bound proteins were eluted with a buffer containing 20 mM Tris-HCl, pH 7.9, 100 mM NaCl, 0.1% Nonidet P-40, and 200 µg/ml of FLAG peptide. Aliquots of the eluates were used for SDS-PAGE and in vitro transcription elongation assay.

Oligo(dC)-tailed Template Assay of Transcription Elongation by RNA Polymerase II-- RNA polymerase II was purified as described from rat liver nuclear extracts (21). Pulse-chase assays were carried out essentially as reported previously (9). RNA polymerase II (0.01 units) and 100 ng of pCpGR220S/P/X were incubated at 28 °C in the presence of 20 mM Hepes-NaOH, pH7.9, 20 mM Tris-HCl, pH 7.9, 2% (w/v) polyvinyl alcohol, 0.5 mg/ml of bovine serum albumin, 60 mM KCl, 50 µM ZnSO4, 7 mM MgCl2, 0.2 mM dithiothreitol, 3% (v/v) glycerol, 3 units of recombinant ribonuclease inhibitor, 50 µM ATP, 50 µM GTP, 2 µM CTP, and 10 µCi [alpha -32P]CTP. After 20 min of labeling, 100 µM nonradioactive CTP, 2 µM UTP, and specific amounts of Elongin preparations were added, and the reactions were incubated for the times indicated in Figs. 4, 5, and 6. Transcripts were analyzed by electrophoresis through 6% polyacrylamide, 7.0 M urea gels.

Assay of Runoff Transcription-- Pre-initiation complexes were assembled by pre-incubation of 50 ng of the EcoRI-NdeI fragment from pDN-AdML (9) and 10 ng of TFIIB, 10 ng of TFIIF, 7 ng of TFIIE, 40 ng of TFIIH, 50 ng of yeast TBP, and 0.01 units of RNA polymerase II. Transcription was initiated by the addition of 7 mM MgCl2, 50 µM ATP, 2 µM UTP, 10 µM CTP, 50 µM GTP, and 10 µCi [alpha -32P]CTP either in the absence or presence of purified Elongin A3. After incubation for given periods at 28 °C, runoff transcripts were analyzed by electrophoresis through 6% polyacrylamide, 7.0 M urea gels.

In Vitro Protein-Protein Interaction Assays-- Recombinant baculoviruses expressing human Elongin A3 or rat Elongin A with both polyhistidine and FLAG epitope tags at their NH2 termini were introduced into Sf9 cells either with or without baculoviruses expressing untagged rat Elongins B and C. The cells were harvested 60-72 h postinfection, resuspended in lysis buffer (20 mM Tris-HCl, pH 7.9, 500 mM NaCl, 0.1% Nonidet P-40, 0.5 mM PMSF, 5 µg/ml of leupeptin, 5 µg/ml of aprotinin, and 1 mM benzamidine), and lysed by brief sonication. The cell lysates were incubated for 2 h at 4 °C with ~100 µl of Ni2+-agarose pre-equilibrated in lysis buffer containing 20 mM imidazole (pH 7.9) and then centrifuged for 1 min at 2000 rpm. Following centrifugation, the supernatants containing the unbound proteins were collected, and the Ni2+-agarose was washed four times by resuspension in 1 ml of lysis buffer containing 20 mM imidazole (pH 7.9) and centrifuged for 1 min at 2000 rpm. Finally, bound proteins were eluted with 200 µl of lysis buffer containing 300 mM imidazole (pH 7.9). Aliquots of loaded and bound fractions were subjected to SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Millipore), and probed with the appropriate antibody.

Immunostaining of Cells-- COS7 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and transiently transfected with the pCI-hEloA3 DNA using SuperFect (Qiagen) according to the manufacturer's protocol. The cells grown in a chamber slide were fixed by immersion in cold acetone/methanol (1:1) for 10 min and then rinsed with 70% ethanol, 50% ethanol, and finally phosphate-buffered saline (PBS). After blocking in PBS containing 2% bovine serum albumin, 0.2% Tween 20, and 6.7% glycerol at 4 °C overnight, the cells were incubated with anti-FLAG antibody (1:1000) for 1 h, washed with PBS, and sequentially incubated with fluorescence-labeled anti-mouse immunoglobulin G antibody (1:5000) for 30 min. For staining of nuclei, cells were treated with 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) from Nacalai Tesque.

    RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

Isolation of a cDNA Clone for Human Elongin A3-- To study the possible existence of a novel member of the Elongin protein family, a data base of human expressed sequence tags was searched with the human Elongin A sequence (20) as the query. One expressed sequence tag clone (accession no. AW090822) found in a brain data base showed 56% identity to the 5'-end of the coding region of human Elongin A at the amino acid level. Subsequent searches using this fragment as a query identified not only DNA sequences that contained this entire fragment but also sequences with homology to the rest of the coding region of both Elongin A and Elongin A2. The full-length human Elongin A3 cDNA was obtained by PCR amplification of pooled human placenta cDNAs using an Elongin A3-specific 5'-sense primer and 3'-antisense primer.

The Elongin A3 cDNA contained an open reading frame encoding a protein of 546 amino acids with a calculated molecular mass of 59,759 Da (Fig. 1). As determined by the MegAlign program of the Lasergene (Madison, WI) system, Elongin A3 is 49 and 81% identical to Elongin A and Elongin A2, respectively. Predicted amino acid sequences of Elongin A3 revealed several notable structural features. First, like Elongins A and A2, the NH2-terminal ~110 amino acids of Elongin A3 resembled the NH2 terminus of transcription elongation factor SII (29% identity to human SII) (9, 10, 22). Second, Elongin A3 also possesses the Elongin BC binding sequence (residues 336-347) at its COOH terminus. This ~10 amino acid consensus sequence (T/S)LXXXCXXX(V/L/I) has been found not only in the Elongin A family but also in VHL, MUF1, Rad7, and the suppressor of cytokine signaling (SOCS) family of proteins (9, 16, 23-25). Third, the COOH-terminal region of Elongin A3 contains the sequence LGDGDGGSV (residues 496-504), which perfectly match the consensus ATP-binding motif LGXGXXGXV often found in serine/threonine kinases (26, 27).


View larger version (95K):
[in this window]
[in a new window]
 
Fig. 1.   Comparison of the deduced amino acid sequences of human Elongin A, Elongin A2, and Elongin A3. Identical amino acids are shown as white letters on a black background. The Elongin BC binding site motif is indicated by a dashed underline. The protein kinase ATP binding motif present in Elongin A3 is underlined. Numbers indicate amino acid positions in each protein. EloA, Elongin A; EloA2, Elongin A2; EloA3, Elongin A3.

Expression of Elongin A3 in Various Human Tissues-- To examine the tissue distribution of Elongin A3, Northern blots containing poly(A)+ RNA from various human tissues were hybridized with Elongin A3-specific probe. As shown in Fig. 2, the Elongin A3 probe hybridized to a single band of ~5.0 kb and, consistent with previous studies, the Elongin A-specific probe hybridized to two mRNA species of ~5.2 and ~2.8 kb (10, 28). To correct for the amount of RNA loaded in each lane, we measured the intensity of each of the bands on the blot after the hybridization with the beta -actin probe. The results of Northern blot analyses indicate that the Elongin A3 and Elongin A mRNAs are expressed in many of the same tissues, although the expression level of each mRNA varies among tissues. Notably, the highest level of expression of Elongin A3 and Elongin A was observed in skeletal muscle and in testis, respectively.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of Elongin A3 and Elongin A mRNA in human tissue. Multiple tissue Northern blots (CLONTECH) containing Poly(A)+ RNA of the indicated human tissues were hybridized with an Elongin A3 (upper), Elongin A (middle), or beta -actin cDNA probe (lower). The signals of Elongins A3 and A were normalized against beta -actin, and the expression level of Elongin A3 in skeletal muscle or that of Elongin A in testis was arbitrarily set to 100. The size of the RNA standards is indicated on the left. PBL, peripheral blood leukocyte; EloA3, Elongin A3; EloA, Elongin A.

Elongin A3 Forms a Stable Complex with Elongin BC-- Because of the high degree of conservation of the putative Elongin BC-binding residues in Elongin A3, we expected Elongin A3 to also interact with Elongins B and C. To investigate this interaction, a DNA fragment containing the open reading frame of Elongin A3 was introduced into the baculovirus expression vector. Recombinant Elongin A3 with hexahistidine and FLAG tags at the NH2 terminus was expressed in insect cells and purified from the soluble fraction of the cell lysates by sequential Ni2+-agarose and anti-FLAG M2-agarose affinity chromatography. Recombinant Elongin A3 had an apparent molecular mass of 75 kDa (Fig. 3A, left panel), and polyclonal antisera raised against a synthetic peptide corresponding to amino acids 491 to 509 of Elongin A3 recognized this protein (Fig. 3A, right panel).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Elongin A3 forms a complex with Elongins B and C. A, left panel, Elongin A3 expressed in and purified from insect cells as described under "Experimental Procedures" was subjected to 8% SDS-PAGE. The protein was visualized by silver staining. Right panel, Elongin A3 expressed in and purified from insect cells was subjected to 8% SDS-PAGE, transferred to a polyvinylidene difluoride membrane (Millipore), and analyzed by Western blotting using rabbit antiserum raised against the nonconserved amino acid sequences located in the COOH-terminal portion of Elongin A3. B, insect cells infected with recombinant baculoviruses expressing the indicated combinations of proteins were lysed, and the proteins were precipitated with Ni2+-agarose resin. Loaded and bound fractions were subjected to SDS-PAGE followed by Western blotting using anti-FLAG (upper), anti-Elongin B (middle), or anti-Elongin C (lower) antibody.

To assess the ability of Elongin A3 to bind with Elongins B and C to form an Elongin A3-Elongin BC complex, we assayed human Elongin A3 containing hexahistidine and FLAG tags for its ability to retain the untagged Elongins B and C on Ni2+-agarose. In this experiment, Elongin A3 was coexpressed with Elongins B and C in Sf9 cells, and cell lysates were subjected to Ni2+-agarose chromatography. Bound protein fractions were collected, and equivalent amounts of loaded and bound fractions were subjected to SDS-polyacrylamide gel electrophoresis and analyzed by Western blotting. As shown in Fig. 3B, untagged Elongins B and C did not bind to Ni2+-agarose (lanes 3 and 4), but were retained on the column in the presence of hexahistidine-tagged Elongin A3 (lanes 5 and 6). Thus, as predicted by the sequence homology, Elongin A3 can stably bind to Elongin BC.

Elongin A3 Stimulates Transcription Elongation-- In previous studies, we demonstrated that both Elongin A and Elongin A2 are capable of stimulating the rate of RNA chain elongation by RNA polymerase II (9, 10). To investigate whether Elongin A3 is also capable of this, we employed two different assays of transcription elongation, the oligo(dC)-tailed template assay and the AdML runoff transcription assay, and measured the kinetics of accumulation of the long transcripts and the distribution of RNA intermediates in the presence or absence of Elongin A3.

To examine the direct effect of Elongin A3 on the rate of RNA chain elongation by RNA polymerase II in the absence of other transcription factors, an oligo(dC)-tailed template assay was performed. In the experiment shown in Fig. 4A, transcription was initiated by the addition of RNA polymerase II to reaction mixtures containing ATP, GTP, and [alpha -32P]CTP and the pCpGR220 S/P/X template. In this template, the first non-template strand (dT) residues are located 136, 137, and 138 nucleotides from the oligo(dC)-tail; the next run of (dT) residues is located 244 to 256 nucleotides from the oligo(dC)-tail. After a 20-min incubation, transcripts of ~135 nucleotides were synthesized on the T-less cassette of the template. These transcripts were then chased with a limiting concentration of UTP and an excess of nonradioactive CTP in the presence or absence of baculovirus expressing recombinant Elongin A3. In the absence of Elongin A3, a substantial portion of the ~135-nucleotide transcripts persisted for at least 10 min after the addition of UTP, and nearly all had been chased into longer transcripts at ~20 min (lanes 1 to 4). In the presence of Elongin A3, RNA chain elongation progressed more rapidly, with nearly all of the ~135-nucleotide transcripts disappearing within 5 min after the addition of UTP (lanes 5 to 8).


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4.   Transcriptional elongation activity of Elongin A3. A, effect of Elongin A3 on the kinetics of promoter-independent transcription. After a 20 min incubation of RNA polymerase II and oligo(dC)-tailed template, the transcripts of 135 nucleotides were chased for the indicated times (top, in minutes) in the absence (lanes 1-4) or presence of 4 nM purified Elongin A3 (lanes 5-8). B, left panel, comparison of the specific activities of Elongin A3 and Elongin A in oligo(dC)-tailed template assays. Reaction mixtures in lanes 3 to 5 contained 1, 2, and 4 nM purified Elongin A3. Reactions in lanes 6 to 8 contained 1, 2, and 4 nM purified Elongin A. Right panel, the amounts of ~135-nucleotide transcripts and ~250-nucleotide transcripts were quantitated using a BAS2000 image analyzer (Fuji), and the ratios of ~250-nucleotide transcripts to ~135-nucleotide transcripts were presented in the bar graph. C, effect of Elongin A3 on the kinetics of AdML (arrowhead) runoff transcript synthesis. After a 30 min preincubation of RNA polymerase II, initiation factors, and DNA template, transcription was carried out for the indicated times (top, in minutes) in the absence (lanes 1-6) or presence of 4 nM purified Elongin A3 (lanes 7-12).

The specific activity of Elongin A3 was then compared with that of Elongin A using the same assay. In the experiment shown in Fig. 4B, the ~135-nucleotide transcripts (lane 1) were chased for 3 min with a limiting concentration of UTP in the presence or absence of equivalent amounts of purified Elongin A3 or Elongin A. In the presence of Elongin A3, a higher proportion of the ~135-nucleotide transcripts had been chased into the ~250-nucleotide transcripts than in the presence of Elongin A, suggesting that Elongin A3 possesses slightly more specific activity than Elongin A.

Next, to examine the ability of Elongin A3 to increase the rate of RNA chain elongation by RNA polymerase II in the presence of general initiation factors, an AdML runoff transcription assay was performed. In the experiment shown in Fig. 4C, preinitiation complexes were assembled by preincubation of purified RNA polymerase II, TBP, TFIIB, TFIIF, TFIIE, and TFIIH with a DNA template containing the AdML promoter. Then, the purified Elongin A3 protein was added to the reaction mixtures, and transcription was initiated by the addition of limiting concentrations of ribonucleoside triphosphates. Under these conditions the rate of RNA chain elongation is very slow, and full-length runoff transcripts were not detectable even 30 min after the addition of ribonucleoside triphosphates unless Elongin A3 was present (lanes 1 to 6). However, with the addition of Elongin A3 transcripts accumulated more rapidly, with the first full-length runoff transcripts appearing within ~18 min (lanes 7 to 12).

The results of these experiments indicate that Elongin A3 is an RNA polymerase II elongation factor that can function either during promoter-independent transcription on an oligo(dC)-tailed template or during promoter-specific transcription in the presence of general initiation factors.

The COOH-Terminus of Elongin A Is Required for the Transcriptional Activation by Elongin BC-- In a previous study we demonstrated that the transcriptional activity of Elongin A but not Elongin A2 is triggered by Elongin BC (9, 10, 16). To examine the effect of Elongin BC on the transcriptional activity of Elongin A3, a purified Elongin BC complex at increasing concentrations was preincubated at 4 °C for 30 min in the presence of purified Elongin A3, and their activities were then measured using the oligo(dC)-tailed template assay (Fig. 5B). As we have reported previously, purified Elongin BC complex strongly increased the elongation activity of Elongin A (lanes 2-4). However, the addition of increasing concentrations of Elongin BC had no detectable effect on the activity of Elongin A3 (lanes 5-7).


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5.   COOH-terminal region of Elongin A is required for the induction of transcriptional activation by Elongin BC. A, structures of the Elongins A, A3, A3 mutant, and A3-A chimera proteins used in this study. On the right, the results of transcription assays in (B) and (C) are shown. B, the oligo(dC)-tailed template assays were performed in the absence (lane 1) or presence of 3 nM purified Elongin A (lanes 2-4) or 3 nM purified Elongin A3 (lanes 5-7). Elongin BC was present in reaction mixtures at 1.5 nM (lanes 3 and 6) or 3 nM (lanes 4 and 7). C, the oligo(dC)-tailed template assays were performed in the absence (lanes 1 and 8) or presence of 3 nM purified Elongin A3 mutant (lanes 2 and 3) or 3 nM purified Elongin A3-A chimeras (lanes 4-7, 9 and 10). Elongin BC was present in reaction mixtures at 3 nM (lanes 3, 5, 7, and 10).

Therefore, to identify the sequences important for the transcriptional activation by Elongin BC, several Elongin A3 mutants were constructed (Fig. 5A). A3M is a mutant Elongin A3 that contains valine and alanine in place of two glycine residues (Gly-499 and Gly-502) within the ATP-binding motif at its COOH terminus. These amino acid substitutions were actually effective in abolishing the kinase activity of one of the serine/threonine kinases, TIP30 (29). A3-A-A3 is a mutant protein in which residues 330-354 of Elongin A3 containing the Elongin BC binding motif have been replaced by the corresponding region, residues 544-568, of Elongin A. Both A3-A (532) and A3-A (490) are chimeric proteins in which the NH2-terminal regions of Elongin A3 have been fused to the COOH-terminal regions of Elongin A. The former includes residues 1-317 of Elongin A3 and residues 532-772 of Elongin A, whereas the latter includes residues 1-276 of Elongin A3 and residues 490-772 of Elongin A. These mutant proteins were then expressed in insect cells, purified, and tested for transcriptional activity and responsiveness to Elongin BC. As shown in Fig. 5C, all of the mutant proteins possessed comparable levels of transcriptional activity to the wild-type Elongin A3 in the absence of Elongin BC. Among the mutants tested, A3M, A3-A-A3, and A3-A (532) were unresponsive to Elongin BC (lanes 1-7). In contrast, A3-A (490) was significantly activated by Elongin BC (lanes 8-10).

The results described above suggest that the potential ATP binding site is unlikely to be required for the transcriptional activity of Elongin A3, although this region may play an in vivo regulatory role not yet revealed by in vitro assays. Moreover, they demonstrate that the COOH-terminal region between residues 490 and 772 of Elongin A, which contains the Elongin BC-binding motif and the sequences outside this region, is responsible for the transcriptional activation by Elongin BC. In a previous study, we demonstrated that residues 520-680 of Elongin A are essential for its transcriptional activity by a systematic structure-function analysis (16). In those experiments, because most of the assays were performed in the presence of Elongins B and C, we could not clarify whether the activity represents that of Elongin A itself or induction by Elongin BC. At the present time, we do not know whether the entire region from residues 490 to 772 or some portion of this region is required for the induction. Further investigation is necessary to determine the most critical sequence substitutions in Elongins A2 and A3 for the loss of responsiveness to Elongin BC.

What is the mechanism by which Elongin A is activated by Elongin BC? Although information concerning the structure of mammalian Elongin A is lacking, Koth et al. (30), using circular dichroism, recently analyzed the structures of the Elongin A and C subunits from yeast Saccharomyces cerevisiae in which Elongin A possesses no transcriptional activity and no Elongin B subunit is present. According to them, yeast Elongin A is unfolded in the absence of Elongin C, and there is a large increase in helical content upon formation of the Elongin AC heterodimer. If this is also the case in mammalian Elongins, the activation of Elongin A might be induced by an allosteric mechanism in which the binding of Elongin BC causes the Elongin A elongation activation domain to adopt a more transcriptionally active conformation.

Elongin A3 and Elongin A Do Not Act in a Synergistic Manner-- The results of Northern blot analysis and studies from other laboratories suggest that both Elongin A and Elongin A3 are expressed in most mammalian tissues and cell types (10, 28, 31-33). It has also been reported that Elongin A is predominantly localized in the nucleus (25, 34). Thus, to investigate the subcellular localization of Elongin A3 we performed immunostaining assays. COS7 cells were transfected with a construct expressing FLAG-tagged Elongin A3 and stained with anti-FLAG antibody. As shown in Fig. 6A, Elongin A3 was clearly localized to the nucleus and displayed a dot-like distribution pattern. These results suggest that Elongin A3 and Elongin A might coexist in the cells.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 6.   Elongin A3 and Elongin A act not in a complementary way but via a similar mechanism. A, subcellular localization of Elongin A3. COS7 cells were transfected with FLAG-tagged Elongin A3. After 12 h, the cells were stained for Elongin A3 using anti-FLAG antibody (green; left panel), and doubly stained for Elongin A3 and nuclei using anti-FLAG antibody (green) and DAPI (blue), respectively (right panel). B, the oligo(dC)-tailed template assays were performed in the absence (lane 1) or presence of 4 nM purified Elongin A3 (lane 2), 8 nM purified Elongin A (lane 3), or 8 nM purified Elongin A plus 4 nM purified Elongin A3 (lane 4).

Therefore, we next tested the effect of Elongin A3 on the transcriptional activity of Elongin A using an oligo(dC)-tailed template assay (Fig. 6B). In this experiment, we used a limiting concentration of purified RNA polymerase II compared with Elongins A3 and A. In the absence of Elongin, a substantial portion of the ~135-nucleotide transcripts persisted for at least 7 min after the addition of UTP and nonradioactive CTP (lanes 1). In the presence of either 4 nM purified Elongin A3 or 8 nM purified Elongin A (lanes 2 and 3), nearly all of the ~135-nucleotide transcripts had been chased into the longer transcripts. Notably, the transcripts synthesized in the presence of Elongin A were substantially longer than those synthesized in the presence of Elongin A3. However, the addition of Elongin A3 to Elongin A resulted in a substantial inhibition of Elongin A activity, and RNA chain elongation progressed at an intermediate rate (lane 4). These results suggest that Elongin A3 and Elongin A act not in a complementary way but rather via a similar mechanism. Although we do not know the mechanism of this action, the two may share the surface of RNA polymerase II.

What might be the roles of members of the Elongin A family in vivo? Because Elongin A is capable of stimulating the rate of elongation through a wide variety of DNA templates tested in vitro, this factor has been considered to be a general elongation factor. However, cDNA microarray analyses using the wild-type and Elongin A-deficient ES cells indicate that the expression of only a small percentage of genes is significantly reduced in the mutant cells.2 These findings suggest that members of the Elongin A family are not general elongation factors and that each factor regulates the expression of a distinct set of genes. Furthermore, it is also possible that Elongins A2 and A3 work as negative regulators of Elongin A in vivo by binding to Elongin BC and inhibiting its ability to activate the transcriptional activity of Elongin A. Alternatively, the Elongin A family could have some other cellular functions. It was recently reported that the Elongin A-Elongin BC complex is capable of assembling with known components of the ubiquitin ligase, Cul5 and Rbx1 (23). We have also found that both Elongins A2 and A3 are capable of assembling with these proteins as efficiently as Elongin A (data not shown). These findings raise the intriguing possibility that at least one of the functions of the Elongin A family may be to participate in ubiquitin-dependent degradation of components of the RNA polymerase II elongation machinery.

    ACKNOWLEDGEMENTS

We thank Drs. Joan W. Conaway and Ronald C. Conaway for providing the anti-Elongin B antibody.

    FOOTNOTES

* This work was supported in part by grants from the Ministry of Education, Culture, Sports, Science, and Technology of Japan, the Takeda Science Foundation, the National Space Development Agency of Japan, and the Japan Space Forum.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AB076840.

** To whom correspondence should be addressed: Dept. of Chemistry, Faculty of Medicine, Kochi Medical School, Kohasu, Oko-cho, Nankoku, Kochi 783-8505, Japan. Tel.: 81-88-880-2279; Fax: 81-88-880-2281; E-mail: asot@kochi-ms.ac.jp.

Published, JBC Papers in Press, May 6, 2002, DOI 10.1074/jbc.M202859200

2 K. Yamazaki, T. Aso, S. Kitajima, and Y. Nakabeppu, unpublished data.

    ABBREVIATIONS

The abbreviations used are: TF, transcription factor; VHL, von Hippel-Lindau; PMSF, phenylmethylsulfonyl fluoride; EST, expressed sequence tag; Ni2+-agarose, Ni2+-nitrilotriacetic acid-agarose; AdML, adenovirus 2 major late; PBS, phosphate-buffered saline; TBP, TATA-binding protein; DAPI, 4',6-diamidino-2-phenylindole dihydrochloride.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
REFERENCES

1. Roeder, R. G. (1996) Trends Biochem. Sci. 21, 327-335[CrossRef][Medline] [Order article via Infotrieve]
2. Aso, T., Conaway, J. W., and Conaway, R. C. (1995) FASEB J. 9, 1419-1428[Abstract]
3. Reines, D., Conaway, J. W., and Conaway, R. C. (1996) Trends Biochem. Sci. 21, 351-355[CrossRef][Medline] [Order article via Infotrieve]
4. Uptain, S. M., Kane, C. M., and Chamberlin, M. J. (1997) Annu. Rev. Biochem. 66, 117-172[CrossRef][Medline] [Order article via Infotrieve]
5. Conaway, J. W., Shilatifard, A., Dvir, A., and Conaway, R. C. (2000) Trends Biochem. Sci. 25, 375-380[CrossRef][Medline] [Order article via Infotrieve]
6. Wind, M., and Reines, D. (2000) Bioessays 22, 327-336[CrossRef][Medline] [Order article via Infotrieve]
7. Marshall, N. F., and Price, D. H. (1995) J. Biol. Chem. 270, 12335-12338[Abstract/Free Full Text]
8. Price, D. H., Sluder, A. E., and Greenleaf, A. L. (1989) Mol. Cell. Biol. 9, 1465-1475[Abstract/Free Full Text]
9. Aso, T., Lane, W. S., Conaway, J. W., and Conaway, R. C. (1995) Science 269, 1439-1443[Abstract/Free Full Text]
10. Aso, T., Yamazaki, K., Amimoto, K., Kuroiwa, A., Higashi, H., Matsuda, Y., Kitajima, S., and Hatakeyama, M. (2000) J. Biol. Chem. 275, 6546-6552[Abstract/Free Full Text]
11. Shilatifard, A., Lane, W. S., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1996) Science 271, 1873-1876[Abstract]
12. Selby, C. P., and Sancar, A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11205-11209[Abstract/Free Full Text]
13. Bradsher, J. N., Jackson, K. W., Conaway, R. C., and Conaway, J. W. (1993) J. Biol. Chem. 268, 25587-25593[Abstract/Free Full Text]
14. Garrett, K. P., Tan, S., Bradsher, J. N., Lane, W. S., Conaway, J. W., and Conaway, R. C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5237-5241[Abstract/Free Full Text]
15. Garrett, K. P., Aso, T., Bradsher, J. N., Foundling, S. I., Lane, W. S., Conaway, R. C., and Conaway, J. W. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7172-7176[Abstract/Free Full Text]
16. Aso, T., Haque, D., Barstead, R. J., Conaway, R. C., and Conaway, J. W. (1996) EMBO J. 15, 5557-5566[Medline] [Order article via Infotrieve]
17. Duan, D. R., Pause, A., Burgess, W. H., Aso, T., Chen, D. Y. T., Garrett, K. P., Conaway, R. C., Conaway, J. W., Linehan, W. M., and Klausner, R. D. (1995) Science 269, 1402-1406[Abstract/Free Full Text]
18. Kibel, A., Iliopoulos, O., DeCaprio, J. A., and Kaelin, W. G. (1995) Science 269, 1444-1446[Abstract/Free Full Text]
19. Kishida, T., Stackhouse, T. M., Chen, F., Lerman, M. I., and Zbar, B. (1995) Cancer Res. 55, 4544-4548[Abstract/Free Full Text]
20. Aso, T., Haque, D., Fukudome, K., Brower, C. S., Conaway, J. W., and Conaway, R. C. (1996) Gene (Amst.) 168, 277-278[CrossRef][Medline] [Order article via Infotrieve]
21. Conaway, J. W., and Conaway, R. C. (1990) Science 248, 1550-1553[Abstract/Free Full Text]
22. Chen, H. C., England, L., and Kane, C. M. (1992) Gene 116, 253-258[CrossRef][Medline] [Order article via Infotrieve]
23. Kamura, T., Burian, D., Yan, Q., Schmidt, S. L., Lane, W. S., Querido, E., Branton, P. E., Shilatifard, A., Conaway, R. C., and Conaway, J. W. (2001) J. Biol. Chem. 276, 29748-29753[Abstract/Free Full Text]
24. Ho, Y., Gruhler, A., Heilbut, A., Bader, G. D., Moore, L., Adams, S. L., Millar, A., Taylor, P., Bennett, K., Boutilier, K., Yang, L., Wolting, C., Donaldson, I., Schandorff, S., Shewnarane, J., Vo, M., Taggart, J., Goudreault, M., Muskat, B., Alfarano, C., Dewar, D., Lin, Z., Michalickova, K., Willems, A. R., Sassi, H., Nielsen, P. A., Rasmussen, K. J., Andersen, J. R., Johansen, L. E., Hansen, L. H., Jespersen, H., Podtelejnikov, A., Nielsen, E., Crawford, J., Poulsen, V., Sorensen, B. D., Matthiesen, J., Hendrickson, R. C., Gleeson, F., Pawson, T., Moran, M. F., Durocher, D., Mann, M., Hogue, C. W., Figeys, D., and Tyers, M. (2002) Nature 415, 180-183[CrossRef][Medline] [Order article via Infotrieve]
25. Kamura, T., Sato, S., Haque, D., Liu, L., Kaelin, W. G., Conaway, R. C., and Conaway, J. W. (1998) Genes Dev. 12, 3872-3881[Abstract/Free Full Text]
26. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-52[Abstract/Free Full Text]
27. Bossemeyer, D. (1994) Trends Biochem. Sci. 19, 201-205[CrossRef][Medline] [Order article via Infotrieve]
28. Aso, T., Amimoto, K., Takebayashi, S., Okumura, K., and Hatakeyama, M. (1999) Cytogenet. Cell Genet. 86, 259-262[CrossRef][Medline] [Order article via Infotrieve]
29. Xiao, H., Palhan, V., Yang, Y., and Roeder, R. G. (2000) EMBO J. 19, 956-963[CrossRef][Medline] [Order article via Infotrieve]
30. Koth, C. M., Botuyan, M. V., Moreland, R. J., Jansma, D. B., Conaway, J. W., Conaway, R. C., Chazin, W. J., Friesen, J. D., Arrowsmith, C. H., and Edwards, A. M. (2000) J. Biol. Chem. 275, 11174-11180[Abstract/Free Full Text]
31. Kroll, S. L., Paulding, W. R., Schnell, P. O., Barton, M. C., Conaway, J. W., Conaway, R. C., and Czyzyk-Krzeska, M. F. (1999) J. Biol. Chem. 274, 30109-30114[Abstract/Free Full Text]
32. Stuhlmüller, B., Ungethüm, U., Scholze, S., Martinez, L., Backhaus, M., Kraetsch, H., Kinne, R. W., and Burmester, G. (2000) Arthritis Rheum. 43, 775-790[CrossRef][Medline] [Order article via Infotrieve]
33. Warskulat, U., Kreuels, S., Müller, H. W., and Haussinger, D. (2001) 35, 358-366
34. Conaway, J. W., and Conaway, R. C. (1999) Annu. Rev. Biochem. 68, 301-319[CrossRef][Medline] [Order article via Infotrieve]


Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
Y. Ling, A. J. Smith, and G. T. Morgan
A sequence motif conserved in diverse nuclear proteins identifies a protein interaction domain utilised for nuclear targeting by human TFIIS.
Nucleic Acids Res., January 1, 2006; 34(8): 2219 - 2229.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Gerber, K. Tenney, J. W. Conaway, R. C. Conaway, J. C. Eissenberg, and A. Shilatifard
Regulation of Heat Shock Gene Expression by RNA Polymerase II Elongation Factor, Elongin A
J. Biol. Chem., February 11, 2005; 280(6): 4017 - 4020.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Gerber, J. C. Eissenberg, S. Kong, K. Tenney, J. W. Conaway, R. C. Conaway, and A. Shilatifard
In Vivo Requirement of the RNA Polymerase II Elongation Factor Elongin A for Proper Gene Expression and Development
Mol. Cell. Biol., November 15, 2004; 24(22): 9911 - 9919.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
R. J. Sims III, R. Belotserkovskaya, and D. Reinberg
Elongation by RNA polymerase II: the short and long of it
Genes & Dev., October 15, 2004; 18(20): 2437 - 2468.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Yamazaki, T. Aso, Y. Ohnishi, M. Ohno, K. Tamura, T. Shuin, S. Kitajima, and Y. Nakabeppu
Mammalian Elongin A Is Not Essential for Cell Viability but Is Required for Proper Cell Cycle Progression with Limited Alteration of Gene Expression
J. Biol. Chem., April 4, 2003; 278(15): 13585 - 13589.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/29/26444    most recent
M202859200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yamazaki, K.
Right arrow Articles by Aso, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yamazaki, K.
Right arrow Articles by Aso, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg