HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 3, 1762-1769, January 18, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/3/1762    most recent M109759200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Francin, M. Articles by Mirande, M. Search for Related Content PubMed PubMed Citation Articles by Francin, M. Articles by Mirande, M. Social Bookmarking                      What's this?

The N-terminal Domain of Mammalian Lysyl-tRNA Synthetase Is a Functional tRNA-binding Domain^*

Mathilde Francin, Monika Kaminska, Pierre Kerjan, and Marc Mirande^§

From the Laboratoire d'Enzymologie et Biochimie Structurales, CNRS, 1 Avenue de la Terrasse, 91190 Gif-sur-Yvette, France

Received for publication, October 9, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Lysyl-tRNA synthetase from higher eukaryotes possesses a lysine-rich N-terminal polypeptide extension appended to a classical prokaryotic-like LysRS domain. Band shift analysis showed that this extra domain provides LysRS with nonspecific tRNA binding properties. A N-terminally truncated derivative of LysRS, LysRS-N, displayed a 100-fold lower apparent affinity for tRNA₃^Lys and a 3-fold increase in K_m for tRNA₃^Lys in the aminoacylation reaction, as compared with the native enzyme. The isolated N-domain of LysRS also displayed weak affinity for tRNA, suggesting that the catalytic and N-domains of LysRS act synergistically to provide a high affinity binding site for tRNA. A more detailed analysis revealed that LysRS binds and specifically aminoacylates an RNA minihelix mimicking the amino acid acceptor stem-loop structure of tRNA₃^Lys, whereas LysRS-N did not. As a consequence, merging an additional RNA-binding domain into a bacterial-like LysRS increases the catalytic efficiency of the enzyme, especially at the low concentration of deacylated tRNA prevailing in vivo. Our results provide new insights into tRNA^Lys channeling in eukaryotic cells and shed new light on the possible requirement of native LysRS for triggering tRNA₃^Lys packaging into human immunodeficiency virus, type 1 viral particles.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Aminoacyl-tRNA synthetases are essential enzymes that catalyze the aminoacylation of tRNA molecules. Because aminoacylated tRNAs connect a given anticodon to the corresponding amino acid, accurate translation of the genetic code relates on the specific charging of these RNA molecules by their cognate aminoacyl-tRNA synthetases (1). Therefore, protein-tRNA interactions play a central role in this essential process. A wealth of biochemical and structural data have revealed different modes of tRNA-synthetase interaction. However, the acceptor stem and anticodon of tRNA are generally involved in binding to the synthetase (2, 3). The majority of earlier studies have focused on bacterial enzymes. A major difference that characterizes eukaryotic enzymes as compared with their prokaryotic counterparts is the presence of polypeptide chain extensions appended to the N or C terminus of the protein (4). Although the mean features of tRNA-synthetase interaction uncovered in bacterial systems should hold true for eukaryotic enzymes, additional RNA-binding helper domains have been recently characterized for several eukaryotic aminoacyl-tRNA synthetases: (i) The yeast protein Arc1p is an RNA-binding protein associated with MetRS and GluRS that functions as a trans-acting cofactor for tRNA aminoacylation (5, 6). A similar RNA-binding domain is recovered as a C-terminal polypeptide chain extension in plant MetRS (7) or as an auxiliary protein associated with the mammalian multisynthetase complex (8). Its crystal structure revealed an oligonucleotide-binding-fold conformation characteristic of numerous RNA-binding proteins (9, 10). (ii) A large, 228-amino acid residue RNA-binding domain is appended to the N terminus of yeast GlnRS (11). (iii) Bombyx mori GlyRS, multifunctional GluProRS, and human MetRS share a short, 50-amino acid residue RNA-binding domain corresponding to a single helix-turn-helix motif (12-14). (iv) Yeast AspRS share with eukaryotic class IIb aminoacyl-tRNA synthetases another type of RNA-binding module (15). In this study, we analyzed the RNA binding capacity of mammalian LysRS, a class IIb enzyme that may be involved in targeting tRNA₃^Lys, one of the three isoaccepting lysine tRNAs, to human immunodeficiency virus, type 1 (HIV-1)¹ viral particles where it serves as a primer for reverse transcription of viral RNA (16).

In mammals, lysyl-tRNA synthetase (LysRS), a homodimeric protein of 136 kDa, is one of the components of a multisynthetase complex containing the nine synthetases specific for amino acids Glu, Pro, Ile, Leu, Met, Gln, Lys, Arg, and Asp, as well as three auxiliary proteins (17, 18). The native form of LysRS, obtained after dissociation from the synthetase complex, displayed a remarkable affinity for negatively charged carriers, as compared with the Escherichia coli enzyme (19). Following controlled elastase digestion of the purified complex, LysRS was converted to a dimer with an apparent M_r of 2 × 62 kDa, similar in size to E. coli LysRS, which had lost its polyanion binding property (19). The crystal structures of the two E. coli lysS (20) and lysU (21) gene products and the crystal structure of Thermus thermophilus LysRS complexed with tRNA^Lys (22) have been described. The anticodon binding domain, located at the N terminus of the bacterial enzyme, is built around a -barrel. The C-terminal catalytic domain consists of an extended anti-parallel -sheet characteristic of class II synthetases. Cloning of the cDNA encoding hamster or human LysRS revealed the presence of a polypeptide chain extension of about 60 amino acid residues appended to the N terminus of the protein (see Fig. 1). The site of cleavage by elastase of mammalian LysRS has been localized within the stretch of alanine residues from Ala⁴⁹ to Ala⁵⁴ (23), just upstream from the anticodon binding domain of the synthetase. The truncated product shares 43% identity to the E. coli enzyme (48% identities for the catalytic domains; 33% identities for the anticodon-binding domains). The eukaryotic-specific, N-terminal polypeptide chain extension of hamster or human LysRS is rich in basic residues (12 Lys and 2 Arg residues) and is believed to be organized into helical segments (23). Sequence comparison of eukaryotic class IIb aminoacyl-tRNA synthetases identified a conserved 11-amino acid peptide that may be functionally important for binding tRNA (15). However, recent in vitro data suggested that removal of the N-domain of human LysRS causes relatively small changes in kinetic parameters for tRNA (24, 25).

In this work, we present evidence for the involvement of the N-domain of mammalian LysRS as a functional tRNA-binding domain. The native enzyme formed a stable RNA-protein complex with human tRNA₃^Lys, whereas a N-terminally truncated derivative did not. The presence of this extension decreases the K_m value for tRNA and therefore should facilitate tRNA aminoacylation under the conditions of suboptimal tRNA concentration prevailing in vivo.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Protein Overexpression and Purification-- Native LysRS from hamster was expressed in yeast and purified as described (23). Its N-terminally truncated derivative (LysRS-N) was obtained by elastase treatment of the native enzyme (19).

The N-terminal polypeptide extension of LysRS (N-LysRS) was expressed in E. coli. The 5'-coding region of hamster cDNA was PCR-amplified between oligonucleotides cccccatggccacgctgcaggagtg and cccctcgagagtctcctcctcaacaccc and inserted into the NcoI-XhoI sites of the bacterial expression vector pET-28b (Novagen). The encoded protein corresponds to hamster LysRS from Met¹ to Leu⁷¹ with the additional Glu-His₆ C-terminal sequence. All constructs were verified by DNA sequencing. Purification of N-LysRS bearing a His tag was conducted starting from a 2-liter culture of BL21(DE3) transformed with the recombinant pET plasmid, grown at 37 °C in LB-kanamycin (50 µg/ml) broth to a cell density corresponding to A₆₀₀ = 0.50. At that time, the recombinant protein was expressed for 3 h after addition of 1 mM isopropyl-1-thio--D-galactopyranoside. All subsequent steps were conducted at 4 °C. The cells were harvested by centrifugation (6000 × g for 10 min), washed with ice-cold extraction buffer (20 mM Tris-HCl, pH 8.0, 500 mM NaCl, 10 mM imidazole, and 10 mM 2-mercaptoethanol), resuspended in 20 ml of extraction buffer supplemented with 1 mM diisopropylfluorophosphate, and homogenized by sonication. After lysis, the supernatant recovered after centrifugation at 30,000 × g for 15 min was loaded on a 10-ml nickel-nitrilotriacetic acid Superflow matrix (Qiagen) charged with Ni²⁺. After washing with extraction buffer, bound material was eluted by a 200-ml linear gradient of imidazole from 10 to 200 mM in 20 mM Tris-HCl, pH 8.0, 500 mM NaCl, and 10 mM 2-mercaptoethanol. Fractions containing N-LysRS were pooled (~30 ml), dialyzed against 20 mM Tris-HCl, pH 7.0, 50 mM NaCl, and 2 mM dithiothreitol (DTT), and applied to a 2.0 × 9.5-cm column of SOURCE 15S (Amersham Biosciences, Inc.) equilibrated in 20 mM Tris-HCl, pH 7.0, 50 mM NaCl, and 2 mM DTT. After washing with equilibration buffer, N-LysRS was eluted by a 50-ml linear gradient of NaCl from 50 to 500 mM NaCl in the same buffer. Fractions were pooled, concentrated by ultrafiltration on MICROSEP (Pall Filtron; 3-kDa molecular mass cut-off), dialyzed against 20 mM Tris-HCl, pH 7.0, 50 mM NaCl, 2 mM DTT, and 55% glycerol, and stored at 20 °C at a protein concentration of ~20 mg/ml. The completeness of the purified protein was checked by matrix-assisted laser desorption ionization-time of flight mass spectrometry analysis (Bruker).

The protein concentration was determined by using calculated absorption coefficients of 0.547 and 0.600 A₂₈₀ units·mg¹·cm², respectively, for LysRS and LysRS-N. The concentration of N-LysRS was estimated according to Ref. 26.

Analytical Gel Filtration-- The apparent native molecular mass of the isolated N-domain of LysRS was determined by gel filtration on a Superdex 75 HR 10/30 column (Amersham Biosciences, Inc.) equilibrated in 25 mM Tris-HCl, pH 7.5, 500 mM NaCl, and 1 mM DTT and developed at 4 °C at a flow rate of 0.5 ml/min. All of the samples were loaded in 0.2 ml. For a particular protein, its elution was described in term of the corresponding K_av value. K_av = (V_e  V₀)/(V_t  V₀), where V_e is the elution volume of the particular molecule, V₀ is the void volume of the column, and V_t is the total bed volume. V₀ and V_t were determined with thyroglobulin (667 kDa) and vitamin B12 (1.35 kDa), respectively. Ovalbumin (45 kDa) and cytochrome c (12.4 kDa) were used for calibration.

Sedimentation Equilibrium-- Ultracentrifugation experiments were conducted as described previously (27) in a Beckman Optima XL-A analytical ultracentrifuge, using an An 60 Ti rotor and a double-sector cell of 12-mm path length. Equilibrium was verified from the superimposition of duplicate scans recorded at 4-h intervals.

The experimental sedimentation equilibrium data were fitted to a model for a single homogeneous species using the following equation.

(Eq. 1)

where c(r) is the protein concentration at radial position r, c(r_ref) is the concentration of the protein at an arbitrary reference radial distance r_ref, M_r is the molecular mass, is the partial specific volume (0.726 at 4 °C, for N-LysRS) of the solute,  is the density of the solvent,  is the angular velocity of the rotor, and R and T are the molar gas constant and the absolute temperature, respectively.

Gel Retardation Assay-- Plasmid pTL9 was obtained from J. L. Darlix (LaboRetro, Lyon). It allows in vitro transcription of tRNA₃^Lys lacking the 3'-terminal -C-A dinucleotide (28). To produce a functional tRNA, the two oligonucleotides LysF1 (5'-gatccggatgaaaa) and LysF2 (5'-gatcttttcatccg), which inserted a FokI site, were hybridized and introduced into pTL9 digested with BamHI, to give pLys3. Linearization with FokI followed by in vitro transcription with T7 RNA polymerase (7) generated a functional full-length tRNA₃^Lys. The amino acid acceptor minihelix^Lys (Acc^Lys) and anticodon microhelix^Lys (Ant^Lys) were produced by in vitro transcription of BstNI- or EcoRV-digested pUC18 derivatives constructed by insertion into their HindIII-BamHI sites of oligonucleotides RS101 (5'-agcttaatacgactcact)/RS111 (5'-ctatagtgagtcgtatta) and KH101 (5'-atagcccggacagggttcaagtccctgttcgggcgccag)/KH111 (5'-gatcctggcgcccgaacagggacttgaaccctgtccggg), or RS101/RS111 and KH102 (5'-atagtcagacttttaatctgatatcg)/KH112 (5'-gatccgatatcagattaaaagtctga), respectively.

³²P-Labeled tRNAs were purified on denaturing polyacrylamide gels, and protein-tRNA interactions were analyzed using a band shift assay, as described previously (7). After autoradiography, free and bound tRNA species were quantified by densitometry measurements.

Aminoacylation Assay-- Initial rates of tRNA aminoacylation were measured at 25 °C in 0.1 ml of 20 mM imidazole HCl buffer, pH 7.5, 100 mM KCl, 0.5 mM DTT, 12 mM MgCl₂, 2 mM ATP, 180 µM ¹⁴C-labeled lysine (PerkinElmer Life Sciences; 16.66 Ci/mol), and saturating amounts of tRNA, as described previously (29). Total brewer's yeast tRNA (Roche Molecular Biochemicals; lysine acceptance of 38 pmol/A₂₆₀) or homogeneous human tRNA₃^Lys obtained by in vitro transcription (lysine acceptance of 720 pmol/A₂₆₀) were used as tRNA substrate. Large scale synthesis of RNA substrates was conducted as described previously (7). The incubation mixture contained catalytic amounts (1-2 nM) of enzymes appropriately diluted in 10 mM Tris-HCl, pH 7.5, and 10 mM 2-mercaptoethanol containing bovine serum albumin at 4 mg/ml. One unit of activity is the amount of enzyme producing 1 nmol of lysine-tRNA^Lys/min, at 25 °C. For the determination of K_m values for substrates, concentrations of 0.02-2 mM, 5-300 µM, and 0.25-50 µM were used for ATP, lysine, and tRNA^Lys, respectively. Michaelian parameters were obtained by nonlinear regression of the theoretical Michaelis-Menten equation to the experimental curve using the KaleidaGraph 3.0.8 software (Abelbeck Software).

The time course of aminoacylation of tRNA₃^Lys minihelix was conducted at 25 °C in 20 mM imidazole HCl buffer, pH 7.5, 0.5 mM DTT, 12 mM MgCl₂, 2 mM ATP, and 150 µM ¹⁴C-labeled lysine (PerkinElmer Life Sciences; 309 Ci/mol) in the presence of 50 µM RNA substrates and 2.5 µM enzyme. At different time intervals, 0.02-ml aliquots were withdrawn and quenched on 3MM Whatman papers presoaked with ice-cold 5% trichloroacetic acid and 1 mM [¹²C]lysine. After a 1-h incubation on ice, filters were washed five times for 10 min in ice-cold 5% trichloroacetic acid containing 1 mM lysine, washed once in 95% ethanol, dried and processed for liquid scintillation counting. For the determination of K_m values for tRNA^Lys minihelix, RNA concentrations of 9-136 µM were used. The K_i value for inhibition of Acc^Lys aminoacylation by Ant^Lys was deduced from a Dixon plot of 1/v versus [Ant^Lys] (30).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The Eukaryote-specific N-domain of LysRS Is an Elongated Monomer in Solution-- To probe the functional role of the appended N-terminal domain of mammalian LysRS, the native enzyme from hamster (LysRS; dimer of 2 × 68 kDa) expressed in yeast (23) and a derivative with a deletion from residues 1-50 (LysRS-N; dimer of 2 × 62 kDa) obtained by in vitro controlled digestion with elastase (19) were isolated as described previously. The N-domain of LysRS from amino acid residues 1-71 (N-LysRS), corresponding to the eukaryotic-specific polypeptide extension preceding helix H1 from the anticodon-binding domain of bacterial LysRS (Fig. 1), was expressed in E. coli as a C-terminally His-tagged protein. This small protein domain (8,741 Da) proved to be highly soluble in E. coli (it contains 38% of charged residues Lys, Arg, Glu, and Asp, with a calculated pI of 8.1) and was purified to homogeneity after fractionation on a nickel-nitrilotriacetic acid column, followed by a second fractionation step on a cation exchange (SOURCE 15S) column. Matrix-assisted laser desorption ionization-time of flight mass spectrometry revealed a molecular mass of 8,608 ± 4 Da. The loss of 133 Da as compared with the calculated mass may be accounted for by the removal of the N-terminal Met residue from the sequence Met-Ala-. Indeed, in accordance with the N-terminal rules of methionine excision by Met aminopeptidase in E. coli (31), N-terminal methionine is generally removed when the second amino acid is alanine.

View larger version (24K): [in this window] [in a new window]   Fig. 1.   Schematic comparison of LysRSs and alignment of their N-terminal sequences. LysRS from E. coli (Ec), S. cerevisiae (Sc), and human (Hs) are schematized by open boxes representing their conserved catalytic domains (Cat. Domain, with arrows pointing to the location of the three conserved motifs of class II synthetases), striped boxes corresponding to their anticodon-binding domains (ABD), and N-terminal appended domains identified with RNA-binding domains (RBD). The N terminus of hamster LysRS (Cl; Cricetulus longicaudatus) from amino acid residues 1-90 is aligned with the corresponding LysRS sequences from H. sapiens (Hs), S. cerevisiae (Sc), T. thermophilus (Tt), and E. coli (lysS (EcS) or lysU (EcU) gene products). Amino acids that are conserved between hamster and another sequence are shaded. Helix H1 from the anticodon-binding domain of LysRS-U (21) is indicated.

The oligomeric structure of the isolated N-domain of LysRS was determined by gel filtration on a Superdex 75 column (Fig. 2A). N-LysRS was eluted as a quite symmetrical peak between ovalbumin (molecular mass = 45 kDa; K_av = 0.251) and cytochrome c (molecular mass = 12.4 kDa; K_av = 0.519) with a K_av of 0.376, corresponding to the elution volume of a globular protein of 24.7 kDa. Taking into account the mass of a monomer (8,608 Da), N-LysRS might behave as a trimer in solution. Essentially similar results were obtained after chromatography in 50 mM potassium phosphate buffer, pH 7.5, or 25 mM Tris-HCl, pH 7.5, containing 100 or 500 mM NaCl. Because molecular sieve chromatography essentially depends on Stokes radius of the solutes, N-LysRS was also analyzed by sedimentation equilibrium, a method that does not rely on the shape of the molecules. As shown in Fig. 2B, when N-LysRS was subjected to centrifugation equilibrium in 20 mM potassium phosphate buffer, pH 6.0, experimental data could be fitted to a monodisperse solute with a molecular mass of 9,104 Da. Molecular masses of 8,551 or 8,462 Da were determined in 200 mM potassium phosphate, pH 6.0, or 25 mM Tris-HCl, pH 7.5, 500 mM NaCl (not shown). Therefore, we concluded that the isolated N-domain of LysRS is a monomer with an elongated shape in solution.

View larger version (15K): [in this window] [in a new window]   Fig. 2.   The isolated N-domain of LysRS is an elongated monomer. A, purified N-LysRS domain (calculated theoretical mass of a monomer = 8,741 Da) was subjected to size exclusion chromatography on a Superdex 75 column as described under "Experimental Procedures." The apparent molecular mass of N-LysRS (24.7 kDa) was deduced from its relative elution volume Kav = 0.376. B, N-LysRS (initial concentration of 10 µM) was analyzed by equilibrium sedimentation at 30,000 rpm in 20 mM potassium phosphate, pH 6.0, and 1 mM DTT, at 4 °C. Experimental values (open circles) were fitted (curves) to a monodisperse solute of 9,104 Da. The residuals are indicated.

The Eukaryote-specific N-domain Provides LysRS with RNA Binding Properties-- Because hamster LysRS displays a markedly basic N-domain appended to a bacterial-like core enzyme, we analyzed the ability of full-length and of N-terminally truncated LysRS to form complexes with various tRNA molecules. Radiolabeled in vitro transcribed human tRNA₃^Lys was incubated with increasing amounts of LysRS (15-1000 nM), and free and bound tRNA species were analyzed by a gel retardation assay (Fig. 3). LysRS interacted with tRNA₃^Lys with an apparent dissociation constant of 30 ± 10 nM, taking into account the dimeric status of LysRS. This K_d value compares well with that reported for association of tRNA^Asp with yeast AspRS (K_d = ~20 nM), an enzyme that possesses a related N-domain (15). Similar band shifts were also observed with noncognate tRNAs from Saccharomyces cerevisiae (tRNA^Asp, K_d = ~40 nM; tRNA^Phe, K_d = ~40 nM; tRNA_i^Met, K_d = ~120 nM) or with human tRNA₃^Lys deprived of the -C-A dinucleotide at its 3'-extremity (K_d = ~50 nM) (not shown). These results established the general tRNA binding capacity of hamster LysRS and suggested that formation of a nonproductive RNA-protein complex might involve nonspecific electrostatic interactions between side chains of basic amino acid residues from the N-domain of LysRS and tRNA phosphate-sugar backbone.

View larger version (19K): [in this window] [in a new window]   Fig. 3.   The N-domain confers on mammalian LysRS tRNA binding properties. The three domains of LysRS are indicated: the catalytic domain (Cat.; amino acid residues 241-597); the anticodon binding domain (A.B.; amino acid residues 72-240); the N-domain (black ovals; amino acid residues 1-71). 32P-Labeled in vitro transcribed tRNA3Lys was incubated with the native enzyme (LysRS), with a N-terminally truncated enzyme (LysRS-N), or with the isolated N-domain (N-LysRS), at different concentrations (0-64 µM, expressed as monomer concentrations). After electrophoresis at 4 °C on a 6% native polyacrylamide gel, the mobility shift of tRNA was visualized by autoradiography. In each assay, the bottom band corresponds to the free tRNA species.

As shown in Fig. 3, the removal of the N-domain of LysRS was accompanied by a dramatic loss of its capacity to bind tRNA₃^Lys. LysRS-N contributed a stable complex with in vitro transcribed tRNA₃^Lys but displayed a 100-fold lower apparent affinity (K_d = 3 ± 1 µM (dimer concentration)). The latter value compares with the dissociation constant of 26 µM determined in the E. coli system between LysRS-S and tRNA^Lys (32). A weaker interaction (K_d  30 µM) was observed with noncognate yeast tRNA^Asp (not shown). The isolated N-domain of LysRS formed a weak complex with tRNA^Lys (K_d = ~20 µM) (Fig. 3). Therefore, N-LysRS and LysRS-N are both required to confer on the native enzyme a robust tRNA binding propensity.

The N-domain of LysRS Is a Functional RNA-binding Domain during tRNA Aminoacylation-- Because the RNA binding properties of LysRS and LysRS-N radically differed, we investigated in detail kinetics of tRNA aminoacylation by these two enzyme species. First, we sought to check whether removal of the N-domain of LysRS affected the catalytic center of the enzyme. The kinetic parameters for lysine and ATP in the aminoacylation reaction, with K_m values of approximately 100 and 200 µM, respectively, were not significantly different for LysRS and LysRS-N (Table I). These results, obtained with the two substrates that deeply fit into the catalytic pocket of the enzyme, established that catalysis of Lys-tRNA^Lys formation is basically unchanged by the deletion of the N-domain.

View this table: [in this window] [in a new window]   Table I Apparent kinetic parameters for lysine, ATP and tRNA by LysRS and LysRS-N in the tRNALys aminoacylation reaction Standard errors were determined from at least two independent data sets.

In contrast, a moderate but consistently observed variation of the K_m value for tRNA was uncovered. The catalytic efficiency (k_cat/K_m) of LysRS and LysRS-N was determined with homogeneous, in vitro transcribed human tRNA₃^Lys (lysine acceptance of 720 pmol/A₂₆₀) (Fig. 4 and Table I). The k_cat/K_m for the aminoacylation of tRNA₃^Lys by LysRS-N is 0.67 µM¹ s¹ at 25 °C in the presence of 180 µM lysine and 100 mM KCl (Table I), as compared with a value of ~0.1 µM¹ s¹ determined for the homologous human enzyme at 30 °C in the presence of 20 µM lysine (a nonsaturating amino acid concentration) and 20 mM KCl (24, 25).

View larger version (15K): [in this window] [in a new window]   Fig. 4.   The N-domain of LysRS affects Km but not kcat in the aminoacylation of tRNA3Lys. The tRNA saturation kinetics in the tRNALys aminoacylation reaction was determined with homogeneous, in vitro transcribed tRNA3Lys (lysine acceptance of 720 pmol/A260 unit) in the presence of 0.5 nM of the native (LysRS) or N-truncated (LysRS-N) enzyme. The experimental values (closed symbols) were fitted to the Michaelis-Menten equation (curves).

We found that the k_cat/K_m for aminoacylation of tRNA₃^Lys is increased 3-fold for the native enzyme, resulting essentially from a 4-fold decrease in K_m for tRNA. Therefore, the N-domain decreased the apparent K_m value for tRNA but did not affect the catalytic rate of the enzyme. This is in contrast to an earlier work that reported identical K_m values for tRNA for Lys-tRNA formation by native and N-terminally truncated human LysRS (25). However, in that study the native enzyme was produced in E. coli with a large (16 amino acid residues) His tag appended to the N terminus of the protein, a feature that might have impair the function of this domain (see below). In the cytoplasm of mammalian cells, LysRS is exclusively found as a component (LysRS^Cx) of a multi-synthetase complex (4). We checked whether association of LysRS within the complex changes its catalytic properties. The k_cat/K_m for the aminoacylation of tRNA₃^Lys by LysRS^Cx (2.0 µM¹ s¹) was similar to that determined for the ectopic free form of LysRS (2.07 µM¹ s¹) (Table I). This result confirms an earlier work showing that the association state of these enzymes is not required for their functioning in vitro (29).

In previous works, we showed that the presence of a large excess of noncognate tRNAs in the aminoacylation reaction may conceal kinetic effects contributed by the appended domains of other eukaryotic enzymes by neutralization of the nonspecific RNA-binding sites (7, 14). Accordingly, when total yeast tRNA (lysine acceptance of 38 pmol/A₂₆₀) was used in the aminoacylation reaction, the K_m values for tRNA^Lys obtained with LysRS, with LysRS-N, or with the natural form of LysRS associated in the complex were similar (Table I).

The N-domain Is Involved in Docking the Acceptor Arm of tRNA in the Catalytic Center of LysRS-- The bacterial LysRS lacks the N-domain specific of the mammalian enzyme. Nucleotide A⁷³ is conserved among prokaryotic tRNA^Lys and, in conjunction with nucleotides U³⁴, U³⁵, and U³⁶ of the anticodon, is an important identity determinant (33, 34). Therefore, the two primary interaction sites between LysRS and tRNA^Lys in the E. coli system are likely to involve both the catalytic domain and the oligonucleotide-binding-folded anticodon binding domain of the synthetase (22, 32). The appended N-domain of mammalian LysRS is contiguous to the anticodon-binding domain of the synthetase. Because of its elongated shape (Fig. 2), we considered the possibility that different regions of tRNA₃^Lys may interact with this RNA-binding domain.

To probe the interaction of tRNA₃^Lys with the N-domain of mammalian LysRS, the two major domains of tRNA₃^Lys were synthesized in vitro (Fig. 5). In vitro transcribed, ³²P-labeled amino acid acceptor minihelix (Acc^Lys) and anticodon microhelix (Ant^Lys) of tRNA₃^Lys were used in a gel mobility shift assay to examine their association with full-length LysRS or with its separate N-LysRS and LysRS-N domains (Fig. 5 and Table II). The acceptor minihelix formed a stable complex with LysRS with an apparent K_d value of about 0.5 µM but gave no complex with the N-terminally truncated enzyme. The isolated N-domain displayed a weak Acc^Lys binding capacity (K_d = ~50 µM). We concluded that the appended RNA-binding domain of LysRS acts synergistically with the catalytic core of the enzyme to build a potent binding site for the amino acid acceptor stem minihelix of tRNA₃^Lys. A minihelix corresponding to a noncognate tRNA, the acceptor stem of yeast tRNA_i^Met, also formed a stable complex with LysRS with an apparent K_d of 1 µM (not shown), further exemplifying the general RNA binding potency of mammalian LysRS.

View larger version (27K): [in this window] [in a new window]   Fig. 5.   The N-domain of LysRS contributes to the binding of the amino acid acceptor and anticodon arms of tRNA. Left panel, sequence and cloverleaf structure of tRNA3Lys and sequence and hairpin structures of acceptor minihelix (AccLys) and anticodon microhelix (AntLys). Right panel, band shift assay performed with 32P-labeled AccLys and AntLys in the presence of various amounts (0.06-64 µM) of LysRS, LysRS-N, or N-LysRS as described in the legend of Fig. 3.

In contrast to Acc^Lys, a microhelix mimicking the anticodon stem-loop structure of tRNA₃^Lys (Ant^Lys) interacted with LysRS-N (K_d = 15 µM) (Fig. 5 and Table II). This is consistent with the finding that the UUU sequence of the anticodon of tRNA^Lys contributes a major site of interaction with the synthetase (32, 35). The isolated general RNA-binding N-domain of the synthetase also interacted with Ant^Lys (K_d ~60 µM). The apparent dissociation constant K_d of 0.2 µM observed with native LysRS is likely to reflect the sum of two discrete interactions: a specific interaction between Ant^Lys and the anticodon-binding domain of LysRS; a nonspecific association with the N-domain of LysRS. The latter domain might therefore interact with the two moieties of the tRNA molecule. A similar behavior was reported in the case of the RNA-binding domain of yeast AspRS (15). This finding is also consistent with the elongated shape observed for the N-domain of LysRS (Fig. 2).

Acceptor minihelices are substrates for many aminoacyl-tRNA synthetases (36). However, human LysRS had been reported to lack the capacity to aminoacylate an acceptor-TC stem-loop derived from tRNA₃^Lys (25). Given the robust interaction observed between LysRS and Acc^Lys (Fig. 5) and taking into account that previous experiments were performed with a human LysRS produced in E. coli with a long 16-amino acid residue N-terminal His tag, we reinvestigated the possibility that a native enzyme may efficiently aminoacylate an RNA minihelix. Although the N-terminally truncated form of LysRS did not detectably aminoacylate an Acc^Lys minihelix even when high concentrations of LysRS-N (2.5 µM) and RNA (50 µM) were used, a linear time course of lysine incorporation into Acc^Lys was observed with the native LysRS enzyme (Fig. 6). The finding that Acc^Lys can be aminoacylated only when the appended RNA-binding domain of LysRS is present is consistent with the involvement of this domain in binding the acceptor stem of tRNA^Lys and presenting its 3'-terminal adenosine in a conformation suited for aminoacylation. This result also suggests that a large His tag appended to the N-terminal extension of LysRS may suppress the functional RNA-binding capacity of this domain. The specificity constant k_cat/K_m for the aminoacylation of Acc^Lys is decreased 2.6 × 10⁶-fold relative to the k_cat/K_m for tRNA₃^Lys. Using Acc^Lys concentrations ranging from 9 to 136 µM, we could determine individual apparent kinetic parameters. The lower k_cat/K_m value results from a limited 40-fold increase in K_m for RNA and a large 65,000-fold decrease in k_cat (Table I). The difference in apparent free energy of activation [G° = RT ln[(k_cat/K_m)^Acc/(k_cat/K_m)^tRNA] for aminoacylation of the acceptor minihelix versus full-length tRNA^Lys is 8.7 kcal/mol. In contrast, taking into account the 16-fold decrease in K_d for Acc^Lys as compared with tRNA^Lys (Table II), the difference in free energy of binding [G° = RT ln[(K_d)^Acc/(K_d)^tRNA] of the tRNA versus acceptor minihelix is only 1.7 kcal/mol. Thus, most of the energy of binding of tRNA anticodon (G° = 8.95 kcal/mol) seems to be involved in improving enzyme transition state complementarity, therefore lowering the activation energy of k_cat and increasing the rate of the reaction.

View larger version (15K): [in this window] [in a new window]   Fig. 6.   Time course of aminoacylation of the amino acid acceptor minihelix of tRNA3Lys by LysRS. Aminoacylation of the amino acid acceptor minihelix of tRNA3Lys was conducted at 25 °C, with 50 µM RNA and 5 µM of the native enzyme (LysRS) or of its N-terminally truncated derivative (LysRS-N).

We tested the possibility that binding of anticodon microhelix of tRNA^Lys on LysRS might stimulate charging of acceptor minihelix. However, inhibition of minihelix aminoacylation occurred upon its addition (K_i = 10 ± 3 µM). This result is consistent with the finding that the N-domain of LysRS displays a general RNA binding capacity and is able to bind Ant^Lys as well (Fig. 5 and Table II). Although the anticodon stem-loop of Ant^Lys specifically interacts with the anticodon-binding domain of LysRS, it can also compete with Acc^Lys for binding to the N-domain of LysRS.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Lysyl-tRNA synthetase from mammalian origin is one of the 11 components of the multisynthetase complex. The native homodimer strongly interacts with the scaffold protein of the complex, the p38 subunit, with a K_d value of 0.3 nM (37, 38). A stable subcomplex comprising p38 and LysRS only can be reconstituted starting from the individual components. In addition, weak interactions were reported between the N-domain of LysRS and the N-domain of ArgRS (39), suggesting that contacts between eukaryotic-specific domains may stabilize this macromolecular assemblage. However, the removal of its eukaryotic-specific polypeptide extension did not impair association of LysRS with p38 (38), suggesting that it fulfills primarily another function. Because of its lysine-rich content, we surmised it may be endowed with a RNA binding potential. As a first step, we investigated the binding of tRNA₃^Lys and of minihelices mimicking the acceptor and anticodon domains of the tRNA molecule by the native or N-terminally truncated LysRS. Our data, combined with kinetics analysis of the aminoacylation reaction, clearly showed that N-LysRS is a new type of RNA-binding domain that acts as a cofactor for tRNA binding. The removal of N-LysRS did not modify the k_cat of Lys-tRNA^Lys formation and did not change the K_m values for lysine and ATP, suggesting that the active site of LysRS is not significantly affected by this deletion. By contrast, the K_m value for tRNA₃^Lys is 3.9 times higher for LysRS-N, as compared with LysRS. This is consistent with the 2-orders of magnitude increase in K_d for tRNA observed for the truncated enzyme.

There is no known three-dimensional structure of structural homologs of N-LysRS, but several regions of this extension are believed to form amphiphilic -helices that would cluster basic residues on one side and may therefore contribute RNA-binding sites (15, 23). Because of the elongated shape of N-LysRS, it is conceivable that this additional domain may optimize tRNA^Lys/LysRS association by binding to several regions of the tRNA molecule (Acc^Lys and Ant^Lys). However, the functional association of Acc^Lys and LysRS observed in this study, not observed in the case of LysRS-N, which is unable to aminoacylate a minihelix mimicking the acceptor stem of tRNA, suggests that an important consequence of acquisition in evolution of a eukaryotic extension is to improve the docking of the CCA end of tRNA in the active site of the enzyme.

Although concentrations of amino acid and ATP in the cytoplasm of eukaryotic cells are above the K_m values determined for the corresponding aminoacyl-tRNA synthetases, the concentration of deacylated tRNA is well under the K_m values determined in vitro. The number of lysine-specific tRNA/rabbit reticulocyte has been estimated to 27,700 molecules/cell, corresponding to an intracellular concentration of about 0.5 µM (40). For a tRNA with a given specificity, the periodate-resistant tRNA fraction, corresponding to the in vivo acylated tRNA fraction, isolated from exponentially growing CHO cells has been shown to be greater than 95% of that tRNA species (41). Because EF-1A is one of the most abundant cellular protein (cellular concentration of about 30 µM) (42), aminoacylated tRNAs should be, to a large extent, in the form of the ternary complex EF-1A-GTP-aminoacyl-tRNA. Therefore, the fraction of free, nonacylated cellular tRNA^Lys is likely to be lower than 0.025 µM, a value 2 orders of magnitude lower than the K_m value for tRNA determined for LysRS. The far suboptimal tRNA concentration suggests that, in vivo, tRNA is not freely diffusing in the entire cellular space but is channeled in the cycle of protein synthesis. The concept of tRNA cycling during translation was proposed by Smith in 1975 (43) and further refined by Deutscher and co-workers (44-46). It assumes that tRNA is vectorially transferred from its synthetase to elongation factor EF-1A, then to ribosome, and back to the synthetase without mixing with the cellular fluid. According to this model, the availability of tRNA for aminoacylation by the synthetase does not rely on the cellular concentration of the free tRNA species but on the efficiency of the cycling process. Because of the scarcity of nonacylated tRNA, delivery of this highly charged macromolecular substrate by a mechanism of free diffusion might introduce a rate-limiting step in translation. In that connection, the acquisition in evolution by mammalian LysRS of an eukaryotic-specific RNA-binding module, which lowers the apparent dissociation constant for tRNA₃^Lys from 3 µM (LysRS-N) to 30 nM (LysRS), may be an essential component for tRNA^Lys cycling during its lysylation process. Likewise, the supplementary RNA-binding modules appended to other eukaryotic aminoacyl-tRNA synthetases also decrease dissociation constants for their cognate tRNAs (6-8, 11, 12, 14, 15).

The sequestering of tRNA in the translation process implies that tRNA is only barely available for parallel processes. However, in some circumstances, tRNA₃^Lys is diverted, at least in part, from its route in translation and enters another pathway. RNA primers are required for initiating reverse transcription of the RNA genome of several retroviruses or endogenous retroelements. In particular, reverse transcription of the genomic RNA of HIV-1 is primed by tRNA₃^Lys (47). Approximately 60% of the tRNA incorporated into infectious HIV-1 particles is accounted for by tRNA_1,2^Lys and tRNA₃^Lys (48). The molecular bases of tRNA^Lys selection for packaging are not clear. The inhibition of LysRS activity by the viral auxiliary protein Vpr may be required to target tRNA₃^Lys to the assembling virion (49). A recent publication reports LysRS packaging into HIV-1 particles (16). Because packaged LysRS corresponded to a shorter, proteolytically modified enzyme, Cen et al. (16) suggested that the truncated enzyme may associate more efficiently tRNA^Lys. However, our results suggest that the removal of the N-terminal RNA-binding module of the human enzyme may preclude its ability to associate tRNA₃^Lys and to trigger its copackaging into the viral particle. The involvement of human LysRS in the biology of HIV-1 remains an intriguing matter.

	ACKNOWLEDGEMENTS

We thank J. L. Darlix for the gift of the pTL9 plasmid and G. Batelier (Laboratoire d'Enzymologie et Biochimie Structurales, CNRS) for performing sedimentation equilibrium analyses. The excellent technical assistance of Françoise Triniolles and Cécile Merle is gratefully acknowledged.

	FOOTNOTES

^* This work was supported by grants from the Agence Nationale de Recherche sur le SIDA, the Association pour la Recherche sur le Cancer, and La Ligue.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Supported in part by grants from the Jumelage Franco-Polonais program from CNRS. Present address: Inst. of Bioorganic Chemistry, Polish Academy of Sciences, 60-704 Poznan, Poland.

^§ To whom correspondence should be addressed. Tel.: 33-1-69-82-35-05; Fax: 33-1-69-82-31-29; E-mail: mirande@lebs.cnrs-gif.fr.

Published, JBC Papers in Press, November 8, 2001, DOI 10.1074/jbc.M109759200

	ABBREVIATIONS

The abbreviations used are: HIV-1, human immunodeficiency virus, type 1; LysRS, lysyl-tRNA synthetase; DTT, dithiothreitol; N-domain, N-terminal domain.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. Guo, M. Ignatov, K. Musier-Forsyth, P. Schimmel, and X.-L. Yang Crystal structure of tetrameric form of human lysyl-tRNA synthetase: Implications for multisynthetase complex formation PNAS, February 19, 2008; 105(7): 2331 - 2336. [Abstract] [Full Text] [PDF]

				H. Walbott, S. Auxilien, H. Grosjean, and B. Golinelli-Pimpaneau The Carboxyl-terminal Extension of Yeast tRNA m5C Methyltransferase Enhances the Catalytic Efficiency of the Amino-terminal Domain J. Biol. Chem., August 10, 2007; 282(32): 23663 - 23671. [Abstract] [Full Text] [PDF]

				M. Kaminska, V. Shalak, M. Francin, and M. Mirande Viral Hijacking of Mitochondrial Lysyl-tRNA Synthetase J. Virol., January 1, 2007; 81(1): 68 - 73. [Abstract] [Full Text] [PDF]

				N. Entelis, I. Brandina, P. Kamenski, I. A. Krasheninnikov, R. P. Martin, and I. Tarassov A glycolytic enzyme, enolase, is recruited as a cofactor of tRNA targeting toward mitochondria in Saccharomyces cerevisiae Genes & Dev., June 15, 2006; 20(12): 1609 - 1620. [Abstract] [Full Text] [PDF]

				C. Ling, Y.-N. Yao, Y.-G. Zheng, H. Wei, L. Wang, X.-F. Wu, and E.-D. Wang The C-terminal Appended Domain of Human Cytosolic Leucyl-tRNA Synthetase Is Indispensable in Its Interaction with Arginyl-tRNA Synthetase in the Multi-tRNA Synthetase Complex J. Biol. Chem., October 14, 2005; 280(41): 34755 - 34763. [Abstract] [Full Text] [PDF]

				M. Praetorius-Ibba, T. E. Rogers, R. Samson, Z. Kelman, and M. Ibba Association between Archaeal Prolyl- and Leucyl-tRNA Synthetases Enhances tRNAPro Aminoacylation J. Biol. Chem., July 15, 2005; 280(28): 26099 - 26104. [Abstract] [Full Text] [PDF]