Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M109320200 on November 7, 2001

J. Biol. Chem., Vol. 277, Issue 3, 1669-1679, January 18, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/3/1669    most recent
M109320200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walters, M. R.
Right arrow Articles by Smith, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walters, M. R.
Right arrow Articles by Smith, C. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

SKF-82958 Is a Subtype-selective Estrogen Receptor-alpha (ERalpha ) Agonist That Induces Functional Interactions between ERalpha and AP-1*

Marian R. WaltersDagger §, Martin Dutertre§, and Carolyn L. Smith§||

From the Dagger  Department of Physiology, Tulane Medical School, New Orleans, Louisiana 70112 and the § Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas 77030

Received for publication, September 26, 2001, and in revised form, October 18, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The transcriptional activity of estrogen receptors (ERs) can be regulated by ligands as well as agents such as dopamine, which stimulate intracellular signaling pathways able to communicate with these receptors. We examined the ability of SKF-82958 (SKF), a previously characterized full dopamine D1 receptor agonist, to stimulate the transcriptional activity of ERalpha and ERbeta . Treatment of HeLa cells with SKF-82958 stimulated robust ERalpha -dependent transcription from an estrogen-response element-E1b-CAT reporter in the absence of estrogen, and this was accompanied by increased receptor phosphorylation. However, induction of ERbeta -directed gene expression under the same conditions was negligible. In our cell model, SKF treatment did not elevate cAMP levels nor enhance transcription from a cAMP-response element-linked reporter. Control studies revealed that SKF-82958, but not dopamine, competes with 17beta -estradiol for binding to ERalpha or ERbeta with comparable relative binding affinities. Therefore, SKF-82958 is an ERalpha -selective agonist. Transcriptional activation of ERalpha by SKF was more potent than expected from its relative binding activity, and further examination revealed that this synthetic compound induced expression of an AP-1 target gene in a tetradecanoylphorbol-13-acetate-response element (TRE)-dependent manner. A putative TRE site upstream of the estrogen-response element and the amino-terminal domain of the receptor contributed to, but were not required for, SKF-induced expression of an ERalpha -dependent reporter gene. Overexpression of the AP-1 protein c-Jun, but not c-Fos, strongly enhanced SKF-induced ERalpha target gene expression but only when the TRE was present. These studies provide information on the ability of a ligand that weakly stimulates ERalpha to yield strong stimulation of ERalpha -dependent gene expression through cross-talk with other intracellular signaling pathways producing a robust combinatorial response within the cell.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The effects of estrogens are mediated by the products of two separate genes, one for estrogen receptor-alpha (ERalpha )1 and another for ERbeta . Both are members of the nuclear receptor superfamily of ligand-activated transcription factors. The mechanisms by which ERs activate target gene expression in response to estrogen signaling have been the subject of intense investigation since their respective cDNAs were cloned (1, 2). Because of the relatively recent identification of ERbeta , the bulk of our knowledge regarding the genomic effects of estrogens is derived from ERalpha studies. For instance, upon binding to 17beta -estradiol (E2), ERalpha undergoes a series of biochemical alterations including increased phosphorylation and conformational changes as well as homodimerization and binding of the receptor to its target DNA sequence, the estrogen-response element (ERE; see Refs. 3-5). ERbeta also undergoes conformational changes in response to ligand binding (6, 7) and is phosphorylated in vivo (8). With respect to DNA binding, ERbeta binds to the same consensus ERE that ERalpha does, although the latter receptor has an ~4-fold higher affinity for this DNA sequence in comparison to ERbeta (9, 10).

Whereas many aspects of the regulation of ERalpha and ERbeta transcriptional activity are quite similar (e.g. both bind to EREs and activate transcription in response to E2 binding), a number of differences between these receptors have been noted. For instance, on ERE-containing reporters, ligands such as 4-hydroxytamoxifen exert partial agonist activity on ERalpha but act as ERbeta antagonists (11). This is likely related to differences in the poorly conserved structure and function of the hormone-independent activation function-1 (AF-1) domain that is located in the amino termini of these receptors (11-13). The carboxyl-terminal AF-2 domain is hormone-dependent, reflecting the ability of agonists to bind to the ligand binding domain of the receptor and induce a conformational change that creates a binding site for coactivators such as steroid receptor coactivator-1 (SRC-1) and its related family members (14, 15). Intriguingly, this domain is only ~60% conserved between ERalpha and ERbeta , and small differences in the affinity of these two receptors for ligands such as genistein and 16alpha -bromo-17beta -estradiol have been demonstrated (16, 17). Although several contexts exist whereby the transcriptional activity of ERalpha is derived predominantly from the AF-1 or AF-2 domains, in most cells the two activation functions work together to bring about a synergistic activation of transcription (18-20). In contrast, the amino terminus of ERbeta possesses relatively low transcriptional activity in comparison to ERalpha , and this region has been shown to repress the activity of the AF-2 domain of ERbeta (11-13).

Estrogen receptors, in addition to their regulation by ligands, can also be activated by extracellular agents that initiate intracellular signal transduction pathways (reviewed in Ref. 21). For instance, epidermal growth factor or insulin-like growth factor-1 treatment of cells results in initiation of a mitogen-activated protein kinase (MAPK) signal transduction cascade leading to phosphorylation of the Ser118 phosphorylation site of ERalpha and stimulation of ERalpha transcriptional activity (22-24). Similarly, activation of MAPKs by either epidermal growth factor treatment or by transfection of a dominant active form of Ras induces ERbeta phosphorylation and transcriptional activity (8, 25), and this is accompanied by a phosphorylation-dependent recruitment of the SRC-1 coactivator (26). In addition to growth factors, insulin, heregulin, 3,3'-diindolylmethane, and the neurotransmitter dopamine can also stimulate ERalpha transcriptional activity in the apparent absence of ligand (27-31). The latter was among the first agents demonstrated to stimulate ERalpha transcriptional activity in a ligand-independent manner (31). There is no information on the ability of dopamine to stimulate ERbeta transcriptional activity. However, dopaminergic activation is not unique to ERalpha , because this neurotransmitter also activates the human vitamin D (but not glucocorticoid) and chicken progesterone receptors (31, 32). Furthermore, in vivo studies have demonstrated that dopamine receptor agonists administered to the third ventricle of the brain lead to initiation of lordosis behavior, a progesterone receptor (PR)-dependent biological response in rodents (33-35).

Dopamine receptors are members of the G protein-coupled receptor superfamily, and five genes encoding the D1-D5 subtypes of dopamine receptor have been identified (36). Studies with subtype-specific synthetic dopamine receptor agonists indicate that it is the D1 and/or D5 dopamine receptors that stimulate steroid receptor transcriptional activity (33, 34, 37), and this is associated with D1 and D5 dopamine receptor stimulation of intracellular cAMP production (36). The mechanisms by which the dopaminergic cell signaling pathway communicates with ERalpha are not well defined, but it is presumed that increased ERalpha phosphorylation contributes to this process. In this regard, it is interesting to note that cAMP signaling pathways stimulate ERalpha transcriptional activity and phosphorylation (38, 39). The chicken PR is also ligand-independently activated by treatment of cells with dopamine or agents that increase intracellular cAMP levels (31, 40). However, cAMP activation of PR-dependent transcription is not accompanied by increased receptor phosphorylation but rather by an increase in the phosphorylation of the SRC-1 coactivator with which the receptor interacts to stimulate gene expression (41, 42). Taken together, the data support a model in which dopamine and cAMP signaling pathways stimulate gene expression in a receptor-specific manner.

Alterations in the biology of dopamine and its receptors play an important role in a number of human diseases, such as Parkinson's disease, as well as contribute to the reward seeking behaviors associated with cocaine abuse (43-45). The molecular mechanisms of dopamine and dopamine receptor action have therefore been extensively studied, and these efforts have been aided by the identification of high affinity and potent ligands for dopamine receptors. One such compound, SKF-82958 (SKF), is a full dopamine D1 subtype-selective receptor agonist with greater potency than dopamine (46, 47). SKF has also been shown to stimulate the transcriptional activity of ERalpha in SK-N-SH neuroblastoma and MCF-7 breast cancer cells (27, 37). We therefore used SKF-82958 to determine the ability of dopaminergic signaling pathways to regulate ERbeta transcriptional activity. We observed that this D1 receptor-selective agonist stimulated the transcriptional activity of ERalpha but had negligible agonist activity for ERbeta . We also found that SKF-82958 stimulates phosphorylation of ERalpha to an extent similar to that observed for E2. However, SKF-82958 competed with E2 for binding to the receptor, suggesting that it exerts at least some of its effects on ERalpha transcriptional activity as an ERalpha agonist. Stimulation of ERalpha transactivation was greater than that anticipated from its relative binding affinity for ERalpha , and we therefore examined the ability of SKF-82958 to stimulate intracellular signal transduction pathways. Whereas SKF-82958 did not increase cAMP production, it did stimulate pathways leading to activation of AP-1, a transcription factor known to functionally interact with many steroid receptors (3), and we therefore examined the contribution of AP-1 to SKF-induced ERalpha transcriptional activity. These studies provide novel information on the ability of a compound to stimulate simultaneously the activity of two transcription factors and in so doing produce robust stimulation of gene expression through a combinatorial response within the cell.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Chemicals-- E2, tetradecanoylphorbol-13-acetate (TPA), and poly-L-lysine were obtained from Sigma. The anti-estrogens, ICI 182,780 and 4-hydroxytamoxifen were gifts from Alan Wakeling (Zeneca Pharmaceuticals, Macclesfield, UK) and D. Salin-Drouin (Laboratoires Besins Iscovesco, Paris, France), respectively. 8-Bromo-cyclic AMP (8-Br-cAMP) and 3-isobutyl-1-methylxanthine (IBMX) were purchased from Research Biochemicals International (Natick, MA) as were dopamine and the synthetic D1 receptor agonist, SKF-82958. All other chemicals were reagent grade.

Plasmids-- The mammalian expression vectors for wild type human ERalpha (pCMV5-hERalpha ) and its corresponding phosphorylation mutants (S104A/S106A/S118A, S118A and S167A) have been described previously (39) as have the plasmids for human ERbeta (pCMV5-hERbeta (48)), mouse ERalpha -Y541A (49), c-Jun (pRSV-jun (50)), c-Fos (pBK-28 (51)), and the pRSV-Not control vector (52). Experiments with deletion mutants of ERalpha used constructs encoding wild type ERalpha (amino acids 1-595), ERalpha -N282G (amino acids 1-282), ERalpha -179C (amino acids 179-595), ERalpha -3× (amino acids 1-595 with three point mutations, D538A/E542A/D545A), and ERalpha -179C-3× (amino acids 179-595 with the D538A/E542A/D545A mutations) expressed from the pRST7 vector (20). Plasmids for the SRC-1e, TIF2, RAC3, and CBP coactivators in the pCR3.1 expression vector have been described previously (53). The estrogen-responsive reporter genes, ERE-E1b-CAT (54) and ERE-E1b-LUC (55), have been used in previous studies, and both contain nucleotides -331 to -87 of the vitellogenin A2 promoter linked upstream of the adenovirus E1b TATA box. The p-169alpha CG-CAT and p-100alpha CG-CAT reporter genes contain portions of the chorionic gonadotropin gene, with or without a cAMP-response element (CRE), respectively, upstream of the chloramphenicol acetyltransferase (CAT) reporter gene (56). The coll73-CAT reporter and the coll60-CAT reporters contain portions of the collagenase gene upstream of CAT differing in the inclusion or exclusion of a TRE, respectively (57). An expression vector for beta -galactosidase, pCMVbeta , was obtained from CLONTECH (Palo Alto, CA).

The mammalian expression vector for FLAG-hERalpha was constructed as follows. The yeast expression vector for human ERalpha , YEPE2 (58), was digested with TthIII, blunted, and subsequently digested with KpnI. The resulting fragment was cloned into the BamHI (blunted) and KpnI sites of pSelect-1 (Promega). The ER cDNA was removed from the resulting vector with KpnI and SalI restriction enzyme digestion and subcloned into the mammalian expression vector, pJ3Omega (59), to create pJ3-hERVal400. The amino-terminal FLAG epitope was created by utilizing a PCR approach. Briefly, a 5' primer (5'-GGGGTCGACCATGGACTACAAGGACGACGATGACAAGATGACCATGACCCTCCAC) encoding a methionine residue linked to the FLAG epitope sequence (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) and the first six amino acids of human ERalpha and a 3' primer (5'-GCGCTTGTGTTTCAACATTCTCC) corresponding to nucleotides 1017-1039 were used to amplify an 844-base pair nucleotide fragment of the ERalpha cDNA using pSVMTwt:ER as template (30). The resulting PCR product was digested with SalI and NotI and substituted for the SalI-NotI fragment of pJ3-hERVal400 to create pJ3-FLAG-hERalpha Val400. To replace Val400 with cDNA encoding the wild type amino acid (Gly400), the NotI-SacI fragment of pSVMTwt:ER (corresponding to amino acids 65 to 595) was substituted for the corresponding region of pJ3-FLAG-hERalpha Val400 to create pJ3-FLAG-hERalpha .

Reporter genes lacking the putative TRE were generated from the parent ERE-E1b-CAT plasmid by deletion or site-directed mutagenesis. In the former case, a 195-bp fragment of ERE-E1b-CAT was removed by digestion with NdeI and Eco0109I. The resulting vector was blunt-ended with Klenow and religated to yield ERE-E1b-CAT(Delta Nde-Eco). To remove the putative TRE sequence by site-directed mutagenesis, the SspI-HindIII fragment of ERE-E1b-CAT was subcloned into pALTER-1 (Promega). By using the PCR Site-directed Mutagenesis System (Invitrogen) and a mutagenic primer, the putative TRE sequence, TGACACA, was mutated to GGACTCA following the manufacturer's recommendations. The latter sequence had been demonstrated previously to prevent AP-1 binding (60). Following sequencing to verify appropriate nucleotide substitutions, a NdeI-Eco0109I fragment was removed from pALTER-1 and substituted for the comparable region of ERE-E1b-CAT to generate ERE-E1b-CAT(mTRE).

Cell Culture, DNA Transfections, and Transactivation Assays-- HeLa cells were routinely maintained in Dulbecco's modified Eagle's media (DMEM) supplemented with 10% fetal bovine serum. DNA transfections were performed by either Lipofectin (Invitrogen) or adenovirus-mediated approaches (61). For transactivation assays, 24 h prior to transfection, 3 × 105 HeLa cells were seeded per well of a 6-well multiple dish in phenol red-free DMEM containing 5% dextran-coated, charcoal-stripped serum (sFBS). For Lipofectin transfections, cells were incubated with the indicated DNAs and Lipofectin according to the manufacturer's guidelines. Six hours later, the DNA/Lipofectin mixture was removed, and cells were fed with phenol red-free media containing 5% sFBS and the indicated treatments, and 24 h thereafter the cells were harvested.

To prepare reagents for adenovirus-mediated transfections, replication-deficient adenovirus dl312 was propagated and covalently modified with poly-L-lysine by the method of Cristiano et al. (62) modified as described previously (61). CsCl-purified fractions of the modified virus were stored at -80 C until use. Adenovirus-DNA complexes were prepared by adding the lysine-modified adenovirus to plasmid DNA and subsequently incubating with a 200-fold molar excess of poly-L-lysine (Mr 18,000-20,000). The adenovirus-DNA-lysine complex was then added to the cells at a virus to cell multiplicity of infection of 500:1. After incubation for 2 h, the medium was replaced with phenol red-free DMEM supplemented with 5% sFBS. Hormones and/or other treatments, as indicated, were added to the cells 4 h later, and the cells were then harvested 24 h thereafter.

Assays of reporter gene expression were performed on cell extracts prepared by lysing cells by rapid freeze-thaw or addition of lysis buffer (Promega). CAT activity was measured by a phase-extraction method utilizing [3H]chloramphenicol (Perkin-Elmer Life Sciences) and butyryl-coenzyme A (Amersham Biosciences) as substrates (30, 63). Luciferase activity was measured using the Luciferase Assay System (Promega). Duplicate samples were measured in each experiment, and data are presented as the average ± S.E. of at least three experiments normalized to protein content measured by Bio-Rad protein assay reagent or beta -galactosidase.

Relative Binding Affinity Assays-- Relative receptor binding affinities were determined in vivo as described previously (64). Briefly, the adenovirus-mediated DNA transfer procedure was used to transfect HeLa cells with 0.25 µg/well of the appropriate expression vector (pCMV5-hERalpha or pCMV5-hERbeta ). Twenty four hours later, media were aspirated from wells and replaced with phenol red-free DMEM containing 5% sFBS, ~1 pmol of [3H]estradiol (Perkin-Elmer Life Sciences), and increasing concentrations (ranging from 10-10 to 10-3 M) of either unlabeled E2, SKF-82958, or dopamine. Following 2 h of incubation at 37 °C, media were aspirated from plates, and cells were washed 3 times in cold PBS and then incubated in 100% ethanol for 15 min at room temperature to extract bound steroid. The amount of ER-bound [3H]estradiol in the ethanol extract was quantified with a Beckman LS 6500 scintillation counter and Biodegradable Counting Scintillant (Amersham Biosciences).

Western Blot Analyses-- To assess ER expression, cells were transfected as described above and harvested for Western blot analysis 24 h later. Cell pellets were resuspended in 50 mM Tris buffer (pH 8.0) containing 400 mM NaCl, 5 mM EDTA, 1% Nonidet P-40, 0.2% Sarkosyl, 100 µM sodium vanadate, 10 mM sodium molybdate, and 20 mM NaF, incubated on ice for 60 min, and centrifuged at 12,000 × g for 10 min at 4 °C. The resulting supernatant was mixed with SDS-PAGE loading buffer, resolved by 7.5% SDS-PAGE, and electrotransferred to nitrocellulose. Filters were incubated sequentially with primary antibodies against ERalpha (H222) or the FLAG epitope (M2; Sigma) and the appropriate horseradish peroxidase-conjugated antibody. Immunodetection was performed with enhanced chemiluminescence (ECL) reagents as recommended by the manufacturer (Amersham Biosciences).

32P Labeling and ERalpha Immunoprecipitation-- Cells were transfected with either pJ3-FLAG-hERalpha or pJ3Omega by the adenovirus method. Eight hours later, media were removed, and cells were rinsed with phosphate-free DMEM and re-fed with phosphate-free DMEM containing 5% dialyzed charcoal-stripped fetal calf serum (HyClone, Logan, UT). Radiolabeled inorganic phosphate (83 µCi/ml media) was added, and cells were incubated for 16 h. Vehicle (ethanol), 1 nM E2, or 25 µM SKF-82958 was added 90 min prior to harvesting cells. Cells were lysed in 50 mM Tris (pH 8.0) containing 5 mM EDTA, 1% Triton X-100, 0.2% Sarkosyl, 400 mM NaCl, 200 µM sodium vanadate, 10 mM sodium molybdate, 50 mM sodium fluoride, 1 mM phenylmethylsulfonyl fluoride (PMSF), 5 µg/ml aprotinin, 3 µg/ml leupeptin, 3 µg/ml pepstatin, 20 mM disodium p-nitrophenyl phosphate, 25 mM beta -glycerophosphate, 5 mM L-Phe-Ala, and 0.15 mM 1,10-phenanthroline for 60 min on ice. Lysates were precleared with rabbit anti-rat IgG and protein A-Sepharose prior to the sequential addition of 5 µg of H222 antibody, 10 µg of rabbit anti-rat IgG, and protein A-Sepharose. The immunoreactive Sepharose complex was washed with 100 mM Tris buffer (pH 9.0) containing 150 mM NaCl, 1% Triton, 1% Tween 20, 20 mM sodium fluoride, 1 mM sodium vanadate, and 10 mM sodium molybdate and eluted with 1 M acetic acid. Samples were resolved by 7.5% SDS-PAGE and electroblotted to nitrocellulose and subjected to autoradiography at -80 °C. Protein levels were subsequently assessed by subjecting this same membrane to Western blot analysis using the anti-FLAG M2 antibody, followed by a secondary antibody of horseradish peroxidase-conjugated sheep anti-mouse IgG. Signals were revealed with ECL methods following the manufacturer's instructions (Amersham Biosciences). The 32P signals were quantitated by a Betagen Betascope 603 Blot Analyzer and normalized to immunoprecipitated protein assessed by Western blot analysis and quantitated by scanning laser densitometry (model 620, Bio-Rad Laboratories).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

SKF-82958 Activation of ERalpha -dependent Gene Transcription-- As reported previously (37), the dopamine D1-selective agonist SKF-82958 (±-6-chloro-7,8-dihydroxy-3-allyl-1-phenyl-2,3,4,5-tetrehydro-1H-3-benzazepine; see Fig. 1A), like dopamine, can stimulate ERalpha transcriptional activity, and this is inhibited by the pure ER antagonist ICI 182,780 (Fig. 1B). Dose-response studies indicated that half-maximal induction of ER-directed gene expression by SKF-82958 occurred at 2 µM (data not shown). In contrast, maximal dopamine induction of ER-directed gene expression occurs at 100-250 µM (23, 30, 31), suggesting that SKF-82958 is a more potent activator of this response. However, the potency (Km) and maximum efficacy of SKF-82958 induction of cAMP are similar to that for dopamine in rat brain striatum after treatment in vivo (46). This discrepancy suggested that there may be mechanistic differences in the ability of SKF-82958 and dopamine to stimulate ERalpha transcriptional activity.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 1.   SKF-82958 activates ERalpha -dependent gene expression. A, chemical structures of the compounds used to regulate ERalpha activity in this study. B, activation of ERE-E1b-Luc target gene expression by SKF-82958 is ER-dependent. HeLa cells were transfected with expression vectors for ERalpha (pCMV5-hERbeta ) and beta -galactosidase (pCMVbeta ), and the ERE-E1b-Luc reporter gene and subsequently treated with ethanol (vehicle), 1 nM E2, or 10 µM SKF in the absence or presence of 100 nM ICI 182,780. Data represent the average of three independent experiments ± S.E. C, SKF-82958 does not stimulate CRE-dependent transcriptional activity. HeLa cells were transfected with either a CRE-containing (p-169alpha CG-CAT) or CRE-minus (p-100alpha CG-CAT) reporter gene and subsequently treated with ethanol (Vehicle), 1 nM E2, 25 µM SKF, 1 mM 8-Br-cAMP, and 100 µM IBMX (cAMP), or 200 µM dopamine (DA). Activation data represent the average ± S.E. of three independent experiments.

To investigate this further, relative to the mechanisms of SKF-82958 activation of ERalpha -dependent gene expression, SKF stimulation of cAMP production in HeLa cells was examined by radioimmunoassay and compared with the ability of SKF to activate ER-dependent gene expression. No correlation was found, as micromolar doses of SKF-82958 failed to elevate significantly cAMP levels (data not shown). To mimic more closely the conditions under which our transactivation assays are performed, the ability of SKF-82958 to stimulate CRE-dependent transcription was assessed. The -169alpha CG-CAT gene is composed of a fragment of the human chorionic gonadotropin gene promoter containing a CRE element, linked upstream of the CAT reporter gene, and is activated by cAMP stimulation of the cAMP-response element-binding protein transcription factor (56). The -100alpha CG-CAT reporter gene that lacks the CRE was used as a negative control. As shown in Fig. 1C, CRE-dependent transcription was stimulated by 8-Br-cAMP and, more modestly, by dopamine. However, there was no stimulation of CRE-dependent transcription by E2 or SKF-82958. These results suggest that SKF-82958 is not acting through stimulation of cAMP-dependent dopaminergic signaling in this system. This result led to a consideration of whether this compound activated ER-dependent gene expression through direct binding to ERalpha . This question is further underscored by the ring structure of this synthetic D1 receptor agonist (Fig. 1A), which is reminiscent of the structures of some ER agonists and antagonists (65).

SKF-82958 Binds to ERalpha and ERbeta but Preferentially Activates ERalpha -- To determine whether SKF-82958 could bind to ERs, whole cell competitive hormone binding assays were performed in HeLa cells transfected with expression vectors for either ERalpha or ERbeta . Cells were incubated with [3H]estradiol and increasing amounts of unlabeled E2, SKF-82958, or dopamine. The displacement curves for ERalpha and ERbeta indicate that SKF-82958 can compete weakly with estradiol for binding to both forms of ER but that dopamine is unable to do so (Fig. 2, A and B). The average relative binding affinities of SKF-82958 in comparison to E2 (100) for ERalpha (0.077 ± 0.018; n = 4) and ERbeta (0.069 ± 0.009; n = 3) are similar and are comparable with those measured by other investigators for low affinity ER agonists such as bisphenol A (16). This result suggests that activation of ER-dependent gene expression may arise through SKF-82958 binding to ERs and serving as a weak receptor agonist, and we therefore wanted to determine whether SKF-82958 could activate both subtypes of ER.


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 2.   SKF-82958 binds to ERalpha and ERbeta . In vivo hormone binding assays of ERalpha (A) or ERbeta (B) were performed to assess the relative binding affinity of E2, SKF, or dopamine (DA) with respect to competition for [3H]estradiol binding to receptor. Total [3H]estradiol binding in the absence of competitor (black-diamond ) is shown for cells treated with ethanol (Veh). Values represent the average of duplicate samples from a representative experiment. Similar results were obtained in n = 3-4 independent experiments.

HeLa cells were transfected with expression vectors for human ERalpha or ERbeta and the ERE-E1b-Luc reporter gene, which consists of the ERE from the vitellogenin A2 promoter linked to the TATA box sequence of the adenovirus E1b gene and luciferase reporter gene. SKF-82958 was not able to activate significantly ERbeta -dependent gene expression in comparison to the ability of this compound to stimulate ERalpha transcriptional activity as shown in Fig. 3A or in dose-response studies (data not shown). SKF therefore appears to be an ERalpha -preferential agonist. To ensure that SKF-82958 induction of ERalpha -dependent gene expression was not due to ligand stabilization of ERalpha expression, Western blot analysis of ERalpha expression in cells treated with vehicle, E2, and SKF-82958 was performed, and like E2 and dopamine (30, 53), SKF was found to down-regulate the expression of ERalpha in HeLa cells (Fig. 3B). The ability of SRC family and CBP coactivators to enhance SKF-induced ERalpha transactivation was also examined. Each was able to significantly enhance the transcriptional activity of ERalpha (Fig. 3C), suggesting that SKF-82958 binding to the receptor allows coactivator-ERalpha functional interactions.


View larger version (24K):
[in this window]
[in a new window]
  		Fig. 3.   SKF-82958 is an ERalpha -selective activator of transcription. A, HeLa cells were transfected with expression vectors for ERalpha (pCMV5-hERalpha ) or ERbeta (pCMV5-hERbeta ) along with ERE-E1b-Luc and pCMVbeta , and subsequently treated with ethanol (Veh), 1 nM E2, or 10 µM SKF. Data represent the average ± S.E. of four independent experiments. B, down-regulation of ERalpha expression by SKF. Western blot analysis of cell extracts prepared from HeLa cells transfected with an ERalpha expression vector and subsequently treated with ethanol (Veh), 1 nM E2, or 25 µM SKF. Signals were detected with H222 antibody. C, HeLa cells were transfected with ERE-Elb-Luc and expression vectors for ERalpha and beta -galactosidase along with plasmids for SRC-1e, TIF2, RAC3, CBP, or the corresponding parental (empty) vector, pCR3.1. Cells were subsequently treated with ethanol (Veh), 1 nM E2 or 10 µM SKF. Values represent results from an experiment performed in duplicate and repeated at least three times.

Characterization of FLAG-tagged ERalpha -- Activation of human ERalpha by E2 is accompanied by increased receptor phosphorylation (39, 66). To determine whether SKF-82958 alters the biochemical properties of ERalpha , the phosphorylation status of the receptor was assessed in HeLa cells treated with SKF-82958 versus E2. First, an expression vector was constructed for FLAG-ERalpha so that distinct antibodies could be used for immunoprecipitation (anti-ERalpha ) and for receptor quantitation by Western blot analysis (anti-FLAG). To demonstrate that the M2 antibody against the FLAG epitope reacted with only FLAG-ERalpha , cell lysates were prepared from HeLa cells transfected with either pJ3-FLAG-hERalpha or empty parent vector (pJ3Omega ) and subjected to Western blot analysis. The M2 antibody detected an appropriately sized band in HeLa cells transfected with pJ3-FLAG-hERalpha but not in mock-transfected cells (Fig. 4A). In a separate experiment, the hERalpha antibody, H222, was used to ensure that the protein encoded by the pJ3-FLAG-ERalpha expression vector was immunoreactive with ERalpha antibodies. As expected, Western blot analysis demonstrated that the FLAG-ERalpha migrated with a slightly lower mobility than wild type ERalpha (Fig. 4B).


View larger version (25K):
[in this window]
[in a new window]
  		Fig. 4.   Comparison of wild type and FLAG-tagged ERalpha . A, Western blot analysis of extracts prepared from cells transfected with pJ3-FLAG-ERalpha or pJ3Omega (mock). Blot was probed with anti-FLAG (M2) antibody. B, Western blot of wild type and FLAG-ERalpha expressed in HeLa cells. Blot was probed with anti-hERalpha (H222) antibody. C, dose-response curves for wild type (wt; black-square) and FLAG-tagged (open circle ) ERalpha in HeLa cells. Cells were transfected with increasing amounts of expression vectors for wild type or FLAG-tagged ERalpha , along with ERE-E1b-Luc and CMVbeta gal, and subsequently treated with 1 nM E2. Data are standardized to the activity of cell lysates prepared from cells transfected with 250 ng of wild type ERalpha , and represent the mean ± S.E. of three independent experiments. D, HeLa cells were transfected with 250 ng of the expression vector for each of the indicated receptor forms along with ERE-E1b-Luc and CMVbeta gal. Cells were treated with ethanol (Veh), 1 nM E2, or 10 µM SKF. Results are standardized to E2 values and represent the average ± S.E. of three independent experiments.

The transcriptional activity of FLAG-ERalpha was compared with wild type ERalpha in transient transfection experiments to ensure that the fusion of the FLAG epitope to the amino terminus of ERalpha did not adversely affect the relative ability of the chimeric receptor to activate expression of a synthetic target gene. HeLa cells were transfected with the ERE-E1b-Luc reporter gene, as well as an expression vector for beta -galactosidase (pCMVbeta ), and increasing amounts (0-1000 ng) of expression vectors for wild type or FLAG-tagged ERalpha . In cells treated with 1 nM E2 both receptors exhibited comparable transcriptional activities in the linear portion of the dose-response curve (Fig. 4C). Only when very high levels (>= 500 ng) of the expression vectors were introduced into cells was a modest reduction in activity observed for FLAG-ERalpha relative to wild type ERalpha . Equivalent amounts of vectors for wild type and epitope-tagged ERalpha were then transfected into HeLa cells, and the ability of each receptor to activate transcription following SKF treatment was determined. Both receptors were activated to an equivalent extent by SKF-82958 (Fig. 4D). Taken together these data indicate that the transcriptional activity of FLAG-ERalpha stimulated by either the natural ligand (E2) or the weakly estrogenic SKF-82958 is comparable with untagged ERalpha , and FLAG-ERalpha was used therefore for analysis in subsequent phosphorylation studies.

SKF-82958 Induces Phosphorylation of FLAG-ERalpha -- To determine whether activation of ERalpha -dependent gene expression by SKF-82958 is accompanied by alterations in the biochemical properties of the receptor, FLAG-ERalpha was expressed in HeLa cells using the adenovirus transfection method. Cells were subsequently radiolabeled with [32P]orthophosphate and treated with vehicle, 1 nM E2, or 25 µM SKF-82958 for 90 min. FLAG-ERalpha was immunopurified with the H222 anti-ERalpha antibody, resolved by 7.5% SDS-PAGE, and electrotransferred to nitrocellulose. The resulting blot was subjected to autoradiography to visualize the relative amount of phosphate incorporated into receptor and was subsequently subjected to Western blot analysis with an anti-FLAG antibody (M2) to quantitate relative receptor expression levels. A representative blot indicates that SKF-82958 significantly increased the overall phosphorylation level of ERalpha relative to 32P incorporation observed in cells treated with vehicle alone (Fig. 5A). As expected, the phosphorylation level of FLAG-ERalpha isolated from cells treated with E2 was also significantly increased in comparison to basal levels. When protein levels were taken into account, the data averaged from four experiments indicate that E2 increased ER phosphorylation by 1.7 ± 0.4-fold, whereas SKF treatment increased ER phosphorylation by 2.2 ± 0.4-fold (Fig. 5B).


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 5.   SKF-82958 induces ERalpha phosphorylation. A, HeLa cells transfected with expression vector for FLAG-ERalpha (lanes 1-3) or empty vector (pJ3Omega ; lane 4) were radiolabeled with [32P]orthophosphate and treated with ethanol (Veh), 1 nM E2, or 25 µM SKF. Receptors were immunoprecipitated with H222 antibody, resolved by SDS-PAGE, transferred to nitrocellulose, and exposed for autoradiography (top) and subsequently subjected to Western blot analysis with an anti-FLAG (M2) antibody (Ab) (bottom). B, values represent the average ± S.E. of relative ERalpha phosphorylation determined in four independent experiments.

To determine whether any of the known ER serine phosphorylation sites are critical for activation of the receptor by the SKF signal transduction pathway(s), the ability of this putative ligand to stimulate the activity of ER phosphorylation site mutants was assessed (39, 66, 67). Although SKF-82958 was able to stimulate the transcriptional activity of each amino-terminal phosphorylation mutant, activation of S118A (2.7 ± 0.3-fold) and S104A/S106A/S118A ERalpha (2.5 ± 0.5-fold) mutants was decreased relative to the ability of this compound to activate either wild type (4.5 ± 0.3-fold) or the S167A (4.7 ± 0.2-fold) mutant. These data are consistent with the effects of these mutations on E2-dependent activity (see Refs. 39 and 66 and our data) and suggest that serines 118 and possibly 104/106 may contribute to, but are not required for, activation of ERalpha in response to SKF-82958 treatment.

Functional Domains of ERalpha Required for SKF-82958 Activation-- To test more generally the regions of ER required for SKF activation, the ability of this compound to stimulate the transcriptional activity of a series of ER mutants (Fig. 6A) was tested. Mutation of the AF-2 domain (D538A/E542A/D545A) in the ERalpha -3× mutant reduced the ability of E2 and SKF to stimulate ER activity by ~64 and ~78%, respectively, suggesting that the carboxyl-terminal AF-2 domain contributes to both mechanisms of activation (Fig. 6B). An ER mutant lacking the ligand binding and F domains (N282G) was not activated by SKF-82958 or E2 treatment, and this is in agreement with previous studies in SK-N-SH neuroblastoma cells in which the carboxyl terminus of ERalpha was required for SKF-82958 activation of target gene expression (37). Deletion of the amino-terminal AF-1 domain reduced E2-dependent transcriptional activity by ~62% and SKF-dependent gene expression by ~70% in the ERalpha -179C mutant in comparison to wild type receptor, whereas deletion of the A/B domain in conjunction with the 3× mutation yielded an ER mutant (ERalpha -179C-3×) unable to activate gene expression in comparison to the empty parent vector. Taken together these data suggest that the amino- and carboxyl-terminal domains of ERalpha both contribute to receptor activity stimulated by SKF-82958.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 6.   The AF1 and AF2 domains of ERalpha are required for optimal activation of transcription by SKF-82958. A, schematic of ER mutants used in experiments shown in B. The location of the D538A/E542A/D545A amino acid mutations are indicated by . B, HeLa cells were transfected with pRST7 (empty plasmid) or pRST7 expression vectors for wild type ERalpha (wt), ERalpha -3× (3×), ERalpha -N282G (N282G), ERalpha -179C (179C), or ERalpha -179C-3× (179C-3×) along with ERE-E1b-Luc and pCMVbeta . Data are presented as the average ± S.E. of three experiments. Cells were treated with ethanol (Veh), 1 nM E2, or 10 µM SKF. The activity of wild type ERalpha in the presence of 1 nM E2 was defined as 100.

SKF-82958 Activates Gene Expression from a TPA-response Element-containing Promoter-- A growing body of evidence indicates that most receptors, whether membrane or nuclear, activate and/or interact with numerous signaling pathways. The dual actions of SKF-82958 in activating dopamine D1 receptors and ERalpha provided an opportunity to explore the impact of multiple signaling mechanisms induced by a multifunctional activator on nuclear receptor-induced transcription. Although SKF-82958 did not appear to appreciably increase cAMP levels in HeLa cells, activation of dopamine D1 receptors has also been shown to stimulate the activity of protein kinase C (68, 69). We therefore examined whether SKF treatment of cells could stimulate the activity of a sequence-specific transcription factor, AP-1, which is a downstream target of the protein kinase C pathway (70). AP-1 is composed of either homo- or heterodimers within the Jun family (c-Jun, JunB, and JunD) or between members of the Jun and Fos (c-Fos, FosB, Fra1, and Fra2) families (71). HeLa cells were transfected with a coll73-CAT reporter, which contains a TRE to which the AP-1 proteins c-Jun and c-Fos bind, or coll60-CAT reporter plasmid lacking the TRE (Fig. 7A) and treated with ethanol (vehicle), 1 nM E2, 100 nM TPA, 10 µM SKF-82958, or 100 nM 4-hydroxytamoxifen. TPA strongly induced TRE-dependent gene expression from coll73-CAT, whereas neither E2 nor 4-hydroxytamoxifen resulted in transcriptional activation (Fig. 7B). In contrast, treatment with SKF-82958 resulted in weaker, but significant (p < 0.05), stimulation of TRE-dependent transcriptional activity. None of the treatments increased transcription from a reporter gene (coll60-CAT) lacking the TRE enhancer.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 7.   SKF-82958 modestly activates TRE-dependent gene expression. A, schematic representation of the coll73-CAT and coll60-CAT reporter genes used in these experiments. B, HeLa cells were plated at a low density (2 × 105 cells/well), switched to media containing 0.5% sFBS, and transfected with coll73-CAT or coll60-CAT reporter plasmid. Cells were treated with ethanol (vehicle), 1 nM E2, 100 nM TPA, 10 µM SKF, or 100 nM 4-hydroxytamoxifen (4HT). Values represent mean ± S.E. for n = 4-5 experiments and are expressed as fold induction relative to vehicle-treated cells transfected with coll73-CAT.

Enhanced SKF-82958 Stimulation of ERalpha -dependent Gene Transcription by an Upstream TRE-- Because SKF weakly stimulated TRE-dependent gene expression and the ERE-E1b-CAT reporter gene contains a putative TRE site in the vector backbone ~255 bp upstream of the ERE, we examined the contribution of TRE binding factors to SKF induction of ERalpha -dependent gene expression. Thus, SKF-82958 or E2-induced CAT expression were compared in the intact ERE-E1b-CAT reporter versus constructs in which the putative TRE site was eliminated by deletion (Delta Nde-Eco) or point (mTRE) mutagenesis (Fig. 8A). The latter point mutant was examined to rule out the possibility that the deletion mutant introduced structural perturbations or removed other cryptic DNA sequences from the reporter that might alter transcriptional responses. As shown in Fig. 8B, significant CAT expression was induced by treatment with E2 or SKF-82958 from either the intact or mutant forms of the ERE-E1b-CAT reporter gene. Moreover, the fold induction by E2 was similar for the three reporter genes, whereas SKF-82958 induction of CAT gene expression was diminished by ~23 and ~28%, when the TRE was deleted or mutated, respectively. The similarity in SKF-82958 effect on gene expression between the reporters generated by deletion versus site-directed mutagenesis is consistent with the interpretation that it is the upstream TRE element, rather than some other element or structural alteration, that contributes to the magnitude of SKF-82958-induced ERalpha transactivation under these conditions. Moreover, in experiments in which a ClaI to BglI linear fragment of the ERE-E1b-Luc plasmid encompassing just the ERE, E1b, and luciferase sequences was transfected into HeLa cells with an ERalpha expression plasmid, SKF stimulation of ERalpha activity relative to E2 was 50% the level seen for unaltered (circular) target gene (data not shown). Taken together, these results support the hypothesis that TRE elements in reporter plasmids may enhance, but are not required for, induction of ERalpha -dependent gene transcription by multifunctional ligands such as SKF-82958.


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 8.   An upstream TRE enhances SKF-82958 activation of ERalpha -dependent gene expression. A, schematic representation of reporter genes used in these experiments. HeLa cells were transfected with expression vectors for wild type ER (pSVMT-wtER) (B) or ERalpha -179C (pRST7-hERalpha -179C) (C) along with ERE-E1b-CAT reporter genes encoding a putative AP-1-responsive element (TRE-ERE) or lacking this site through deletion (Delta Nde-Eco-ERE) or mutation (mTRE-ERE). Cells were treated with the ethanol (Veh), 1 nM E2, or 10 µM SKF. Bars represent mean ± S.E. for n = 4-6 independent experiments, and values are expressed relative to the CAT activity induced by E2 treatment from the intact TRE-ERE-E1b-CAT reporter in each experiment.

Because TRE-dependent activity significantly enhanced SKF activation of ERalpha -dependent gene expression, and because c-Jun has been shown to bind to the amino terminus of ERalpha (57), we wanted to ensure that the ligand binding domain and AF-2 could support SKF activation of gene expression in the absence of AF-1. We therefore examined the ability of ERalpha -179C to be activated by SKF-82958 in the absence of the upstream TRE. As shown in Fig. 8C, loss of the TRE site of the reporter and the AF-1 domain of the receptor significantly compromises the ability of SKF-82959 to activate ERalpha -dependent gene expression, consistent with the interpretation that both the AF-1 and TRE contribute to SKF-induced transcriptional activity. Taken together, these data suggest that SKF-82958 on its own is a weak ERalpha agonist and that the robust activation seen with full-length receptor is a result of the synergistic activation of ERalpha and cellular factors, such as c-Jun or c-Fos, that can bind to the TRE (60).

Effect of AP-1 Overexpression on ERalpha Transactivation by SKF-82958-- The above observations suggest that transcription factors able to interact with the TRE-binding site can contribute to ERalpha -mediated gene expression stimulated by SKF-82958. Protein-protein interactions have been reported between the AP-1 protein c-Jun and ER, but not between c-Fos and ER, and occur principally through the amino-terminal AF-1 domain of the ER protein (57). To investigate further the ability of SKF to activate synergistically ER/AP-1-dependent transcription, we tested the hypothesis that increased Jun/Fos expression would enhance SKF-82958 activation of ERalpha -dependent transcription. HeLa cells were cotransfected with expression plasmids for c-Jun, c-Fos, or equivalent levels of c-Jun + c-Fos (12.5-100 ng/well), with total DNA/well maintained constant by altering the levels of cotransfected empty plasmid. Jun overexpression resulted in strong and significant increases in basal, E2, and SKF-82958-induced transcription from ERE-E1b-CAT but not from reporter genes lacking the TRE (Delta Nde-Eco), suggesting that c-Jun-activated transcription was primarily dependent on the TRE of the intact reporter and not through binding to ERalpha (Fig. 9A). Fos overexpression resulted in only very modest increases in the effects of E2 and SKF-82958, with no significant effect on basal activity (Fig. 9B). The result from the combination of c-Jun with c-Fos was similar to that of c-Jun alone (Fig. 9C). In all experiments performed with the ERE-E1b-CAT(Delta Nde-Eco) reporter construct lacking the TRE, no significant increases in transcriptional activation were induced by AP-1 overexpression (Fig. 9, A-C), suggesting that the TRE-binding site was required for strong AP-1 effects.


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 9.   Overexpression of c-Jun enhances ER activity stimulated by E2 or SKF-82958. HeLa cells were cotransfected with increasing concentrations of expression plasmid for c-Jun (A), c-Fos (B), or equivalent amounts of c-Jun and c-Fos (C) along with pSVMT-wtER and ERE-E1b-CAT reporter genes with (TRE-ERE) or without (Delta Nde-Eco-ERE) a TRE. Total DNA levels were normalized in each group by cotransfecting appropriate levels of the empty plasmid pRSV-Not. Transfections were done 6 h prior to addition of the indicated agonists, with harvest following 18 h thereafter. Cells were treated with ethanol (vehicle), 1 nM E2, or 10 µM SKF. Bars represent mean ± S.E. for n = 3 independent experiments, and values are expressed relative to the CAT activity (100) induced by E2 treatment from ERE-E1b-CAT in each experiment. Analysis of variance indicated that (a) c-Jun overexpression, both in the presence and absence of cotransfected c-Fos, significantly elevated basal (p < 0.001), and E2- (p < 0.01) and SKF-induced (p < 0.001) transcriptional activation from ERE-E1b-CAT, but not from the TRE deletion mutant; (b) c-Fos overexpression resulted in modestly significant (p < 0.05) increases in E2- and SKF-induced transcriptional activity from the intact reporter.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The relatively high concentration of SKF-82958 required to achieve ERalpha transcriptional activity in comparison to dopamine D1 receptor activation suggested that this compound was an ERalpha agonist, and our relative binding affinity analyses demonstrated that SKF competed with E2 for binding to either ERalpha or ERbeta . However, the results obtained in this study demonstrate that SKF-82958 stimulates the transcriptional activity of ERalpha , but not ERbeta , and therefore SKF-82958 is an ERalpha -selective agonist. Intriguingly, our studies also demonstrated that SKF stimulates the transcriptional activity of AP-1 and provides evidence that in the appropriate promoter context activation of target gene expression by SKF is the combinatorial result of AP-1 and ERalpha activation. Understanding the role of AP-1 in SKF-dependent ERalpha transactivation is particularly important given the ability of SKF to activate both transcription factors. In so doing, the results of these studies provide an example of how other transcription factors can seemingly enhance the potency of weak ER ligands.

Although SKF-82958 is a full agonist of dopamine D1 receptors, it failed to stimulate increases in intracellular cAMP, nor was it able to stimulate CRE-dependent gene expression in our HeLa cells. We had previously shown that dopamine treatment of HeLa cells increased cAMP levels in a dose-dependent manner in vitro (30), and the inability of SKF to do so here was unexpected. Although SKF induction of cAMP in SK-N-SH cells had not been characterized, the protein kinase A inhibitor, H89, partially blocked ERalpha transactivation by SKF-82958 (37), suggesting that a cAMP signaling transduction pathway was playing a role in these cells. Similarly, H89 reduced SKF induction of ER transcription activity in MCF-7 cells (27). These reports are consistent with the ability of SKF to stimulate adenylate cyclase and cAMP production via the dopamine D1 receptor (46, 47), and it is possible that in these cell models ERalpha transactivation by SKF is at least partially cAMP/protein kinase A-dependent and/or that H89 is inhibiting the activity of other signaling pathways able to cross-talk with ERalpha or AP-1. Indeed, whereas H89 effectively inhibits protein kinase A, it also blocks the activity of other kinases including protein kinase B (Akt) and mitogen-and stress-activated protein kinase-1 (72).

The inability of SKF to stimulate ERbeta transcriptional activity is unlikely to be due to the minor differences in the relative binding affinities of this compound for ERalpha and ERbeta . A large number of naturally occurring substances, as well as pharmacological and environmental agents, bind to ERs (16, 17). The crystal structures of receptors complexed with E2, diethylstilbestrol, raloxifene, or 4-hydroxytamoxifen and molecular modeling studies suggest that binding of a phenolic group to the A-ring binding pocket of the ligand binding domains of the receptors is a common feature (14, 73-75). Whereas SKF-82958 does not possess a simple phenolic ring characteristic of many ER ligands (Fig. 1A), it does have a hydroxyphenolic ring with a large, bulky chlorine substituent. Based on the ability of C (2) substituted derivatives of E2 and estrone (2-hydroxyestradiol and 2-hydroxyestrone, respectively) to have severely reduced relative binding affinities for ERs (16, 17) and the chlorine atom on SKF-82958, it was unexpected that SKF would inhibit E2 occupancy of the ligand binding pocket. This result is perhaps even more surprising in view of the inability of dopamine to bind to ERalpha or ERbeta , because dopamine also possesses a hydroxyphenol ring. However, it is possible that the remainder of the dopamine molecule is of insufficient size to interact with other regions of the ligand binding pocket required for high affinity binding. It will be interesting to determine whether chemical derivatives of SKF-82958 can be generated with increased receptor affinity.

There is significant interest in identifying ER subtype-selective agonists and antagonists, and several investigators have made progress in identifying and characterizing such compounds. These include a cis-diethyl-substituted tetrahydrochrysene that has a 4-fold preferential binding affinity for ERbeta and is an ERalpha agonist and complete ERbeta antagonist (76), and a methoxychlor metabolite that inhibits estrogen-induced ERbeta activity, yet stimulates the transcriptional activity of ERalpha (77). Potency-selective agonists have also been identified such as pyrazole, which has a 120-fold greater potency for stimulating ERalpha activity in comparison to ERbeta (76), and A-ring reduced metabolites of the 19-nor synthetic progestins, norethisterone and Gestodene, which have at least a 100-fold greater potency for ERalpha in comparison to ERbeta transcriptional activity (78). In addition to these compounds, differences in the ability of steroidal derivatives and non-steroidal phytoestrogens to bind to ERalpha and ERbeta have also been reported (16, 17). Moreover, the differences in the relative agonist and antagonistic activity of several of these novel compounds have been found to correlate with changes in the conformation of the receptors and their ability to bind to SRC family coactivators (79). For instance, the ERalpha agonist propylpyrazole triol induces an agonistic conformational change in ERalpha and promotes interaction of this receptor with SRC-1, GRIP1, and ACTR but does not promote interaction of ERbeta with these coactivators. We have demonstrated that SRC family coactivators as well as the general coactivator CBP can enhance SKF-induced ERalpha transactivation, and this is consistent with SKF inducing a conformational change able to promote ERalpha -coactivator interactions.

By having established that SKF-82958 is an ERalpha -selective agonist, we examined the mechanism(s) by which it stimulated ERalpha -dependent gene expression. Deletion of the amino-terminal A/B domain of ERalpha indicates that the AF-1 domain is not required for SKF-82958 activation of ERalpha -dependent gene expression nor is a fully functional AF-2 as demonstrated by data from the ERalpha -3× mutant. However, both these mutations reduce the relative ability of ERalpha to activate gene expression, and the AF-1 and AF-2 regions are therefore required to yield a full response to SKF stimulation as has been shown in other contexts for E2 and SKF (20, 37). Deletion of the entire ligand binding domain confirms that SKF-induced ERalpha transcriptional activity involves the carboxyl terminus of the receptor. As noted above, mutations of the core domain of AF2 reduced, but did not block, the ability of SKF-mediated signaling pathways to activate gene expression, except when combined with deletions of the A/B domain of the receptor. This supports the supposition that SKF activation of ERalpha transcriptional activity requires the cooperative effects of both the amino- and carboxyl-terminal domains. The inability of SKF to stimulate ERbeta transcriptional activity is interesting in view of the contributions of the AF-1 domain of the ERalpha to this response and differences in the structure and relative transcriptional activity of the AF-1 domains of the two ER subtypes (11-13). It should also be noted that the lack of ERbeta transactivation by SKF is not due to an inability of ERbeta to interact functionally with AP-1, as we have observed this mechanism in the context of cAMP signaling pathways.2

Stimulation of ERalpha transcriptional activity by SKF is accompanied by increases in the levels of receptor phosphorylation that are similar to those induced in parallel experiments by E2. However, the enzyme(s) responsible for this post-translational modification and the residue(s) within ERalpha that are phosphorylated following SKF treatment remain undefined. The similarity of SKF- and E2-induced phosphorylation of ERalpha does not correlate with the relative ability of these two compounds to activate the transcriptional activity of this receptor, and this suggests that SKF-induced phosphorylation of ERalpha may not be important for this process. Although E2 and growth factor signaling pathways able to stimulate ERalpha activity induce receptor phosphorylation (4, 21), so do the ERalpha antagonists, ICI 164,384 and 4-hydroxytamoxifen (39, 66). Taken together, these data suggest that the role of receptor phosphorylation in ligand-induced ERalpha function may be quite complex and possibly ligand-specific. Alternatively, it is possible that signal transduction pathways initiated by SKF-82958 (see below) could affect receptor-dependent gene expression by phosphorylating coactivators and altering their intrinsic transcriptional activity. For instance, 8-Br-cAMP treatment of COS-1 cells phosphorylates SRC-1 and stimulates its intrinsic transcriptional activity (42). Similarly, growth factor signaling pathways increase the transcriptional activity of the GRIP1 and AIB1 coactivators (80, 81) and cAMP and MAPK signaling pathways increase CBP activity (82, 83). Thus, SKF-induced, ERalpha -dependent gene expression may also be influenced by SKF-induced alterations in coactivator function.

The ability of SKF to stimulate AP-1 activity contributes to the ability of this compound to stimulate ERalpha -dependent gene expression on the ERE-E1b-CAT reporter gene. Activation of AP-1, however, is insufficient to stimulate CAT activity from this reporter in cells lacking ERalpha (see Fig. 6B). Several lines of evidence indicate that the TRE site contributes to the magnitude of target gene expression by ERalpha and SKF-82958. First, this synthetic dopamine receptor agonist did activate transcription from a TRE-dependent reporter in the absence of cotransfected ER. Moreover, eliminating a functional AP-1 element ~255 bp upstream from the ERE-E1b-CAT reporter sequence, either by deletion or site-directed mutagenesis, significantly reduced the ability of SKF to stimulate ER transactivation. Interactions between ERalpha and c-Jun are mediated via the amino terminus of ERalpha (57), and eliminating both the upstream AP-1-binding site from ERE-E1b-CAT and the AF-1 domain of ERalpha severely compromised the ability of SKF to activate ERalpha -dependent gene expression, suggesting that the A/B domain contributes to this activity through its ability to interact with AP-1 and/or accessory transcription factors that link AP-1 and ERalpha function.

Although steroid receptors can activate the transcription of target genes containing only their response elements and minimal promoters such as TATA boxes, natural target gene promoters are significantly more complex and contain binding sites for many different transcription factors. Regulation of target gene expression is therefore a result of the coordinate regulation of the activity of all transcription factors that can bind to a target promoter, and for this reason, it is important to examine the interaction between AP-1 and ERalpha . The mechanisms by which SKF enhanced activation of the TRE (coll73-CAT) reporter gene are not defined but could be mediated by increased expression of AP-1 transcription factors and/or their activation by signal transduction pathway-induced post-translational modifications (e.g. phosphorylation (71, 84)). However, we demonstrated that the magnitude of SKF-dependent ERalpha transactivation paralleled the relative levels of c-Jun expression (i.e. enhanced when c-Jun was overexpressed) confirming that SKF effects dependent on the TRE site are mediated by AP-1. There seems to be a preferential role for c-Jun in this system, because its overexpression resulted in a substantial enhancement of overall transcriptional activity, whereas c-Fos overexpression only modestly enhanced ERalpha -dependent transactivation. Alternatively, it is possible that other Fos family members may better stimulate ERalpha activity, analogous to the situation where the ability of E2 to stimulate or repress AP-1 activity appears to correlate with the relative expression of the Fos family member Fra-1 (85).

These effects of either c-Jun or c-Fos were greatly diminished on ERE-E1b-CAT reporters lacking the upstream TRE site. This is important because it suggests that AP-1 interaction with ERalpha in the absence of TRE DNA-binding site makes very modest contributions to ERalpha -dependent gene expression. These relationships were particularly well demonstrated when SKF-dependent ERalpha transactivation of the ERE-E1b-CAT TRE site mutants was compared in the presence of wild type ER versus the ER mutant lacking the AF-1 domain (Fig. 8). Under these conditions, which limit the contribution of AP-1 both through its DNA-binding site and through protein-protein interactions with ERalpha , E2-, and SKF-82958-induced ERalpha transactivation were substantially diminished. Collectively, these observations are consistent with the hypothesis that AP-1 enhances SKF-dependent ER transactivation both by AP-1/TRE interaction and by protein/protein interaction between the ER and AP-1 proteins. Whether this latter interaction is direct or is indirectly mediated through other proteins such as coactivators is presently unknown.

The interactions between ERs and AP-1 are complex, and using reporters containing only AP-1-binding sites, other investigators have demonstrated two pathways for ER activation of AP-1-dependent gene expression (reviewed in Ref. 3). There appears to be an activation function-dependent pathway that estrogen- or anti-estrogen-liganded ERalpha utilizes, whereas ERbeta stimulates AP-1 activity in an activation function-independent manner (57, 86). The results of our study suggest that AP-1 can stimulate the activity of ERalpha activated by a weak agonist such as SKF-82958 or as expected with the full agonist, E2 (57), indicating that these two classes of transcription factors have the ability to regulate each other's transcriptional activity. This also suggests that the ability of any given ER ligand to activate receptor-dependent gene expression may vary depending on the presence of DNA-binding sites for other transcription factors that can functionally interact with the ER and/or that the ligand may regulate. Because ERs have been reported to interact functionally with AP-1 (discussed above), as well as Sp1, NF-Y, and USF (87, 88), many possible regulatory combinations would seem to be possible, leading to complex regulation of ER-dependent gene expression. Taken together, these results suggest that the ability of pharmacological and environmental compounds to exert estrogen-like effects may need to take into account the activities from other transcription factors able to interact functionally with ERalpha .

    ACKNOWLEDGEMENTS

Gifts of H222 antibody were received from Geoffrey Greene and Abbott Laboratories. The plasmids provided by Drs. Benita Katzenellenbogen, Peter Kushner, Donald McDonnell, Malcolm Parker, JoAnne Richards, Robert Tjian, and Inder Verma are gratefully acknowledged as is the technical assistance of Yayun Zhang and Vinh Lam.

    FOOTNOTES

* This work was supported in part by National Institutes of Health Grant DK53002 (to C. L. S.), Department of Defense Grant DAMD17-98-1-8282, and an institutional grant from the American Cancer Society.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported by Fellowship DAMD17-00-1-0136 from the Department of Defense.

|| To whom correspondence should be addressed: Dept. of Molecular and Cellular Biology, One Baylor Plaza, Houston, TX 77030. Tel.: 713-798-6235; Fax: 713-790-1275; E-mail: carolyns@bcm.tmc.edu.

Published, JBC Papers in Press, November 7, 2001, DOI 10.1074/jbc.M109320200

2 K. M. Coleman and C. L. Smith, unpublished data.

    ABBREVIATIONS

The abbreviations used are: ERalpha , estrogen receptor-alpha ; ER, estrogen receptor; AF, activation function; CAT, chloramphenicol acetyltransferase; E2, 17beta -estradiol; ERE, estrogen-response element; IBMX, 3-isobutyl-1-methylxanthine; MAPK, mitogen-activated protein kinase; PR, progesterone receptor; SKF, SKF-82958; SRC, steroid receptor coactivator; TRE, TPA-responsive element; TPA, tetradecanoylphorbol-13-acetate; CRE, cAMP-response element; DMEM, Dulbecco's modified Eagle's medium; sFBS, charcoal-stripped fetal bovine serum; 8-Br-cAMP, 8-bromo-cyclic AMP; CBP, CREB-binding protein.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Green, S., Walter, P., Kumar, V., Krust, A., Bornert, J. M., Argos, P., and Chambon, P. (1986) Nature 320, 134-139
2. Kuiper, G. G., Enmark, E., Pelto-Huikko, M., Nilsson, S., and Gustafsson, J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 5925-5930
3. Kushner, P. J., Agard, D. A., Greene, G. L., Scanlan, T. S., Shiau, A. K., Uht, R. M., and Webb, P. (2000) J. Steroid Biochem. Mol. Biol. 74, 311-317
4. Weigel, N. L. (1996) Biochem. J. 319, 657-667
5. Tsai, M.-J., and O'Malley, B. W. (1994) Annu. Rev. Biochem. 63, 451-486
6. Paige, L. A., Christensen, D. J., Gron, H., Norris, J. D., Gottlin, E. B., Padilla, K. M., Chang, C.-Y., Ballas, L. M., Hamilton, P. T., McDonnell, D. P., and Fowlkes, D. M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3999-4004
7. Pike, A. C., Brzozowski, A. M., Hubbard, R. E., Bonn, T., Thorsell, A. G., Engstrom, O., Ljunggren, J., Gustafsson, J.-A., and Carlquist, M. (1999) EMBO J. 18, 4608-4618
8. Tremblay, A., and Giguère, V. (2001) J. Steroid Biochem. Mol. Biol. 77, 19-27
9. Cowley, S. M., Hoare, S., Mosselman, S., and Parker, M. G. (1997) J. Biol. Chem. 272, 19858-19862
10. Pace, P., Taylor, J., Suntharalingam, S., Coombes, R. C., and Ali, S. (1997) J. Biol. Chem. 272, 25832-25838
11. Hall, J. M., and McDonnell, D. P. (1999) Endocrinology 140, 5566-5578
12. Delaunay, F., Pettersson, K., Tujague, M., and Gustafsson, J.-Å. (2000) Mol. Pharmacol. 58, 584-590
13. Cowley, S. M., and Parker, M. G. (1999) J. Steroid Biochem. Mol. Biol. 69, 165-175
14. Shiau, A. K., Barstad, D., Loria, P. M., Cheng, L., Kushner, P. J., Agard, D. A., and Greene, G. L. (1998) Cell 95, 927-937
15. McKenna, N. J., Lanz, R. B., and O'Malley, B. W. (1999) Endocr. Rev. 20, 321-344
16. Kuiper, G. G., Carlsson, B., Grandien, K., Enmark, E., Haggblad, J., Nilsson, S., and Gustafsson, J. (1997) Endocrinology 138, 863-870
17. Kuiper, G. G. J. M., Lemmen, J. G., Carlsson, B., Corton, J. C., Safe, S. H., van der Saag, P. T., van der Burg, B., and Gustafsson, J.-Å. (1998) Endocrinology 139, 4252-4263
18. Tora, L., White, J. H., Brou, C., Tasset, D. M., Webster, N. J. G., Scheer, E., and Chambon, P. (1989) Cell 59, 477-487
19. Lees, J. A., Fawell, S. E., and Parker, M. G. (1989) J. Steroid Biochem. 34, 33-39
20. Tzukerman, M. T., Esty, A., Santiso-Mere, D., Danielian, P., Parker, M. G., Stein, R. B., Pike, J. W., and McDonnell, D. P. (1994) Mol. Endocrinol. 8, 21-30
21. Weigel, N. L., and Zhang, Y. (1997) J. Mol. Med. 76, 469-479
22. Kato, S., Endoh, H., Masuhiro, Y., Kitamoto, T., Uchiyama, S., Sasaki, H., Masushige, S., Gotoh, Y., Nishida, E., Kawashima, H., Metzger, D., and Chambon, P. (1995) Science 270, 1491-1494
23. Bunone, G., Briand, P.-A., Miksicek, R. J., and Picard, D. (1996) EMBO J. 15, 2174-2183
24. Ignar-Trowbridge, D. M., Teng, C. T., Ross, K. A., Parker, M. G., Korach, K. S., and McLachlan, J. A. (1993) Mol. Endocrinol. 7, 992-998
25. Tremblay, G. B., Tremblay, A., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Labrie, F., and Giguere, V. (1997) Mol. Endocrinol. 11, 353-365
26. Tremblay, A., Tremblay, G. B., Labrie, F., and Giguère, V. (1999) Mol. Cell 3, 513-519
27. Riby, J. E., Chang, G. H. F., Firestone, G. L., and Bjeldanes, L. F. (2000) Biochem. Pharmacol. 60, 167-177
28. Patrone, C., Ma, Z. Q., Pollio, G., Agrati, P., Parker, M. G., and Maggi, A. (1996) Mol. Endocrinol. 10, 499-507
29. Pietras, R. J., Arboleda, J., Reese, D. M., Wongvipat, N., Pegram, M. D., Ramos, L., Gorman, C. M., Parker, M. G., Sliwkowski, M. X., and Slamon, D. J. (1995) Oncogene 10, 2435-2446
30. Smith, C. L., Conneely, O. M., and O'Malley, B. W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6120-6124
31. Power, R. F., Mani, S. K., Codina, J., Conneely, O. M., and O'Malley, B. W. (1991) Science 254, 1636-1639
32. Matkovits, T., and Christakos, S. (1995) Mol. Endocrinol. 9, 232-242
33. Apostolakis, E. M., Garai, J., Fox, C. F., Smith, C. L., Watson, S. J., Clark, J. H., and O'Malley, B. W. (1998) J. Neurosci. 16, 4823-4834
34. Mani, S. K., Allen, J. M., Clark, J. H., Blaustein, J. D., and O'Malley, B. W. (1994) Science 265, 1246-1249
35. Mani, S., Allen, J. M. C., Lydon, J. P., Mulac-Jericevic, B., Blaustein, J. D., DeMayo, F. J., Conneely, O. M., and O'Malley, B. W. (1996) Mol. Endocrinol. 10, 1728-1737
36. Missale, C., Nash, S. R., Robinson, S. W., Jaber, M., and Caron, M. G. (1998) Physiol. Rev. 78, 189-225
37. Gangolli, E. A., Conneely, O. M., and O'Malley, B. W. (1997) J. Steroid Biochem. Mol. Biol. 61, 1-9
38. Aronica, S. M., and Katzenellenbogen, B. S. (1993) Mol. Endocrinol. 7, 743-752
39. LeGoff, P., Montano, M. M., Schodin, D. J., and Katzenellenbogen, B. S. (1994) J. Biol. Chem. 269, 4458-4466
40. Denner, L. A., Weigel, N. L., Maxwell, B. L., Schrader, W. T., and O'Malley, B. W. (1990) Science 250, 1740-1743
41. Bai, W., Rowan, B. G., Allgood, V. E., O'Malley, B. W., and Weigel, N. L. (1997) J. Biol. Chem. 272, 10457-10463
42. Rowan, B. G., Garrison, N., Weigel, N. L., and O'Malley, B. W. (2000) Mol. Cell. Biol. 20, 8720-8730
43. Kuhar, M. J., Ritz, M. C., and Boja, J. W. (1991) Trends Neurosci. 14, 299-302
44. Katz, J. L., Kopajtic, T. A., Myers, K. A., Mitkus, R. J., and Chider, M. (1999) J. Pharmacol. Exp. Ther. 291, 265-279
45. Jenner, P. (1995) Neurology 45, S6-S12
46. O'Boyle, K. M., Gaitanopoulos, D. E., Brenner, M., and Waddington, J. L. (1989) Neuropharmacology 28, 401-405
47. Murray, A. M., and Waddington, J. L. (1989) Eur. J. Pharmacol. 160, 377-384
48. Enmark, E., Pelto-Huikko, M., Grandien, K., Lagercrantx, S., Lagercrantz, J., Fried, G., Nordenskjold, M., and Gustafsson, J.-A. (1997) J. Clin. Endocrinol. & Metab. 82, 4258-4265
49. White, R., Sjöberg, M., Kalkhoven, E., and Parker, M. G. (1997) EMBO J. 16, 1427-1435
50. Baichwal, V. R., Park, A., and Tjian, R. (1998) Nature 352, 165-168
51. Sassone-Corsi, P., Lamph, W. W., Kamps, M., and Verma, I. M. (1988) Cell 54, 553-560
52. Sun, P., Lou, L., and Maurer, R. A. (1996) J. Biol. Chem. 271, 3066-3073
53. Lonard, D. M., Nawaz, Z., Smith, C. L., and O'Malley, B. W. (2000) Mol. Cell 5, 939-948
54. Allgood, V. E., Oakley, R. H., and Cidlowski, J. A. (1993) J. Biol. Chem. 268, 20870-20876
55. Nawaz, Z., Lonard, D. M., Smith, C. L., Lev-Lehman, E., Tsai, S. Y., Tsai, M.-J., and O'Malley, B. W. (1999) Mol. Cell. Biol. 19, 1182-1189
56. Kurten, R. C., and Richards, J. S. (1989) Endocrinology 125, 1345-1357
57. Webb, P., Lopez, G. N., Uht, R. M., and Kushner, P. J. (1995) Mol. Endocrinol. 9, 443-456
58. Pham, T. A., Elliston, J. F., Nawaz, Z., McDonnell, D. P., Tsai, M.-J., and O'Malley, B. W. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3125-3129
59. Morgenstern, J. P., and Land, H. (1990) Nucleic Acids Res. 18, 1068
60. Angel, P., Imagawa, M., Chiu, R., Stein, B., Imbra, R. J., Rahmsdorf, H. J., Jonat, G., Herrlich, P., and Karin, M. (1987) Cell 49, 729-739
61. Allgood, V. E., Zhang, Y., O'Malley, B. W., and Weigel, N. L. (1997) Biochemistry 36, 224-232
62. Cristiano, R. J., Smith, L. C., and Woo, S. L. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2122-2126
63. Seed, B., and Sheen, J.-Y. (1988) Gene (Amst.) 67, 271-277
64. Bai, W., Tullos, S., and Weigel, N. L. (1994) Mol. Endocrinol. 8, 1465-1473
65. Jordan, V. C. (1984) Pharmacol. Rev. 36, 245-276
66. Ali, S., Metzger, D., Bornert, J. M., and Chambon, P. (1993) EMBO J. 12, 1153-1160
67. Arnold, S. F., Obourn, J. D., Jaffe, H., and Notides, A. C. (1994) Mol. Endocrinol. 8, 1208-1214
68. Gorelova, N. A., and Yang, C. R. (2000) J. Neurophysiol. 84, 75-87
69. Asghar, M., Hussain, T., and Lokhandwala, M. F. (2001) Eur. J. Pharmacol. 411, 61-66
70. Imagawa, M., Chiu, R., and Karin, M. (1987) Cell 51, 251-260
71. Karin, M., Liu, Z., and Zandi, E. (1997) Curr. Opin. Cell Biol. 9, 240-246
72. Davies, S. P., Reddy, H., Caivano, M., and Cohen, P. (2000) Biochem. J. 351, 95-105
73. Stauffer, S. R., Coletta, C. J., Tedesco, R., Nishiguchi, G., Carlson, K., Sun, J., Katzenellenbogen, B. S., and Katzenellenbogen, J. A. (2000) J. Med. Chem. 43, 4934-4947
74. Anstead, G. M., Carlson, K. E., and Katzenellenbogen, J. A. (1997) Steroids 62, 268-303
75. Brzozowski, A. M., Pike, A. C., Dauter, Z., Hubbard, R. E., Bonn, T., Engstrom, O., Ohman, L., Greene, G. L., Gustafsson, J.-Å., and Carlquist, M. (1997) Nature 389, 753-758
76. Sun, J., Meyers, M. J., Fink, B. E., Rajendran, R., Katzenellenbogen, J. A., and Katzenellenbogen, B. S. (1999) Endocrinology 140, 800-804
77. Gaido, K. W., Leonard, L. S., Maness, S. C., Hall, J. M., McDonnell, D. P., Saville, B., and Safe, S. (1999) Endocrinology 140, 5746-5753
78. Larrea, F., García-Becerra, R., Lemus, A. E., García, G. A., Pérez-Palacios, G., Jackson, K. J., Coleman, K. M., Dace, R., Smith, C. L., and Cooney, A. J. (2001) Endocrinology 142, 3791-3799
79. Kraichely, D. M., Sun, J., Katzenellenbogen, J. A., and Katzenellenbogen, B. S. (2000) Endocrinology 141, 3534-3545
80. Lopez, G. N., Turck, C. W., Schaufele, F., Stallcup, M. R., and Kushner, P. J. (2001) J. Biol. Chem. 276, 22177-22182
81. Font de Mora, J. F., and Brown, M. (2000) Mol. Cell. Biol. 20, 5041-5047
82. Ait-Si-Ali, S., Carlisi, D., Ramirez, S., Upegui-Gonzalez, L. C., Duquet, A., Robin, P., Rudkin, B., Harel-Bellan, A., and Trouche, D. (1999) Biochem. Biophys. Res. Commun. 262, 157-162
83. Chrivia, J. C., Kwok, R. P. S., Lamb, N., Hagiwara, M., Montminy, M. R., and Goodman, R. H. (1993) Nature 365, 855-859
84. Karin, M., and Hunter, T. (1995) Curr. Biol. 5, 747-757
85. Philips, A., Teyssier, C., Galtier, F., Rivier-Covas, C., Rey, J.-M., Rochefort, H., and Chalbos, D. (1998) Mol. Endocrinol. 12, 973-985
86. Webb, P., Nguyen, P., Valentine, C., Lopez, G. N., Kwok, G. R., McInerney, E., Katzenellenbogen, B. S., Enmark, E., Gustafsson, J.-Å., Nilsson, S., and Kushner, P. J. (1999) Mol. Endocrinol. 13, 1672-1685
87. Wang, W., Dong, L., Saville, B., and Safe, S. (1999) Mol. Endocrinol. 13, 1373-1387
88. Xing, W., and Archer, T. K. (1998) Mol. Endocrinol. 12, 1310-1321

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J Mol EndocrinolHome page
S. Safe and K. Kim
Non-classical genomic estrogen receptor (ER)/specificity protein and ER/activating protein-1 signaling pathways
J. Mol. Endocrinol., November 1, 2008; 41(5): 263 - 275.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
T. J. Peterson, S. Karmakar, M. C. Pace, T. Gao, and C. L. Smith
The Silencing Mediator of Retinoic Acid and Thyroid Hormone Receptor (SMRT) Corepressor Is Required for Full Estrogen Receptor {alpha} Transcriptional Activity
Mol. Cell. Biol., September 1, 2007; 27(17): 5933 - 5948.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
B. M. Jaber, T. Gao, L. Huang, S. Karmakar, and C. L. Smith
The Pure Estrogen Receptor Antagonist ICI 182,780 Promotes a Novel Interaction of Estrogen Receptor-{alpha} with the 3',5'-Cyclic Adenosine Monophosphate Response Element-Binding Protein-Binding Protein/p300 Coactivators
Mol. Endocrinol., November 1, 2006; 20(11): 2695 - 2710.
[Abstract] [Full Text] [PDF]

Home page
 J PsychopharmacolHome page
Y. Makihara, H. Yamamoto, M. Inoue, K. Tomiyama, N. Koshikawa, and J. L. Waddington
Topographical effects of D1-like dopamine receptor agonists on orofacial movements in mice and their differential regulation via oppositional versus synergistic D1-like: D2-like interactions: cautionary observations on SK&F 82958 as an anomalous agent
J Psychopharmacol, December 1, 2004; 18(4): 484 - 495.
[Abstract] [PDF]

Home page
 J. Biol. Chem.Home page
T. L. McCarthy, W.-Z. Chang, Y. Liu, and M. Centrella
Runx2 Integrates Estrogen Activity in Osteoblasts
J. Biol. Chem., October 31, 2003; 278(44): 43121 - 43129.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
M. Dutertre and C. L. Smith
Ligand-Independent Interactions of p160/Steroid Receptor Coactivators and CREB-Binding Protein (CBP) with Estrogen Receptor-{alpha}: Regulation by Phosphorylation Sites in the A/B Region Depends on Other Receptor Domains
Mol. Endocrinol., July 1, 2003; 17(7): 1296 - 1314.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. M. Coleman, M. Dutertre, A. El-Gharbawy, B. G. Rowan, N. L. Weigel, and C. L. Smith
Mechanistic Differences in the Activation of Estrogen Receptor-alpha (ERalpha )- and ERbeta -dependent Gene Expression by cAMP Signaling Pathway(s)
J. Biol. Chem., April 4, 2003; 278(15): 12834 - 12845.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/3/1669    most recent
M109320200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Walters, M. R.
Right arrow Articles by Smith, C. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Walters, M. R.
Right arrow Articles by Smith, C. L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement