|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 3, 1816-1823, January 18, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, August 20, 2001, and in revised form, October 9, 2001
Free fatty acids (FFA) and
sn-2-monoacylglycerol (MG), the two major hydrolysis
products of dietary triacylglycerol (TG), are absorbed from the lumen
into polarized enterocytes that line the small intestine. Intensive
studies regarding FFA metabolism in the intestine have been published;
however, little is known regarding the metabolism of MG. In these
studies, we examined the metabolism of sn-2-monoolein
(sn-2-18:1) by human intestinal Caco-2 cells. To mimic the
physiological presentation of MG to the enterocyte, the metabolism of
[3H]sn-2-monoolein was examined by adding
taurocholate-mixed sn-2-18:1 and albumin-bound
sn-2-18:1 at the apical (AP) and basolateral (BL) surfaces
of the Caco-2 cell, respectively. The results demonstrate that more
sn-2-18:1 was incorporated into TG from AP
taurocholate-mixed sn-2-18:1, whereas more phospholipid
was synthesized from BL albumin-bound sn-2-18:1. The
TG:phospholipid ratio was ~5-fold higher for AP relative to BL MG
incubation. Qualitatively similar results were observed for bovine
serum albumin-bound MG added at the apical surface. It was also found
that substantial sn-2-18:1 radioactivity was recovered in
the FFA fraction, suggesting that sn-2-18:1 may be
directly hydrolyzed within the Caco-2. We therefore used reverse transcription-PCR with primers designed from the murine MG lipase (MGL)
gene, and detected the presence of MG lipase mRNA in Caco-2. The
human MGL gene was cloned and found to be 83% identical to the murine
MGL, and identical to a previously described lysophospholipase-like protein. Northern blot analysis showed the expression of MGL throughout Caco-2 differentiation. Thus, MG metabolism in Caco-2 cells may include
not only well established anabolic processes, but also catabolic
processes. Further, the observed polarity of MG metabolism suggests that, as for fatty acids, separate precursor and/or product pools of lipid may exist in the intestinal enterocyte.
sn-2-Monoacylglycerol
(sn-2-MG)1 and
fatty acids (FFA) are the products of pancreatic lipase hydrolysis of
dietary triacylglycerol (TG). They are absorbed from the lumen into
polarized enterocytes that line the small intestine (1).
Following absorption, across the apical (AP) surface of the enterocyte,
sn-2-MG and FFA are reincorporated into TG, which are subsequently
secreted as the major component of chylomicrons (CM) into the lymphatic
system (1). FFA are also taken up across the basolateral (BL) surface of the enterocyte (2), and we have shown recently that MG is taken up
across the BL surface of Caco-2 cells as well (3). CM and other TG-rich
lipoproteins are hydrolyzed by lipoprotein lipase (LPL) that extends
into the vascular space from the capillary endothelial cells of
extrahepatic tissues. LPL catalyzes the release of FFA from TG, and
circulating TG-rich lipoproteins have been reported to accumulate MG
after LPL hydrolysis (4, 5). Further, serum albumin was found to bind
sn-2-monoolein (sn-2-18:1) with an apparent
dissociation constant (Kd) of ~0.2
µM (6), and it was shown that albumin-bound MG was not
hydrolyzed by milk LPL (5). Therefore, it is likely that
sn-2-MG is circulating in the plasma either bound to albumin
or as a component of lipoprotein remnants, and is taken up into the
enterocyte across the basolateral membrane. However, no studies have
addressed the metabolic fate of plasma MG taken up by the enterocyte.
The small intestine is capable of synthesizing TG via both the glycerol
3-phosphate (G3P) and the CoA-dependent MG pathways of
acylglycerol synthesis, which under normal conditions contribute about
20 and 80%, respectively, to total TG levels in the CM (7). The
CoA-dependent MG pathway proceeds by direct acylation of
the sn-2-MG with fatty acyl CoA, yielding the
sn-1,2-diacylglycerol (sn-1,2-DG) intermediate
(8). The MG pathway is achieved by the enzyme complex "TG
synthetase" that has been localized to the cytosolic surface of the
endoplasmic reticulum (ER) (9). When the FFA and sn-2-MG
levels are low, the G3P pathway becomes a major route for synthesis of
TG in the enterocyte (7). This pathway involves the acylation of G3P
with fatty acyl CoA to yield lysophosphatidic acid, and subsequent
acylation and dephosphorylation of lysophosphatidic acid to obtain DG.
The final reaction in both the MG and G3P pathways for TG synthesis is
the conversion of DG to TG via diacylglycerol acyltransferase (DGAT)
(7). Cases et al. (10) have shown that two DGAT genes are
expressed in the small intestine. It is not yet clear whether the DGAT
activities in the MG pathway and G3P pathway have distinct localizations.
Luminally derived and plasma-derived FFA were found to have different
metabolic fates in the enterocyte. Plasma FFA were primarily oxidized
or incorporated into phospholipids in rats and humans (2, 11), whereas
FFA absorbed from the intestinal tract were mainly incorporated into TG
(2). Studies in Caco-2 cells also showed an increase in the ratio of
TG:PL for apically, compared with basolaterally, administered FFA,
further suggesting polarity of lipid metabolism at the level of the
intestinal cell (12). No studies have addresses the metabolic fate of
plasma-derived MG taken up by enterocytes; thus, it is not known
whether a similar compartmentation of MG metabolism occurs.
The Caco-2 cell line was used to begin to examine enterocyte MG
metabolism. When grown in culture, Caco-2 cells spontaneously develop
many functions characteristic of mature villus cells of the small
intestinal epithelium, including tight junction formation, lipoprotein
secretion across the BL membrane, and the expression of
L-and I-FABP (13). Caco-2 cells also have a number of
traits that differ from those of native enterocytes, including the
synthesis of apoB-100 rather than apoB-48 (14), and lower levels of
I-FABP expression (15). In addition, we have shown previously that, although Caco-2 cells have both the G3P and MG pathways of TG synthesis, the levels of monoacylglycerol acyltransferase (MGAT) activity are ~10% of those found in the mature villus cell (16). Despite their limitations, Caco-2 cells allow the study of a polarized enterocyte monolayer, provide separate access to AP and BL surfaces, and are a commonly used model system for studies of intestinal lipid
absorption and metabolism.
In the present studies, the metabolic fate of sn-2-MG in the
Caco-2 enterocyte was examined using taurocholate (TC)-mixed MG
micelles at the AP surface, to mimic the postprandial luminal environment, and albumin-bound MG at the BL surface, to mimic the plasma situation. In addition, the metabolic fates of palmitate and
oleate, two major dietary FFA that are the predominant FFA species in
serum, were studied, to directly compare the metabolic fates of FFA and
MG.
Materials--
Polycarbonate Transwell filter inserts (6.5-mm
diameter, 0.4-µm pore) were purchased from Costar Corp. (Cambridge,
MA). Tritium-labeled [9,10-3H]triolein (28 Ci/mmol),
9,10-3H-labeled oleic acid (14 Ci/mmol), and
9,10-3H-labeled palmitic acid (56 Ci/mmol) were from
PerkinElmer Life Sciences. Unlabeled
sn-2-monoolein and sn-1-monoolein were obtained from Serdary Research Laboratory (Englewood Cliffs, NJ). The 3% sodium
borate-coated preparative thin layer chromatography (TLC) plates were
obtained from Analtech (Newark, DE). Silica gel G TLC plates were
purchased from Whatman (Hillsboro, OR). Bovine serum albumin (BSA)
(essentially fatty acid-free) and pancreatic lipase (type VI) were
obtained from Sigma. TC was purchased from Calbiochem (La Jolla, CA).
The PVDF Immobilon-P blotting membranes were from Millipore Corp
(Bedford, MA). Dulbecco's modified Eagle's medium (DMEM),
nonessential amino acids, fetal bovine serum, penicillin, streptomycin,
trypsin-EDTA, and poly(T) primers were from Invitrogen. Lipid
standards were obtained from Avanti Polar Lipids (Birmingham, AL).
Chloroform, methanol, acetic acid, diethyl ether, and hexane were
obtained from Fisher Scientific (Pittsburgh, PA). The SV total RNA
isolation kit, Cell Culture--
Caco-2 cell cultures were grown in DMEM with
4.5 g/liter glucose, 4 mM glutamine, 100 units/ml
penicillin, 100 mg/ml streptomycin, 1% nonessential amino acids, and
20% fetal bovine serum in a 95% air, 5% CO2 atmosphere
at 37 °C. The medium was changed every other day. Cells were
plated at a density Preparation of Radiolabeled sn-2-Monoolein
(sn-2-18:1)--
Because there is no commercially available
radiolabeled sn-2-MG, and the isomerization of
monoacylglycerides between sn-1 and sn-2
positions is likely to occur by acid, alkali, or heat (18),
3H-labeled sn-2-monoolein was freshly prepared
before each experiment. 3H-Labeled triolein (specific
activity 28 Ci/mmol) that has 3H-label on the double bond
of all acyl chains was used as substrate. [3H]sn-2-Monoolein was prepared by digestion
of radiolabeled triolein with pancreatic lipase (type VI) (Sigma),
followed by 3% sodium borate coated preparative TLC separation and
elution into hexane (18). Recovery was typically 20% (maximum recovery
is, theoretically, 33%). As analyzed by borate-TLC separation, the
prepared [3H]sn-2-MG in hexane was stable as
sn-2-MG over a 1-month period when stored in brown vials
filled with N2 at Preparation of Radiolabeled FFA and MG Media--
For apical
incubation, radiolabeled palmitic acid (16:0), oleic acid (18:1), and
sn-2-18:1 (2 mM final concentration, 0.5 µCi/nmol for each ligand) were dried under N2. The dried
lipids were then dissolved in ethanol (0.5% volume of the final volume of the solution), and subsequently dispersed in 10 mM TC
(typical luminal bile salt level) (19) in phosphate-buffered saline
(PBS; 137 mM NaCl, 2.7 mM KCl, 1.5 mM KH2PO4, 8 mM
NaHPO4, pH 7.4) and incubated for 1 h at 37 °C with
90 rpm shaking. Solutions of 30 µM 3H-labeled
16:0, 18:1, and sn-2-18:1 complexed to 100 µM
BSA (essentially fatty acid-free; Sigma) were made by addition of
ethanol (0.5% volume to the final volume of solution) to dried
3H-lipids, followed by addition of 100 µM BSA
(typical plasma albumin level) (20) in PBS, and incubated for 1 h
at 37 °C before use. The unbound concentrations of 16:0 and 18:1 in
TC micelles were determined using the fluorescent probe ADIFAB
(Molecular Probes, Inc., Eugene, OR) (21), and the ultrafiltration
method described by Schulthess et al. (22), as described
previously (3). The unbound concentration of sn-2-18:1 in
TC-mixed micelles was determined only by the ultrafiltration method
because ADIFAB does not bind MG. The unbound concentrations of LCFA
bound to BSA were calculated from the equilibrium binding constants as
reported by Spector et al. (23), and the unbound
concentration of sn-2-18:1 bound to BSA was calculated from
the binding constant determined by Thumser et al (6). Uptake
media containing unbound concentrations of lipids below their critical
micellar concentrations were used for the studies.
Metabolism Studies--
The metabolic fates of radiolabeled
sn-2-18:1, 18:1, and 16:0 were determined in Caco-2 cells
as follows. Media were replaced with serum-free DMEM for 15 h. The
Caco-2 cell monolayers were then incubated with TC-mixed lipids
apically, and with BSA-bound lipids at either the BL surface or, for
some experiments, at the AP surface, for 2, 6, or 24 h at
37 °C. At these designated time points, cells were collected after
washing with ice-cold 0.5% BSA solution twice, and ice-cold PBS
solution three times, as shown previously to remove all extracellular
substrate (3). Protein content and radioactivity were determined after
sonication of cells on ice for 30 s using a Branson sonifier
equipped with a microtip. Total cell lipids were extracted using the
method of Bligh and Dyer (24), and the radioactivity after lipid
extraction was found to be ~80% of the radioactivity prior to lipid
extraction. After accounting for extraction efficiency, FFA oxidation
was estimated by subtraction of the radioactivity recovered in the lipid extract from that in the cell sonicate, and averaged less than
3%. The incorporation of radiolabeled palmitic acid, oleic acid, and
sn-2-monooleion into lipid metabolites was analyzed using
two-step TLC separation as described previously (12). Briefly, extracts
with added carrier lipids (cholesteryl oleate, triolein (TG), oleate,
sn-1,2-diolein (DG), monoolein (MG), cholesterol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, phosphatidic acid, and lysophosphatidylcholine) were spotted under nitrogen gas onto 20 × 20-cm TLC plates (Silica gel G; Whatman, Hillsboro, OR). The plates were developed to half the height of the
plate in chloroform-methanol-acetic acid-formic acid-distilled water
(35:15:6:2:1 v/v), allowed to dry under the hood, and then developed up
the entire height of the plate in hexane-diethyl ether-acetic acid
(70:30:1 v/v). Lipids were visualized with iodine vapor. After allowing
the iodine to evaporate under the hood, the area corresponding to each
lipid was scraped into 3 ml of Ultrafluor (Fisher Scientific) and
radioactivities were counted using a scintillation counter.
Western Blot to Detect Human Pancreatic TG Lipase
(PTL)--
Caco-2 cells were harvested and lysed by sonication. The
lysed cells were centrifuged at 12,000 × g for 10 min
at 4 °C. Total protein in the lysate supernatant was measured
according to Bradford (25). The proteins were separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using
10% gels. The proteins were electrophoretically transferred to PVDF
membranes. Blotting membranes were blocked with 5% nonfat dry milk and
then incubated with the polyclonal rabbit anti-human PTL antibody at a
1:2000 dilution. Antigen-antibody complexes were detected by incubating
with anti-rabbit IgG-horseradish peroxidase conjugate at 1:10,000
dilution. The blots were developed by enhanced chemiluminescence (ECL,
Amersham Biosciences, Inc.). Both purified human PTL and
polyclonal rabbit anti-human PTL antibody were obtained from Dr. M. Lowe (Washington University, St. Louis, MO). Polyclonal anti-human
L-FABP and anti-human I-FABP antibodies were provided by
Dr. J. Veerkamp (University of Nijmegen, The Netherlands) to serve as
positive controls.
RT-PCR Determination for MG Lipase--
The presence of MG
lipase mRNA in Caco-2 was evaluated by RT-PCR. All assays were done
in triplicate or more. RNA from male Sprague-Dawley rat adipose tissue
was used for a positive control; RNA from rat jejunal mucosa was also
evaluated (26). RNAs were prepared from Caco-2 cells grown in
75-cm2 flasks at designated times after confluence, as
indicated in the figure legends. Total RNA was extracted from cells
using the SV total RNA isolation kit from Promega. First strand DNA
synthesis was done by using the oligo(dT)18 primer from
Invitrogen and AMV transcriptase from Promega. cDNA first-strand
synthesis was performed at 42 °C for 1 h, followed by 94 °C
for 10 min for enzyme inactivation. PCR was then carried out using
primers designed from mouse MG lipase cDNA (26) as follows:
5'-66GGTCA ATGCA GACGG ACAGT ACCTC TTTTG95-3'
and 5'-861GTTTA CTTCA TGGAG GACGG AGTTG
GTCAC832-3'. Ten µl of the first-strand mix was then
added to 100 µl of PCR buffer containing 10 µl of 10× buffer, 2 µl of 10 mM dNTP, 1 µl of 100 µM MG
lipase primers, 0.5 µl of 100 mM MgSO4, and 2 µl of Vent polymerase from New England Biolabs Inc. After the initiation incubation of 2 min at 94 °C, 40 cycles of PCR consisting of 1 min at 94 °C, 1 min at 65 °C, and 2 min at 72 °C were
performed. PCR was completed with a final 10 min at 72 °C. Amplified
DNA was separated through a 1% agarose gel and visualized by ethidium bromide staining. The size of the amplified fragment (800 bp) corresponded to an amplification of cDNA rather than genomic DNA. RT-PCR for human L-FABP served as a positive control for
Caco-2 RNA and was performed using the following primers:
5'-29GCAAG TACCA ACTGC AGAGC CAGGA AAAGT58-3'
and 5'-389TTGCT GATTC TCTTG AAGAC AATGT
CACCC360-3', for an expected size of 400 bp. cDNA Cloning of Human MG Lipase--
Total RNA were prepared
from Caco-2 cells grown in 75-cm2 flasks at day 18 after
confluence, and was extracted using the SV total RNA isolation kit from
Promega. First-strand DNA synthesis was done using the
oligo(dT)18 primer from Invitrogen and AMV transcriptase
from Promega. cDNA first-strand synthesis was performed at 42 °C
for 1 h, followed by 94 °C for 10 min for enzyme inactivation. PCR was then carried out using primers designed from the human lysophospholipase homolog (27) as follows:
5'-130GAATGCAAACGCCAGCACATAATG153-3' and
5'-1170AGAGATGGCTTCTCAGATATGGCT1147-3'. Ten
µl of the first-strand mix was then added to 100 µl of PCR reaction
containing 10 µl of 10× buffer, 2 µl of 10 mM dNTP, 1 µl of 100 µM MG lipase primers, 0.5 µl of 100 mM MgSO4, and 2 µl of Vent polymerase from
New England Biolabs Inc. After the initiation incubation of 2 min at
94 °C, 30 cycles of PCR consisting of 1 min at 94 °C, 1 min at
60 °C, and 2 min at 72 °C were performed. PCR was completed with
a final 10 min at 72 °C. Amplified DNA was separated through a 1%
agarose gel and visualized by ethidium bromide staining. The amplified
fragment (1000 bp) was then purified using Qiagen gel extraction kit.
The purified cDNA was used as template to perform PCR reaction as
per above conditions, then the freshly made PCR product was cloned into
Invitrogen's PCR-Blunt II-TOPO vector. The vector was then transformed
into TOP 10 cells and plasmid DNA was purified by Qiagen Miniprep kit.
Sequencing of the insert confirmed that it was human lysophospholipase
homolog (GI1763010) (27).
Northern Blot Analysis for MG Lipase Expression--
Caco-2
cells were collected at various times from 0 to 16 days after
confluence. A Sprague-Dawley rat small intestine was collected, and
adipose tissue was also obtained to serve as a positive control. Total
RNA was extracted by guanidinium thiocyanate extraction. Cells and
tissues were homogenized on ice using a high speed Tekmar Tissuemizer
(Tekmar, Inc., Cincinnati, OH). 20 µg of total RNA was loaded onto
1% agarose gels; the RNA was transferred overnight onto GeneScreen
Plus hybridization transfer membranes (PerkinElmer Life Sciences). The
1000-base pair MGL sequence cloned from human Caco-2 cell cDNA was
used as probe, and was labeled with 32P using the Random
Primers DNA labeling system (Invitrogen). Labeled probe was purified
using ProbeQuant G-50 microcolumns (Amersham Biosciences, Inc.). Blots
were pre-hybridized and hybridized using Express-Hyb hybridization
solution (CLONTECH, Palo Alto CA) in a
hybridization oven with rolling motion. Pre-hybridization was for 30 min at 68 °C; hybridization with MGL probe was performed for 1 h at 68 °C. Blots were rinsed once at room temperature with 2× SSC,
0.1% SDS and washed once for 10 min at 42 °C. This was followed by
two washes with 0.1 SSC, 0.1% SDS for 10 min at 60 °C. The gene
screen was exposed to Kodak Intensifying Screen (Eastman Kodak Co.) for
2 days and developed and analyzed using the PhosphorImager Storm 840 (Molecular Dynamics, Piscataway, NJ). Equal loading of all lanes was
verified using the 18 S RNA.
Statistical Analysis--
Within each experiment, triplicate
samples were analyzed. Each separate experiment was performed at least
three times, and results are expressed as the mean ± standard
deviation (S.D.). A three-way repeated-measures analysis of variance
was used to determine whether differences existed among groups for each
time point of each substrate for each incubation. If the effect of any
combination was significant, a multiple comparison procedure was
conducted by using the Student-Newman-Keuls range test to determine
whether a significant difference occurred. These procedures were
carried out using the SAS program. Results were considered statistically significant at p < 0.05.
Net Uptake of [3H]sn-2-Monoolein,
3H-Oleic acid, and 3H-Palmitic Acid by Caco-2
Cells--
Uptake studies were performed using similar concentrations
of unbound lipids at the AP and BL surfaces, determined as previously described (3). The net uptake of 3H-labeled MG,
sn-2-18:1, from AP (both TC-mixed and BSA-bound) and BL
(BSA-bound) surfaces of Caco-2 cells is shown in Fig.
1. The net uptake of lipids was greatest
from TC-mixed 3H-lipids at the AP surface. A comparison of
BSA-bound lipids shows that net uptake was consistently higher at the
AP surface than at the BL surface. Uptake of TC-mixed LCFA was greater
than TC-mixed MG, with the highest net uptake observed for TC-mixed
18:1. For BSA-bound lipids, in contrast, 16:0 showed higher net uptake
than 18:1. BSA-bound sn-2-18:1 has the lowest net uptake at
both AP and BL surfaces. As expected, the net uptake of all lipids
increased with time of incubation.
Incorporation of MG and LCFA into Cellular Lipids--
Caco-2
monolayers were incubated with 2 mM 3H-labeled
lipid complexed with 10 mM TC at the AP surface. The
unbound concentrations of radiolabeled sn-2-monoolein, oleic
acid, and palmitic acid were determined as described under
"Experimental Procedures" and were 0.22, 0.12 and 0.09 µM, respectively. Caco-2 monolayers grown on
polycarbonate filters were also incubated with 30 µM
3H-labeled lipids bound to 100 µM BSA at
either the AP or the BL surfaces. Unbound concentrations of
sn-2-18:1, 18:1, and 16:0 calculated from respective
Kd values (6, 23) were 0.09, 0.02, and 0.01 µM. The incorporation into each lipid category was
determined, and results are expressed as the percentage of total lipid
extract 3H-labeled substrate incorporated into each lipid class.
Table I shows the incorporation of
[3H]sn-2-18:1 into cellular lipid classes by
Caco-2 monolayers. Apical incubation with TC-mixed
[3H]sn-2-18:1 resulted in a high level of
incorporation into the TG fraction with 37 ± 3, 57 ± 8, and
73 ± 8% incorporated into TG at 2, 6, and 24 h,
respectively. The corresponding TG:PL ratios, shown in Fig.
2A, were 2.10 ± 0.54, 5.98 ± 2.89, and 8.70 ± 2.82. In contrast, basolateral
incubations with BSA-bound [3H]sn-2-18:1
resulted in greater labeling of the PL fractions, with resultant far
lower TG:PL ratios of 0.52 ± 0.17, 1.21 ± 0.29, and
2.85 ± 1.13 at 2, 6, and 24 h, respectively (Fig.
2A). Absolute levels of TG incorporation from AP TC-mixed
[3H]sn-2-18:1 were significantly higher than
that of BL BSA-bound [3H]sn-2-18:1 at all
time points (p < 0.05), whereas AP TC-mixed [3H]sn-2-18:1 had significantly lower PL
incorporation than those of BL BSA-bound
[3H]sn-2-18:1 at all time points
(p < 0.05). To compare AP and BL incubations using the
same vehicle for substrate presentation, the AP absorption of
sn-2-18:1 from a BSA solution was also examined. Similar
results were observed, with the apical TG:PL ratios higher than
basolateral incubations at 2 and 6 h; however, the magnitude of
the AP-BL differences were not as dramatic as those observed when the
physiologically relevant substrate solutions were used. For apical
incubation of BSA-bound [3H]sn-2-18:1, TG
incorporation was increased over time whereas PL incorporation remained
unchanged; thus, the TG:PL ratios at 2 and 6 h were intermediate
between AP TC and BL BSA uptakes (Fig. 2A).
Table II shows the incorporation of
[3H]18:1 by Caco-2 monolayers. Incorporation of TG tended
to increase with time, whereas incorporation into PL tended to decrease
with time of incubation. The fractional incorporation into TG was
consistently greater for apical TC incubation, and the incorporation
into PL was greater for BL BSA incubation, Thus, as was observed for
MG, the TG:PL ratio was greater for AP TC-mixed [3H]18:1
incubation compared with BSA-bound [3H]18:1 incubation at
all time points (Fig. 2B). Nevertheless, the extent of
metabolic polarity was not as large as that observed for AP
versus BL incubations of MG. Moreover, comparison of AP and
BL BSA-18:1 solutions showed a higher TG:PL ratio at 2 h but, by
24 h, the difference was, if any, reversed.
We also examined the metabolic fate of [3H]16:0. In
agreement with our previous results (3), a higher TG:PL ratio was found for AP BSA relative to BL BSA incubations at 2 and 6 h of
incubation, with no difference at 24 h. For AP TC incubations, the
relative TG incorporation was also greater compared with the BL BSA
incubations (Table III).
sn-2-18:1 has significantly higher TG % incorporation
(p < 0.05) and significantly lower PL% incorporation
(p < 0.05) than 16:0 at all time points, whereas
sn-2-18:1 had no difference in TG % incorporation compared
with 18:1 at all time points, and no difference in PL % incorporation
compared with 18:1 at 6 and 24 h of incubation (Table I-III).
Thus, the TG:PL ratio increased with time for both
sn-2-monoolein and oleic acid, whereas it remained unchanged
for palmitic acid. The TG:PL ratios are generally highest for
sn-2-monooelin (Fig. 2, A-C). Oleic acid had a
very similar TG:PL profile relative to sn-2-monoolein. In
contrast, TG:PL ratios are close to or below 1.00 at all time points
for both AP TC-mixed and BSA-bound [3H]16:0 at both
sides, indicating that the palmitic acid substrate is more evenly
distributed between TG and PL synthesis (Table III and Fig.
2C).
We further observed that radiolabel from sn-2-18:1 was
recovered in the FFA fraction for all treatments and incubation times (Table I), at ~10-20% of total lipid incorporation. That this was a
cell-mediated phenomenon was confirmed by control cell-free incubations, after which no substrate hydrolysis was detected (data not
shown). This result suggested that sn-2-18:1 may be hydrolyzed within the Caco-2 cell, or that the
[3H]sn-2-18:1 was esterified into DG or TG
and then subsequently hydrolyzed to yield [3H]18:1.
Detection of MG Lipase mRNA by RT-PCR--
3H
activity of sn-2-monoolein was recovered in the FFA
fraction, as noted above, indicating that sn-2-18:1 may be
hydrolyzed within the Caco-2 cells. We therefore hypothesized that a MG
lipase activity may be a candidate to hydrolyze MG into FFA and
glycerol within Caco-2. Recently, a MG lipase was cloned from a mouse
adipocyte cDNA library (26). We used RT-PCR (nonquantitative) to
detect the presence of MG lipase mRNA, as described under
"Experimental Procedures." The results showed that a single 800-bp
band, corresponding to MG lipase, was expressed in Caco-2 cells at days
7, 14, and 21 after confluence. No bands were detected in the day 0 and
rat jejunum samples; however, it is likely that amplification for these
samples was insufficient, as seen for cDNA Cloning and Northern Blot Analysis of Human MGL--
The
human MGL gene was cloned from day 18 Caco-2 cell RNA as described
above. The nucleotide sequence obtained for the 1000-bp clone was 83%
identical to the murine MG lipase gene (26), and identical to the human
lysophospholipase homologue (27). Fig. 4 shows a Northern blot of
Caco-2 mRNA from cells at day 0 (confluence) through day 16, and
from small intestine. Rat adipose tissue mRNA served as a positive
control, and the expected 4-kb mRNA (26) was observed. The results
demonstrate that the MGL gene is expressed at low levels at day 0 and
increases ~2.5-fold over the course of Caco-2 differentiation.
Moreover, detectable levels of MGL are observed in small intestine.
Western Blot for Human PTL--
Tsujita et al. (28) and
Mahan et al. (29) have reported that PTL is expressed in the
absorptive cells of the rat intestine. Because PTL may, therefore,
represent an alternative mechanism whereby exogenous MG could be
metabolized independent of the MGAT pathway, the expression of human
PTL in Caco-2 was analyzed by Western blot to determine whether these
cells express a protein immunoreactive to a polyclonal anti-human PTL
antibody. Fig. 5 shows that this antibody does react with purified
human PTL with molecular mass of 49 kDa. However, Caco-2 homogenates as
well as rat jejunal mucosa homogenates showed no detectable level of human PTL. The expression of L-FABP and I-FABP from the
same homogenates served as positive controls (Fig.
5).
FFA and sn-2-MG are the products of pancreatic TG
lipase hydrolysis of dietary TG in the lumen of the small intestine.
FFA metabolism in the enterocyte has been intensively studied (12, 17,
30, 31); however, far less is known about sn-2-MG
metabolism. In the present study, the metabolism of exogenous
sn-2-monoolein, oleic acid, and palmitic acid were examined
in the human intestinal Caco-2 cell. Culture on permeable filters
allowed for a comparison of AP and BL presentation of lipid substrates
(32, 33).
Apical net uptake of both TC-mixed lipids and BSA-bound MG and FFA was
found to be higher than BL BSA-bound lipid uptake, under conditions of
equal unbound lipid concentration (3). This may be related to several
factors, including, perhaps, differences in the plasma membrane
composition between the AP and BL domains of the enterocytes (34), such
as differences in intramembranous protein levels, phospholipid fatty
acyl chain unsaturation, cholesterol:PL ratios, and membrane lipid
fluidity (34, 35). The presence and distribution of putative
transmembrane transporters might also play a role in the greater AP
uptake. Previous results showed that the increased AP relative to BL
uptake of FFA is not simply because of greater AP plasma membrane
surface area in Caco-2, but is, rather, likely to reflect
enterocyte-specific FFA transport and metabolism (12).
For similar unbound concentrations, the net uptake of TC-mixed lipids
was substantially greater than that of BSA-bound lipids, in agreement
with previous reports. For example, Ranheim et al. (31) have
reported that oleic acid and eicosapentaenoic acid (20:5(n-3)) in TC micellar solution were absorbed more
efficiently into Caco-2 cells than when bound to BSA. Levin et
al. (30) reported similar effects for TC-mixed versus
BSA-bound oleic acid in Caco-2 cells. It is generally accepted that
micellar solubilization increases uptake of LCFA by increasing their
aqueous concentration gradients across the unstirred water layer (1).
We were concerned, however, that, because bile salts act as detergents
when the concentration exceeds the critical micellar concentration,
they may have deleterious effects on cell membranes and/or
intercellular tight junctions. We therefore measured the TER of Caco-2
monolayers after incubation with 10 mM TC for 24 h,
and the results showed that the TER of the monolayers remained above
250 ohms × cm2, indicating that tight junctions were
intact (3). Furthermore, the initial rates of uptake of LCFA with or
without preincubation with 10 mM TC were identical (3).
Additionally, others have reported no cell loss and minimal leakage
(<1.5%), as determined by a low molecule weight probe, after 5 h
of incubation with 12 mM TC micellar solution in Caco-2
(31). Thus, the dramatic increase in net uptake from 10 mM
TC micellar solutions relative to BSA solutions is not likely due to
the damage of cell membranes by TC, but rather is presumably
representative of physiologically relevant differences secondary to
substrate presentation.
In the present study, AP TC-mixed sn-2-18:1 was metabolized
differently from BL BSA-bound sn-2-18:1 at all time points
examined. TG was the primary metabolite of AP TC-mixed
sn-2-18:1, whereas PL was the major metabolite of BL
BSA-bound sn-2-18:1. Using human jejunal biopsy samples,
Gangl and Renner (11) showed that plasma FFA were preferentially
incorporated into PL or oxidized. Although we found little or no
oxidation, in agreement with previous results for Caco-2 (3), the
present study also showed that radioactivities from BL incubated FFA
were primarily incorporated into the PL fraction.
The basic mechanisms underlying the cellular polarity of enterocyte
lipid metabolism are not known, but several may be envisioned. As
mentioned earlier, the small intestine can synthesize TG via both the
G3P and the CoA-dependent MG pathways of acylglycerol synthesis (7, 8). The final reaction in both MG and G3P pathways is the
conversion of DG to TG via DGAT (7). It is not yet clear whether the
DGAT activities in the MG pathway and G3P pathway are distinct, nor
whether intestinal DGAT might be involved in the metabolic
compartmentation of AP and BL lipids. Interestingly, Owens et
al. (36) reported the presence of two pools of DGAT in liver
microsomes, cytosol-facing and "latent" (ER lumen), and a second
DGAT gene has, in fact, recently been described (10).
Compartmentation of FFA and MG metabolism may also be related to the
presence of multiple acyl-coenzyme A synthetase (ACS) genes. ACS5 is
highly expressed in the small intestine (37), and ACS1, with widespread
tissue distribution, is also found (38). ACS5 is thought to be involved
in PL synthesis and FFA Palmitic acid was not as efficiently incorporated into the TG fraction
relative to PL as was oleic acid, resulting in a lower TG:PL ratio for
palmitic acid. This is in agreement with previous studies, which also
demonstrated lower incorporation of 16:0 into TG (2, 12). The
significantly higher PL synthesis relative to TG formation for 16:0 may
reflect known differences in the intestinal incorporation of saturated
FFA relative to unsaturated FFA. It has been reported that saturated
FFA esterification was significantly less rapid than unsaturated FFA
(linoleic acid) esterification by rat intestinal mucosa (41). In
addition, van Greevenbroek et al. (42) have shown that
saturated palmitic acid was not efficiently incorporated into TG
compared with unsaturated linoleic acid in Caco-2 cells.
The intracellular metabolism of MG showed consistent compartmentation
into FFA. One possible mechanism is that some of the MG that is
esterified into TG is then hydrolyzed to FFA. We have shown previously
that MGAT activity is present in Caco-2, albeit at a lower level than
in rat jejunum (16). Presumably, the incorporation of labeled MG into
TG is proceeding via the MGAT pathway. Recently, however, another
potential mechanism for intestinal TG formation was proposed. Tsujita
et al. suggested that PTL may facilitate a CoA-independent
pathway of DG synthesis from MG and FFA in rat intestinal mucosa, by
showing that a CoA-independent MGAT activity was inhibited
up to 65% by addition of the antibodies against PTL (28). In the
present studies, we were unable to detect a protein immunoreactive to
polyclonal anti-human PTL antibodies either in Caco-2 cells or in rat
jejunal mucosa homogenates. The reason for these discrepant results are
not clear; however, others have also not found PTL in
intestine.2
Another mechanism by which 3H activity of
sn-2-MG could appear in the TG as well as the FFA fractions
would be via its hydrolysis and subsequent re-esterification within the
Caco-2 cell. Yang and Kuksis (43) have shown that hydrolysis of
G3P-derived TG and resynthesis into TG via the
CoA-dependent MG pathway does appear to occur, possibly by
a lysosomal acid lipase, accounting for ~15% of total CM-TG
collected from rats. In addition, an alkaline lipase activity was found
in the rat intestinal mucosa, with optimal activity using a radioactive
triolein emulsion, requiring both Ca2+ and TC (44).
Further, it has been reported that Caco-2 cells possess an endogenous
lipase activity that is capable of hydrolyzing intracellular TG, and
this lipase activity was shown not to be LPL (45). Thus, it is possible
that these lipase activities, if present in the enterocyte, could also,
perhaps, hydrolyze MG. A MG hydrolytic activity (EC 3.1.1.23) was, in
fact, partially purified from isolated rat small intestinal epithelial
cells by De Jong et al. in 1978 (46); however, no further
reports have appeared. Recently, a MG lipase was cloned from a mouse
adipocyte cDNA library (26). Using oligonucleotides primers
designed from the mouse MG lipase sequence, we found that Caco-2 cells
express MG lipase. Cloning of the human MG lipase gene from day 18 Caco-2 cells showed that it is 83% identical to the murine gene (26), and identical to the previously designated but as yet uncharacterized lysophospholipase homologue (27).
Northern analysis indicates that the MGL gene is expressed early during
Caco-2 differentiation, and increases to a modest extent as cells
develop the enterocyte-like phenotype. The results show that MGL is
expressed at low levels in adult rat intestine, and preliminary data
indicate that higher levels of expression are present during prenatal
and early postnatal age (data not shown). Caco-2 cells still possesses
some characteristics similar to fetal cells or crypt cells of the colon
(47), and our previous studies of lipid metabolism during Caco-2
differentiation also suggest that the differentiated phenotype in
Caco-2 may be representative of early stages in the enterocyte
developmental program (16). It is not known, at present, whether the MG
lipase activity reported by De Jong et al (46) comes solely
from the MGL gene presently detected, or whether more than one
intestinal lipolytic activity for monoacylglycerols may be present. The
presence of MGL expression in Caco-2 cells offers the opportunity to
examine the functional role of MG hydrolysis in the enterocyte, and the
potential for coordinate and, perhaps, inverse regulation of MG
hydrolysis via MGL, and MG anabolism via monoacylglycrerol acyltransferase.
*
This work was supported by Grant DK38389 from the National
Institutes of Health (to J. S.) and by state funds.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Current address: Dept. of Microbiology and Immunology, Kimmel
Cancer Center, Thomas Jefferson University, Philadelphia, PA 19107.
¶
To whom correspondence should be addressed: Dept. of
Nutritional Sciences, Rutgers University, 96 Lipman Dr., New Brunswick, NJ 08901-8525. Fax: 732-932-6837; E-mail:
storch@aesop.rutgers.edu.
Published, JBC Papers in Press, October 26, 2001, DOI 10.1074/jbc.M108027200
2
M. Lowe, personal communication.
The abbreviations used are:
MG, monoacylglycerol;
FFA, unesterified free fatty acid;
DG, diacylglycerol;
TG, triacylglycerol;
PL, phospholipid;
TC, taurocholate;
BSA, bovine serum albumin;
G3P, glycerol 3-phosphate;
MGAT, monoacylglycerol acyltransferase;
DGAT, diacylglycerol
acyltransferase;
AP, apical;
BL, basolateral;
sn-2-18:1, sn-2-monoolein;
18:1, oleic acid;
16:0, palmitic acid;
L-FABP, liver fatty acid-binding protein;
I-FABP, intestinal fatty
acid-binding protein;
ACS, acyl-coenzyme A synthetase;
MGL, monoacylglycerol lipase;
CM, chylomicron;
PTL, pancreatic
triacylglycerol lipase;
ER, endoplasmic reticulum;
LPL, lipoprotein
lipase;
DMEM, Dulbecco's modified Eagle's medium;
LCFA, long-chain
fatty acid;
TER, transepithelial resistance;
TLC, thin layer
chromatography;
RT, reverse transcriptase;
PVDF, polyvinylidene
difluoride;
AMV, avian myeloblastosis virus;
PBS, phosphate-buffered
saline.
Monoacylglycerol Metabolism in Human Intestinal Caco-2 Cells
EVIDENCE FOR METABOLIC COMPARTMENTATION AND
HYDROLYSIS*
§,, and¶
Department of Nutritional Sciences, Rutgers
University, New Brunswick, New Jersey 08901-8525
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-actin primers, and AMV reverse transcriptase were
obtained from Promega (Madison, WI). Oligonucleotide primers were made
by Genosys (Woodlands, TX). Vent polymerase was purchased from New
England Biolabs Inc. (Beverly, MA). QIAquick Gel extraction kits and
QIAprep Spin Miniprep kits were obtained from Qiagen Inc. (Santa
Clarita, CA). Zero Blunt II-TOPO PCR cloning vector was from Invitrogen
(Carlsbad, CA). Purified human pancreatic TG lipase (PTL) and
polyclonal antibodies against human pancreatic TG lipase were generous
gifts of Dr. M. Lowe (Washington University, St. Louis, MO). Polyclonal
antibodies against human L- and I-FABP were kindly provided
by Dr. J. Veerkamp (University of Nijmegen, Nijmegen, The Netherlands).
104/cm2 in
75-cm2 flasks, and split with 0.25% trypsin, 1 mM EDTA when they reached 70-90% confluence (12, 17). For
experiments, cells were plated at a density of 3 × 105/cm2 onto 24-mm polycarbonate Transwell
filter inserts with 0.4-µm pores (Costar Corp.). Cells were grown to
14-18 days post-confluence. Transepithelial resistance (TER)
measurements were made to ensure tight junction formation, and the
monolayers were used for the experiments only when TER was >250
ohms × cm2 (12).
20 °C.
-Actin
primers (expected size of 300 bp) obtained from Promega were also used
to ensure the quality of isolated RNA.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (31K):
[in a new window]
Fig. 1.
Net uptake of 3H-lipids by Caco-2
monolayers. A, sn-2-monoolein; B,
oleic acid; C, palmitic acid. Monolayers were incubated with
30 µM 3H-lipids complexed to 100 µM BSA in either the AP (open bar)
or BL (slashed bar) compartment, or with 2 mM 3H-lipids complexed to 10 mM TC
in AP (cross-hatched bar) compartment. Data shown
are a representative experiment from four separate experiments. Results
are represent the mean ± S.D. for three filters.
Incorporation of [3H]sn-2-monoolein by Caco-2 monolayers
View larger version (23K):
[in a new window]
Fig. 2.
TG:PL ratio for
[3H]sn-2-monooein (A)
oleic acid (B), and palmitic acid
(C). Caco-2 monolayers were incubated with 2 mM lipids complexed with 10 mM TC at the apical
surface (TC, AP)
(cross-hatched bar), or 30 µM lipids with 100 µM BSA at either at the
AP (BSA, AP) (open bar) or
at the BL surface (BSA, BL) (slashed
bar). Lipids were extracted from the cell sonicates, and
metabolites were analyzed as described under "Experimental
Procedures." Data represent the mean ± S.D. from three
experiments. b, p < 0.05 versus
TC(AP); c, p < 0.05 versus
BSA(BL).
Incorporation of [3H]oleate by Caco-2 monolayers
Incorporation of [3H]palmitate by Caco-2 monolayers
-actin (Fig.
3), as the Northern blot results below
indicate that MGL is expressed throughout Caco-2 differentiation and at
low levels in adult rat small intestine (Fig.
4).
View larger version (35K):
[in a new window]
Fig. 3.
RT-PCR to detect gene expression of MG
lipase. MG lipase mRNA was evaluated by RT-PCR as
described under "Experimental Procedures." Lane 1,
Caco-2 cells, day 0 (confluence); lane 2, Caco-2 cells, day
7 after confluence; lane 3, Caco-2 cells, day 14; lane
4, Caco-2 cells, day 21; lane 5, rat jejunal mucosa;
lane 6, rat adipose tissue. The band for MG lipase is 800 bp. The positive controls are human L-FABP (400 bp) and
-actin (300 bp).
View larger version (44K):
[in a new window]
Fig. 4.
Northern blots for human monoacylglycerol
lipase in Caco-2 cells. 20 µg of total RNA was loaded in each
lane. The 1000-bp MGL sequence cloned from Caco-2 intestinal cell
cDNA, as described under "Experimental Procedures," was used as
the probe. Lanes 1-6, Caco-2 cells days 0, 2, 4, 8, 12, and
16 after confluence; lane 7, rat intestine; lane
8, rat adipose tissue.
View larger version (44K):
[in a new window]
Fig. 5.
Immunoblots for human PTL, L-FABP, and I-FABP
in Caco-2 cells. Proteins were separated by 10% SDS-PAGE,
electrophoretically blotted to PVDF membrane, and reacted with
anti-human antibodies against pancreatic TG lipase (A),
L-FABP (B), and I-FABP (C) as
described under "Experimental Procedures." A, pancreatic
TG lipase. Lanes 1, 4, and 7, purified
human pancreatic TG lipase (3.5, 1.4, and 0.7 µg, respectively);
lanes 2, 3, and 5, 200 µg of Caco-2
homogenate protein (day 2, 14, and 7 after confluence, respectively);
lane 6, 200 µg of rat jejunal mucosa homogenate protein.
B, L-FABP. Lane 1, purified human
I-FABP, 0.2 µg; lanes 2-4, purified human
L-FABP (0.4, 0.2, and 0.1 µg, respectively); lanes
5-8, 100 µg of Caco-2 homogenate protein (day 21, 14, 7, and 0 after confluence, respectively. C, I-FABP. Lanes
1 and 2, purified human I-FABP (0.1 and 0.2 µg,
respectively); lane 3, purified human L-FABP,
0.2 µg; lanes 4-7, 100 µg of Caco-2 homogenate protein
(day 0, 7, 14, and 21 after confluence, respectively).
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-oxidation, and ACS-1 may be linked to TG
synthesis (37). Thus, the ACSs could play a role in partitioning of FFA
between anabolic and catabolic pathways. It has also been shown that
the MG pathway is primarily associated with smooth ER, and this is the
main site of chylomicron assembly (9), whereas the G3P pathway is
localized to the rough ER (39), affording another possible origin of
metabolic polarity of FFA and MG. Finally, one must also consider the
simultaneous expression of I-FABP and L-FABP within the
enterocyte as a potential source of metabolic compartmentation for
their ligands, particularly as they are now thought to be involved in
ligand targeting (40).
FOOTNOTES
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Thomson, A. B. R.,
Schoeller, C.,
Keelan, M.,
Smith, L. C.,
and Clandinin, M. T.
(1993)
Can. J. Physiol. Pharmacol.
71,
531-555
2.
Gangl, A.,
and Ockner, R. K.
(1975)
J. Clin. Invest.
55,
803-813
3.
Ho, S. Y.,
and Storch, J.
(2001)
Am. J. Physiol.
281,
C1106-C1117
4.
Fielding, B. A.,
Humphreys, S. M.,
Allman, R. F.,
and Frayn, K. N.
(1993)
Clin. Chim. Acta
216,
167-173
5.
El Maghrabi, M. R.,
Waite, M.,
Rudel, L. L.,
and Sisson, P.
(1978)
J. Biol. Chem.
253,
974-981
6.
Thumser, A. E. A.,
Buckland, A. G.,
and Wilton, D. C.
(1998)
J. Lipid Res.
39,
1033-1038
7.
Tso, P.,
and Crissinger, K.
(2000)
in
Biochemical and Physiological Aspects of Human Nutrition
(Stipanuk, M. H., ed)
, pp. 125-141, W. B. Saunders Co., Philadelphia
8.
Brindley, D. N.
(1974)
in
Biomembranes
(Smyth, D. H., ed)
, pp. 621-671, Plenum Publishing Co., London
9.
Lehner, R.,
and Kuksis, A.
(1995)
J. Biol. Chem.
270,
13630-13636
10.
Cases, S.,
Stone, S.,
Zhou, P.,
Yen, E.,
Tow, B.,
Lardizabal, K. D.,
Voelker, T.,
and Farese, R. V., Jr.
(2001)
J. Biol. Chem.
276,
38870-38876
11.
Gangl, A.,
and Renner, F.
(1978)
Gastroenterology
74,
847-850
12.
Trotter, P. J.,
and Storch, J.
(1991)
J. Lipid Res.
32,
293-304
13.
Darimont, C.,
Gradoux, N.,
Cumin, F.,
Baum, H. P.,
and De Pover, A.
(1998)
Exp. Cell Res.
244,
441-447
14.
Traber, M. G.,
Kayden, H. J.,
and Rindler, M. J.
(1987)
J. Lipid Res.
28,
1350-1363
15.
Le Beyec, J.,
Delers, F.,
Jourdant, F.,
Schreider, C.,
Chambaz, J.,
Cardot, P.,
and Pincon-Raymond, M.
(1997)
Exp. Cell Res.
236,
311-320
16.
Trotter, P. J.,
and Storch, J.
(1993)
J. Biol. Chem.
268,
10017-10023
17.
Trotter, P. J., Ho, S. Y.,
and Storch, J.
(1996)
J. Lipid Res.
37,
336-346
18.
Mattson, F. H.,
and Volpenheim, R. A.
(1962)
J. Lipid Res.
3,
281-296
19.
Dakka, T.,
Dumoulin, V.,
Chayvialle, J. A.,
and Cuber, J. C.
(1994)
Endocrinology
134,
603-607
20.
Berk, P. D.,
and Stump, D. D.
(1999)
Mol. Cell Biochem.
192,
17-31
21.
Richieri, G. V.,
Ogata, R. T.,
and Kleinfeld, A. M.
(1994)
J. Biol. Chem.
269,
23918-23930
22.
Schulthess, G.,
Lipka, G.,
Compassi, S.,
Boffelli, D.,
Weber, F. E.,
Paltauf, F.,
and Hauser, H.
(1994)
Biochemistry
33,
4500-4508
23.
Spector, A. A.,
Fletcher, J. E.,
and Ashbrook, J. D.
(1971)
Biochemistry
10,
3229-3232
24.
Bligh, E. G.,
and Dyer, W. J.
(1959)
Can. J. Biochem. Physiol.
37,
911-917
25.
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254
26.
Karlsson, M.,
Contreras, J. A.,
Hellman, U.,
Tornqvist, H.,
and Holm, C.
(1997)
J. Biol. Chem.
272,
27218-27223
27.
Wall, E. M.,
Cao, J. X.,
Chen, N.,
Buller, M. L.,
and Upton, C.
(1997)
Virus Res.
52,
157-167
28.
Tsujita, T.,
Miyazaki, T.,
Tabei, R.,
and Okuda, H.
(1996)
J. Biol. Chem.
271,
2156-2161
29.
Mahan, J. T.,
Heda, G. D.,
Rao, R. H.,
and Mansbach, C. M.
(2001)
Am. J. Physiol.
280,
G1187-G1196
30.
Levin, M. S.,
Talkad, V. D.,
Gordon, J. I.,
and Stenson, W. F.
(1992)
J. Lipid Res.
33,
9-19
31.
Ranheim, T.,
Gedde-Dahl, A.,
Rustan, A. C.,
and Drevon, C. A.
(1994)
Biochim. Biophys. Acta
1212,
295-304
32.
Moberly, J. B.,
Cole, T. G.,
Alpers, D. H.,
and Schonfeld, G.
(1990)
Biochim. Biophys. Acta
1042,
70-80
33.
Field, F. J.,
Albright, A.,
and Mathur, S. N.
(1988)
J. Lipid Res.
29,
1427-1437
34.
Brasitus, T. A.,
and Schachter, D.
(1980)
Biochemistry
19,
2763-2769
35.
Brasitus, T. A.,
and Schachter, D.
(1984)
Biochim. Biophys. Acta
774,
138-146
36.
Owen, M. R.,
Corstorphine, C. C.,
and Zammit, V. A.
(1997)
Biochem. J.
323,
17-21
37.
Oikawa, E.,
Iijima, H.,
Suzuki, T.,
Sasano, H.,
Sato, H.,
Kamataki, A.,
Nagura, H.,
Kang, M. J.,
Fujino, T.,
Suzuki, H.,
and Yamamoto, T. T.
(1998)
J. Biochem. (Tokyo)
124,
679-685
38.
Lewin, T. M.,
Kim, J. H.,
Granger, D. A.,
Vance, J. E.,
and Coleman, R. A.
(2001)
J. Biol. Chem.
276,
24674-24679
39.
Lamb, R. G.,
Gardner, T. G.,
and Fallon, H. J.
(1980)
Biochim. Biophys. Acta
619,
385-395
40.
Glatz, J. F. C.,
and Storch, J.
(2001)
Curr. Opin. Lipidol.
12,
267-274
41.
Ockner, R. K.,
Pittman, J. P.,
and Yager, J. L.
(1972)
Gastroenterology
62,
981-992
42.
van Greevenbroek, M. M. J.,
Voorhout, W. F.,
Erkelens, D. W.,
van Meer, G.,
and de Briun, T. W. A.
(1995)
J. Lipid Res.
36,
13-24
43.
Yang, L. Y.,
and Kuksis, A.
(1991)
J. Lipid Res.
32,
1173-1186
44.
Rao, R. H.,
and Mansbach, C. M.
(1993)
Arch. Biochem. Biophys.
304,
483-489
45.
Spalinger, J. H.,
Seidman, E. G.,
Menard, D.,
and Levy, E.
(1998)
Biochim. Biophys. Acta
1393,
119-127
46.
De Jong, B. J.,
Kalkman, C.,
and Hulsmann, W. C.
(1978)
Biochim. Biophys. Acta
530,
56-66
47.
Pinto, M.,
Robine-Leon, S.,
Appay, M. D.,
Kedinger, M.,
Triadou, N.,
Dussaulx, E.,
Lacroix, B.,
Simon, A. P.,
Haffen, K.,
Fogh, J.,
and Zweibaum, A.
(1983)
Biol. Cell
47,
323-330
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. Duncan, A. D. Thomas, N. L. Cluny, A. Patel, K. D. Patel, B. Lutz, D. Piomelli, S. P. H. Alexander, and K. A. Sharkey Distribution and function of monoacylglycerol lipase in the gastrointestinal tract Am J Physiol Gastrointest Liver Physiol, December 1, 2008; 295(6): G1255 - G1265. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Storch, Y. X. Zhou, and W. S. Lagakos Metabolism of apical versus basolateral sn-2-monoacylglycerol and fatty acids in rodent small intestine J. Lipid Res., August 1, 2008; 49(8): 1762 - 1769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-H. Chon, Y. X. Zhou, J. L. Dixon, and J. Storch Intestinal Monoacylglycerol Metabolism: DEVELOPMENTAL AND NUTRITIONAL REGULATION OF MONOACYLGLYCEROL LIPASE AND MONOACYLGLYCEROL ACYLTRANSFERASE J. Biol. Chem., November 16, 2007; 282(46): 33346 - 33357. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wang, S. K. Dey, and M. Maccarrone Jekyll and Hyde: Two Faces of Cannabinoid Signaling in Male and Female Fertility Endocr. Rev., August 1, 2006; 27(5): 427 - 448. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Murota and J. Storch Uptake of Micellar Long-Chain Fatty Acid and sn-2-Monoacylglycerol into Human Intestinal Caco-2 Cells Exhibits Characteristics of Protein-Mediated Transport J. Nutr., July 1, 2005; 135(7): 1626 - 1630. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |