Originally published In Press as doi:10.1074/jbc.M203925200 on May 28, 2002
J. Biol. Chem., Vol. 277, Issue 31, 28280-28286, August 2, 2002
An Extracellular Matrix-localized Metalloproteinase with an
Exceptional QEXXH Metal Binding Site Prefers Copper for
Catalytic Activity*
Markus
Heitzer and
Armin
Hallmann
From the Lehrstuhl Biochemie I, Universität
Regensburg, D-93053 Regensburg, Germany
Received for publication, April 23, 2002, and in revised form, May 19, 2002
 |
ABSTRACT |
The extracellular matrix (ECM) of the simple
multicellular organism Volvox contains many region-specific
morphological elements and mediates a variety of developmental and
physiological responses by modification of its components. The fact
that >95% of the mature organism is ECM makes Volvox
suitable as a model system for ECM investigations. VMPs are
a family of Volvox genes that are homologous to
zinc-dependent matrix metalloproteinases (MMPs). Here we
describe the identification and purification of the first VMP protein, VMP3. The 470-kDa VMP3 glycoprotein is localized within the ECM, and
its biosynthesis is induced by the sex pheromone. The metal binding
motif of VMP3 is QEXXH, not HEXXH as known for
~1300 other metalloproteinases. VMP3 shows proteinase activity and is
inhibited by EDTA or the MMP inhibitor GM 6001, but in contrast to all
known proteinases, VMP3 clearly prefers copper for activity rather than zinc. The exchange from Q to H within the QEXXH motif
abolishes its copper preference. The unique properties of VMP3 suggest
a novel type of metalloproteinase.
 |
INTRODUCTION |
The well timed breakdown of an ECM is indispensable for embryonic
development, morphogenesis, reproduction, tissue resorption, or
remodeling. In vertebrates, one of the major groups of enzymes that
degrade ECM components is the matrix metalloproteinase
(MMP)1 family. MMPs regulate
many biological processes and are themselves closely regulated. The
effectors that induce MMP synthesis not only include growth factors and
cytokines, but also physical stress and cell-matrix or cell-cell
interactions. The MMPs are among the hydrolases in which the
nucleophilic attack on a peptide bond is mediated by a water molecule,
a characteristic shared with the aspartic peptidases. Although in the
metallopeptidases the divalent metal cation zinc activates the water
molecule (1). The zinc is held in place by three amino acid ligands,
and consequently, the catalytic domain of MMPs contains a conserved
zinc binding motif, which is
HEXXHXXGXXH.
The occurrence of MMPs is not restricted to vertebrates, lower animals
like sea urchins or Caenorhabditis have also been shown to
possess MMP homologues, as well as lower plants like
Chlamydomonas and higher plants, like
Arabidopsis, soybean, or cucumber. Recently, four
MMP-related genes, named VMP genes, were
identified in the multicellular green alga Volvox carteri
(2). Like MMPs, the VMP genes code for proteins
with a putative proteinase domain and a proline-rich, probably rod-like
domain (HR domain). However, there is one hitch with the presumptive
zinc binding site of all VMPs: it is
QEXXHXXGXXH not
HEXXHXXGXXH.
Despite the general simplicity of Volvox, which has only two
cell types, somatic and reproductive, its ECM is surprisingly complex
(3). It consists of many region-specific, anatomically distinct
structures arranged in a defined spatial pattern. These structures are
modified under physiological, metabolic, or developmental control. The
main zones of the ECM are named FZ (flagellar zone), BZ (boundary
zone), CZ (cellular zone), and DZ (deep zone) (3). The BZ includes the
components of the ECM that, except in periflagellar regions, appear to
be continuous over the surface of the organism. The CZ includes
components lying internal to BZ and exhibits specializations around
individual cells. The DZ contains all ECM components internal to the
CZ, fills the deepest regions of the spheroid, and is by far the
largest region.
One important event in development of Volvox is the change
from vegetative to sexual development. The stimulus for switching from
the vegetative to the sexual mode of reproduction in V. carteri is known to be a sex-inducing pheromone (4, 5). This
32-kDa glycoprotein is one of the most potent biological effector
molecules known, since it still works at concentrations as low as
10
16 M. The first responses to the pheromone
are structural modifications within the ECM (6) as well as changes
within the mRNA population. By differential screenings of cDNA
libraries (vegetative versus sexually induced) several new
genes have been discovered; four of these genes are VMPs
(2).
In this paper we describe the identification and purification of VMP3
protein, the first ECM-localized metalloproteinase from Volvox. Among other unusual properties, the enzyme prefers
copper for activity rather than zinc, suggesting a new type of
metalloproteinase. Transgenic algae carrying point mutations within the
QEXXH motif were generated to give detailed information
about the metal binding site.
 |
EXPERIMENTAL PROCEDURES |
Culture Conditions--
The female V. carteri f.
nagariensis strains HK10 (wild type) and 153-48
(nitA
) were obtained from R. C. Starr
(University of Texas, Austin, TX) or D. L. Kirk (Washington
University, St. Louis, MO). Cultures were grown in Volvox
medium (7) at 28 °C in a 8 h dark/16 h light (10,000 lux) cycle
(4).
Separation of Somatic Cells, Reproductive Cells, and
DZ--
Spheroids were broken up by forcing them through a 0.4-mm
hypodermic needle, followed by centrifugation at 20,000 × g for 5 min. The clear, highly viscous supernatant is the so
called DZ extract. Other components were fractionated as described
(2).
Heterologous Expression for Antibody Production--
cDNA
encoding amino acids 22-475 of VMP3 was amplified by polymerase chain
reaction (PCR), simultaneously NdeI and
BamHI sites were added as well as a (His)6-tag
sequence; the sense primer was 5'-ACATATGGCTCCAGGCCCATCAAGC
and the antisense primer was 5'-TGGATCCTTAGTGATGATGATGATGATGAGAGGAGAGCGTCTCAAGCACGGAA
(restriction sites underlined, His-tag in italics). The fragment
was cloned into pET11a (Novagen, Madison, WI) and then transformed into
Escherichia coli BL21(DE3). Expressed protein was
solubilized in 6 M urea, purified on
nickel-nitrilotriacetic acid-agarose (Qiagen, Hilden, Germany), and refolded in 50 mM glycine at pH
9.0.
Antibodies and Western Blotting--
Antibodies were raised in
rabbits and purified on protein A-Sepharose (Amersham
Biosciences, Uppsala, Sweden). Detection of electroblotted
proteins was performed by using the VMP3 antibody at a 1:2500 dilution
and an alkaline phosphatase-conjugated goat anti-rabbit IgG antibody
(Sigma) at a 1:10,000 dilution.
Purification of VMP3 from Volvox--
Sexually induced spheroids
from a 80-liter culture were disrupted using a Dounce homogenizer.
Following centrifugation at 20,000 × g for 20 min, the
DZ extract was brought to 50 mM Tris/HCl, pH 9.0, 10 mM NaCl and applied to a QAE-Sephadex A-25 anion exchange column (Amersham Biosciences). Elution was performed with 100, 200, 300, 400, 500, and 1000 mM NaCl in 50 mM
Tris/HCl, pH 9.0. Relevant fractions were dialyzed against 10 mM NaCl in 20 mM Tris/HCl, pH 8.2, and applied
to a UNO Q1R-column (Bio-Rad) using a Dionex (Sunnyvale, CA) HPLC
system. Elution was at 100, 200, 300, 400, 500, and 1000 mM
NaCl in 20 mM Tris/HCl, pH 8.2. Relevant fractions were
subjected to preparative 6% SDS-polyacrylamide gel electrophoresis (PAGE), and VMP3 was eluted from the gel by diffusion.
Immunoprecipitation--
100 µl of magnetic beads (Dynabeads
450, Dynal, Oslo, Norway) conjugated with sheep anti-rabbit-IgG
antibodies were washed with phosphate-buffered saline-Tween,
mixed with VMP3 rabbit immune serum (or preimmune serum) at a ratio of
1:20 (v/v), and incubated on a rotary shaker for 15 h at 4 °C.
After four washing steps, extracts containing VMP3 were added to the
beads-bound antibodies. Incubation and washing followed. Finally, the
antigen was removed from the beads by adding standard gel loading
buffer without dithiothreitol (prior to in-gel assays).
Non-standard SDS-PAGE--
Non-standard SDS-polyacrylamide gels
were prepared using 100 mM sodium phosphate buffer, pH 7.0, containing 7.5 mM SDS, 3% N,N,N',N'-tetramethylethylenediamine,
and 0.3 mg/ml ammonium persulfate (8). Electrophoresis was in 66 mM sodium phosphate buffer, pH 7.0, 2.3% SDS at 12 mA and
22 °C for 24 h.
Deglycosylation--
VMP3 was dissolved in anhydrous hydrogen
fluoride and incubated at 0 °C for 90 min (9).
In-gel Proteinase Activity Assay--
Samples were mixed with
gel loading buffer without thiol reagents and loaded (without heating)
onto SDS-polyacrylamide gels (8-10% separation gel, 5% stacking gel)
supplemented with 0.2% gelatin. After electrophoresis at 14 mA for
3 h, in-gel renaturation was performed in Volvox medium
supplemented with 0.02% NaN3, 0.1 mM
ZnCl2, and 1% Triton X-100 for 48 h at 28 °C,
followed by incubation in the same solution, but without Triton for
24 h (10). Gels were stained with Coomassie Blue for 30 min and
then destained. Potential inhibitors were added in concentrations that
are customary in proteinase assays, i.e. 1 mM
EDTA, 1 mM EGTA, 2 mM 1,10-phenanthroline, 0.5 mM phenylmethylsulfonyl fluoride, 10 µM GM
6001, or 10 mM dithiothreitol.
For assaying metal-ion specificity in the experiments described in the
results section, renaturation was in the presence of 1 mM
EDTA plus 2 mM of the metal-ions Zn2+,
Ca2+, Mg2+, Co2+, Mn2+,
Cu2+, Ni2+, or Fe2+. In addition,
studies on Zn2+ and Cu2+ replacement were
carried out at a series of concentrations from 10 µM to 2 mM, showing that the described effects are also true for
lower concentrations (down to 10 µM); no inhibitory
effects were detectable within the range of concentrations used.
Gel Documentation and Quantification--
Gel documentation and
quantification was by using a Photo-print system (Vilber Lourmat,
Marne-La-Vallee Cedex, France) and the Bio-1D Software (version 5.01, Vilber Lourmat, France).
Construction of Gene Derivatives--
A PstI fragment
coding for the complete HR domain of VMP3 was used to generate the
modifications in VMP3
, VMP3
, and
VMP3
. There are two EagI sites within the
PstI fragment. The 423-bp EagI fragment was
removed and the ends re-ligated in-frame, resulting in the deletion
within VMP3
. In addition, there is an AatII site in the
middle of the PstI fragment. By using recombinant PCR (11) an artificial AatII site was added either at the 5'- or
3'-end of the HR domain, which resulted in shortened
PstI-AatII (VMP3
) or
AatII-PstI (VMP3
) fragments,
respectively. The primers that introduced the artificial
AatII site (underlined) were
5'-TACGACGTCGGCGCCGATGGGAGCGT (VMP3
) or
5'-ATCCGACGTCGCCGGTAGCGGTGAGTTGC (VMP3
). The
resulting three different PstI fragments (for
VMP3
, -
, or -
) were each connected to the flanking sequences, just as in VMP3, by
standard techniques (12). Mutations within VMP3
were made
by recombinant PCR (11, 13). PCR 1 was performed on the VMP3
gene with the sense primer 5'-CAATGATGGCGACACGGCT and the antisense
primers 5'-GGATGGCCTCGTGCATGATCGTAGCCCAAC
(VMP3
-H), 5'-GGATGGCCTCCAGCATGATCGTAGCCCAAC (VMP3
-L), or
5'-GTGGATGGCCGCCTGCATGATCGTAGCCCA (VMP3
-A),
respectively (mutations underlined). PCR 2 was performed on the same
template with the sense primers
5'-CGATCATGCACGAGGCCATCCACAACTATG (VMP3
-H), 5'-ACGATCATGCTGGAGGCCATCCACAACTATG (VMP3
-L),
or 5'-ATCATGCAGGCGGCCATCCACAACTATGGT (VMP3
-A), respectively (mutations underlined), and
with the antisense primer 5'-AGGACAGTACACGCAGGA, which anneals within
intron 3. PCR 3 was carried out using the first two PCR products as
templates and the flanking primers. A KpnI and a
PstI site within this fragment were used for connection to
the flanking sequences by standard techniques (12).
Stable Nuclear Transformation of Volvox--
Co-transformation
of Volvox with the selectable marker (nitA) plus
the VMP3 gene derivatives was performed as described (14) using a Biolistic PDS-1000/helium particle gun (Bio-Rad).
Reverse Transcription (RT)-PCR--
RT-PCR was performed
as described (13) using the antisense primers
5'-GGAATGCCGTAGTGTTAAG (VMP3) or 5'-GACATCGCACTTCATGATGC (actin; control) (15) and the sense primers 5'-CACTTAATCTGGTCTGAAGC (VMP3) or 5'-TGACGGACTACCTGATGAAG (actin; control).
 |
RESULTS |
In Search of VMP3 Protein--
VMP3 cDNA encoding
the putative proteinase domain was cloned into E. coli
expression vectors and the heterologously expressed VMP3 proteins were
found in inclusion bodies, even if an E. coli signal peptide
for periplasmic localization was added. Heterologously expressed VMP3
proteins were purified and refolding was done in the presence of metal
ions and detergents following published methods (16-18). Finally
heterologously expressed VMP3s were analyzed for proteinase activity.
Neither in solution nor in in-gel activity assays (10) a proteinase
activity could be detected (data not shown). In a different approach,
the VMP3 variant carrying the E. coli signal peptide for
periplasmic localization was co-expressed with the protein disulfide
isomerase to reduce the likelihood of problems with disulfide bonds;
refolding also was done in the presence of glutathion as described
(19). These additional experiments did not either lead to a measurable
proteolytical activity (data not shown). However, heterologously
expressed ECM enzymes often do not show activity due to the lack of
essential posttranslational modifications. Therefore, we intended to
search for the VMP3 polypeptide in wild-type Volvox. For
that purpose the heterologously expressed proteinase domain of VMP3 was
used for generation of polyclonal antibodies. In Western blots the
antibody detected a single band in Volvox lysates (Fig.
1A), indicating the existence
of a high molecular mass VMP3 protein.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 1.
Specificity of VMP3 antibody, localization of
VMP3 polypeptide, and mRNA and protein induction kinetics in
response to the pheromone. A, Western blot of whole
spheroids (6 h after sexual induction). Total protein was fractionated
by 6% SDS-PAGE, electroblotted, and probed using either the VMP3
antibody or the preimmune serum. B, spheroids were separated
into three major components: the somatic cells within small fragments
of the somatic cell layer of the ECM (including FZ, BZ, CZ), the
reproductive cells, and the cell-free DZ and analyzed as described in
the legend to A. C, RT-PCR analysis of
VMP3 mRNA accumulation after sexual induction. There are
two introns within the corresponding VMP3 genomic DNA;
therefore, the amplified fragment shows the predicted size of 641 bp
only if the introns were spliced correctly. Amplification of a 308-bp
Volvox actin cDNA fragment was used as a control (15).
D, synthesis of VMP3 protein in response to the pheromone.
Total protein corresponding to the same number of algae each were
separated by SDS-PAGE (6%). Western blot analysis was done using the
VMP3 antibody.
|
|
VMP3 Is Localized within the ECM Zone DZ--
After mechanical
disruption of a Volvox alga, its components can be separated
from each other by filtration and centrifugation steps. All fractions
were analyzed separately by SDS-PAGE followed by Western blotting using
the VMP3 antibody. As documented in Fig. 1B, VMP3 is
localized only within the DZ, thus being a component of the ECM that
fills out the extracellular interior of the spheroid.
In a different approach VMP3 was localized by fine structure
immunocytology using the VMP3 antibody. Immunogold-labeled and heavy
metal counterstained specimens were examined by transmission electron
microscopy as described (20) (data not shown). Gold particles marking
the localization of VMP3 were uniformly distributed within the DZ (DZ1
and DZ2), confirming the results obtained with the above biochemical approach.
Synthesis of VMP3 Is Stimulated by the Sex-inducing
Pheromone--
The kinetics of accumulation of VMP3
mRNA in response to the pheromone was analyzed in detail by
RT-PCRs. There is a low level of VMP3 mRNA detectable
throughout the life cycle even in vegetatively grown algae, but the
VMP3 mRNA level increases abruptly after pheromone
addition (Fig. 1C). Subsequent to sexual induction, RT-PCRs
give a strong signal of constant intensity for at least 18 h,
whereas VMP3 protein levels exhibited a steady-going increase after
pheromone addition (Fig. 1D).
Purification of VMP3 from Wild-type Volvox--
To allow a
detailed characterization of VMP3 and to prove identity with the
immunoreactive material, VMP3 was purified from wild-type
Volvox. For this purpose a DZ extract was fractionated by
anion exchange chromatography at pH 9.0 on a QAE-Sephadex column. Elution of VMP3 was at 100-200 mM NaCl. Subsequently, VMP3
was re-chromatographed using a UNO Q1R-HPLC anion exchange column at pH
8.2, which provided a higher resolution. VMP3 eluted at 100 mM NaCl. Final purification was achieved by preparative
SDS-PAGE. During development of the purification method all steps were
monitored by Western blots (Fig.
2A) as well as by analytical
gels stained with silver (Fig. 2B). The purified protein was
subjected to automated Edman degradation. Protein deglycosylation with
anhydrous hydrogen fluoride was essential prior to sequencing, since
aldehyde functions, probably produced from attached sugars, interfered
heavily with Edman reagents. Edman degradation resulted in the
N-terminal sequence Ala-Hyp-Gly-Hyp/Gln-Ser-Ser-Asn-Ala-Hyp, which
matches VMP3. Remarkably, there are two amino acids
detectable simultaneously in the fourth cycle. Apparently, signal
peptidases made use of two different leader peptide cleavage sites, and
thus, two differently processed VMP3 species have been sequenced at the
same time (Fig. 2C). The two sequences differ only in the
fourth cycle due to a short sequence repeat within VMP3.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 2.
Purification and sequencing of VMP3
polypeptide. The following steps of purification are shown on a
6% SDS-polyacrylamide gel: total protein after lysis by ultrasonic
treatment (lane 1), DZ extract (lane 2), eluate
from QAE-Sephadex A25 column at 100 mM NaCl (lane
3), eluate from UNO Q1R HPLC column at 100 mM NaCl
(lane 4), after final preparative SDS-PAGE (lane
5). The samples loaded onto the gels in A and
B are identical, but detection differs: A,
Western blot using the VMP3 antibody. B, silver stain.
C, N-terminal sequences of VMP3 deduced from cDNA or
determined by Edman degradation of purified, deglycosylated VMP3.
Leader peptide cleavage sites are indicated. Hyp = hydroxyproline.
|
|
Another striking feature was revealed by N-terminal sequencing: even
the very first proline of the mature VMP3 turned out to be modified to
hydroxyproline. In the ECM proteins found so far, hydroxyprolines are
strictly confined to the HR domains, which consist almost exclusively
of hydroxyprolines, whereas other domains are completely devoid of
hydroxylated prolines (21). N-terminal sequencing does not run into the
HR domain of VMP3 but into the proteinase domain, which is not
proline-rich.
Finally, N-terminal sequencing shows that only the signal peptide was
cleaved off in mature VMP3, but no additional propeptide, which has to
be cut off in most MMPs for enzyme activation (1).
Calculated and In-gel Determined Sizes of VMP3 Differ
Extremely--
A molecular mass of 70 kDa is calculated for the mature
VMP3, but on 6% SDS-polyacrylamide gels the protein hardly enters the
gel. To give a relatively precise molecular mass, non-standard SDS-PAGEs for high molecular mass proteins were used (8). On these gels
VMP3 exhibits ~470 kDa (Fig.
3A), and thus the molecular mass on the gel is almost 7-fold higher than expected. The
extracellular localization of VMP3 and the problems in N-terminal
sequencing without preceding hydrogen fluoride treatment suggest an
extensive glycosylation of VMP3. Actually, deglycosylation reduces the
mass of VMP3 to about a fourth, that is ~125 kDa (Fig.
3B). Nevertheless, the apparent size of the deglycosylated
VMP3 is still significantly larger than calculated. The extreme
(hydroxy)proline content (~25%) explains the difference between
observed and calculated molecular masses, since stretches of
poly(hydroxy)proline possess a reduced ability to bind SDS (22).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 3.
Apparent molecular mass of glycosylated and
deglycosylated VMP3 and proof of identity between purified VMP3
polypeptide and proteinase activity. A, purified VMP3
(glycosylated) analyzed by non-standard SDS-PAGE (4%; without stacking
gel) for high molecular mass proteins (8). B, purified VMP3
analyzed by standard SDS-PAGE (6%) before and after deglycosylation
using anhydrous hydrogen fluoride (HF). Detection in
A and B was by Western blots using the VMP3
antibody. C, purified VMP3 was analyzed in three different
ways: on a standard SDS-polyacrylamide gel (8%) stained with silver,
by a Western blot using the VMP3 antibody, or by using the in-gel
activity assay after 8% SDS-PAGE under non-reducing conditions
(dark and light areas are inverted).
D, immunoprecipitation was applied by using the VMP3
antibody or the preimmune serum as a control. The in-gel activity assay
was used for detection.
|
|
VMP3 Demonstrates Proteinase Activity--
Purified VMP3 from
wild-type Volvox was analyzed for proteinase activity by
using an in-gel assay (10). For that purpose SDS-polyacrylamide gels
were cast in the presence of 0.2% gelatin, and electrophoresis was
carried out in the absence of thiol reagents. After renaturation and
incubation, negative staining was achieved with Coomassie Blue. In this
assay a proteinase activity was detectable, i.e. gelatin was
accepted as an artificial substrate (Fig. 3C). In contrast
to gelatin, casein, which is otherwise often used in activity assays,
was not an acceptable substrate (data not shown). To prove the identity
of the purified protein and activity, the same sample was investigated
by a standard SDS-polyacrylamide gel stained with silver, a Western
blot, as well as an activity gel (Fig. 3C). In addition, an
immunoprecipitation experiment was carried out, in which extracts
containing the VMP3 antigen were mixed with the VMP3 antibody, and the
precipitate was subsequently analyzed by the activity assay. A VMP3
activity band was detected in the precipitate, whereas control
experiments with preimmune serum did not produce any signal (Fig.
3D).
To get information about the real substrate of VMP3, radioactive
in vivo pulse labeling experiments were carried out, and purified, radioactive DZ preparations (23) were used as a substrate. In
addition, there is a way to get otherwise insoluble ECM components into
a soluble form using Ellman's reagent (24). All these soluble or
solubilized ECM components were used as potential substrates in
proteinase assays, which were analyzed by fluorography, but no
significant digestion of DZ or other ECM components was detectable (data not shown). However, we know that there are VMPs as well as
proteinases other than VMPs in the DZ, which might have cleaved the
real substrate of VMP3 already in vivo or during preparation of these extracts. Consequently, it is unclear whether the ECM preparations still contained a significant amount of cleavable substrate when we did the activity assays.
A Bulky VMP3 Proteinase Made Handy--
The high molecular mass
and glycosylation kept us from characterizing VMP3 in more detail. This
problem was solved by homologous expression of VMP3 variants with a
clearly reduced molecular mass. Since the HR domain seemed to be only a
structural component, we reduced its extent. The derivatives VMP3
,
VMP3
, and VMP3
carry deletions at the amino end, the carboxyl
end, or in the middle of the HR domain, respectively (Fig.
4A). Volvox algae were transformed with the corresponding gene constructs using a
particle gun, and transformants were obtained for each of the three
variants. Western blots of wild-type and transgenic strains expressing
VMP3
, VMP3
, or VMP3
, respectively, are shown in Fig.
4B. The VMP3 antibody, which is directed against the
proteinase domain, was used for detection. The apparent molecular mass
is gradually reduced from ~470 kDa in VMP3 to ~190 kDa in VMP3
, ~130 kDa in VMP3
, or ~120 kDa in VMP3
. Fortunately, the
extensive deletion within the HR domain had no effect on proteinase
activity, and all variants are easily distinguished from wild-type VMP3 in the in-gel assay (Fig. 4C). The smallest variant,
VMP3
, was used for all further investigations.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
Deletions within the HR domain of VMP3: sizes
of resulting variants and their proteinase activities.
A, domain structure of wild-type VMP3 and the three VMP3
derivatives. In VMP3 the amino acids between 478 and 555 are
deleted, in VMP3 between 557 and 682 and in VMP3 between 506 and
648. Protease domain = N-terminal globular domain; HR domain = (hydroxy)proline-rich, rod-like domain; empty rectangle at
the N-terminal end = signal peptide; small empty
rectangle at the C-terminal end, 5 amino acids without allocation.
B, Western blot analysis of DZ extracts of wild-type (VMP3)
and transgenic Volvox strains expressing VMP3 , VMP3 ,
or VMP3 , respectively. The VMP3 antibody was used for detection.
C, in-gel activity assay using the same samples as in
B. (Note: due to the imperative omission of thiol reagents
in activity gels, the bands in C run slighty different from
those in B.)
|
|
VMP3 Enzyme Is Inhibited Just as MMPs--
For a detailed
characterization of VMP3
quantification of enzyme activity was
necessary. At present, activity assays are only feasible within a gel,
thus quantification of VMP3
enzyme activity also had to be carried
out within the gel. Therefore, increasing amounts of DZ extract of the
VMP3
-expressing transformant were analyzed by the in-gel assay (Fig.
5A), and activity bands were
quantified using a gel documentation and quantification system. Fig.
5B shows that there is a range of linear correlation between the amount of VMP3
loaded onto the gel and the determined relative activity, thereby allowing us to quantify activity within the gel. By
means of this quantification method, identical amounts of VMP3
were
assayed in the presence of different potential inhibitors. Fig. 5,
C and D, show that the metal chelators EDTA,
EGTA, or 1,10-phenanthroline as well as dithiothreitol inhibit
proteinase activity almost quantitatively, whereas phenylmethylsulfonyl
fluoride, which inhibits serine proteases but not metalloproteinases,
only has a minor effect on activity. Aside from metal chelators and dithiothreitol, the MMP inhibitor GM 6001 reduces activity of VMP3
to zero.

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibitors and metal ion specificity.
A, increasing amounts of VMP3 (DZ extract) were subjected
to the in-gel activity assay (in the presence of Zn2+).
B, linearity of the activity assay: the intensities of the
bands shown in A were quantified. The intensity of the
sample with the strongest signal was set to 100%. Within the range of
enzyme quantities used here the determined intensities were
proportional to the amounts of VMP3 used. C, identical
amounts of VMP3 were assayed in the presence of the following
potential inhibitors: EDTA, EGTA, 1,10-phenanthroline,
phenylmethylsulfonyl fluoride, GM 6001, and dithiothreitol. The
positive control was without any inhibitor. D, the
intensities of the bands shown in C were quantified. The
positive control was set to 100%. E, identical amounts of
VMP3 were renaturated in the presence of Zn2+,
Ca2+, Mg2+, Co2+, Mn2+,
Cu2+, Ni2+, or Fe2+ (2 mM each). In the negative control no metal ion was added.
F, the intensities of the bands shown in E were
quantified. The result with Cu2+ was set to 100%. (Note:
due to the extremely high activity with Cu2+ the linearity
range in the presence of Cu2+ had to be determined
separately with significantly lower VMP3 quantities, but all given
relative activities, including that from Cu2+, refer to
identical VMP3 amounts.)
|
|
Copper, Rather than Zinc, Is Preferred for Proteolytic Activity of
VMP3--
Sensitivity to metal chelators demonstrated involvement of a
metal ion in VMP3
activity. To find out the metal ion specificities, in-gel renaturation was performed in the presence of the metal ions
Zn2+, Ca2+, Mg2+, Co2+,
Mn2+, Cu2+, Ni2+, or
Fe2+, respectively. Generally MMPs are known to prefer zinc
for proteolytic activity; like in MMPs, reconstitution of VMP3
activity was feasible in the presence of Zn2+ (Fig. 5,
E and F). Surprisingly, when Cu2+ was
used a 15-fold higher activity was achieved as compared with Zn2+. In a control experiment human gelatinase (MMP-2) was
assayed in the same way, but its activity decreased to a fourth when
Cu2+ was used instead of Zn2+ (data not shown).
A Point Mutation from Q to H within the QEXXH Motif Increases the
Activity of VMP Dramatically in the Presence of Zinc--
Sequence
comparisons imply that VMPs are members of the MA clan of
zinc-dependent metalloproteinases as defined in the MEROPS protease data base (25), although their putative metal binding site is
QEXXH instead of HEXXH (Fig.
6A). We speculated that the different amino acid at position 1 of the highly conserved zinc binding
motif could be responsible for the preference of VMP3 for copper.
Therefore, the QEXXH motif was subjected to mutation analysis, and transgenic Volvox strains expressing different
VMP3
variants were generated (Fig. 6A). The amino acid
exchanges within the QEXXH motif lead to a total loss of
activity in all variants made, except for a Q-to-H mutation (Fig. 6
B-D). In this variant, VMP3
-H, the activity was not only
retained in the presence of Zn2+, but even increased
5-fold. The loss of activity after an E-to-A exchange within the
QEXXH motif in VMP3
-A indicates the importance of the
glutamate for catalysis, just as known for MMPs. An exchange from Q to
L within the QEXXH motif in VMP3
-L also leads to a total
loss of activity, demonstrating the essential function of glutamine for
metal coordination in wild-type VMP3.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Consensus sequence of zinc metalloproteinases
and VMPs and localization of point mutations in VMP3
sequence and their effects on activity. A,
conserved sequences in metalloproteinases and VMPs:
MMP-1 = matrix metalloproteinase 1 (= collagenase 1)
from Homo sapiens (33), MMP-2 = matrix
metalloproteinase 2 (= gelatinase A) from H. sapiens (34),
At1-MMP = matrix metalloproteinase from
Arabidopsis thaliana (16), SMEP1 = metalloendoproteinase 1 from Glycine max (35),
Cs1-MMP = matrix metalloproteinase from Cucumis
sativus (17), GLE = gamete lytic enzyme from
Chlamydomonas reinhardtii (29), VMPs 1-4 = potential metalloproteinases from V. carteri (2). The
performed amino acid exchanges within the VMP3 variant VMP3 are
given in white characters on black background. The consensus
sequence is boxed. The atypical glutamine of VMPs is given
on gray background. B, analysis of VMP3 point
mutations: equal amounts of VMP3 (from DZ extract) and of the
VMP3 variants carrying point mutations (VMP3 -H,
VMP3 -L, VMP3 -A) were analyzed by Western
blot using the VMP3 antibody. C, in-gel activity assay (in
the presence of Zn2+) using the same samples as in
B. D, the intensities of the bands shown in
C were quantified. The result with VMP3 -H was set to
100%.
|
|
The Copper Preference of VMP3 Is Almost Abolished by the Q-to-H
Exchange--
As described above, VMP3
, carrying the
wild-type QEXXH motif, shows a 15-fold higher
activity if copper was used instead of zinc. When the same
experiment was performed with VMP3
-H, which has the mutant
HEXXH motif, activity with copper was only 2.5-fold above
that for zinc. Thus, the Q-to-H exchange nearly abolished the copper preference.
 |
DISCUSSION |
VMP3, a Metal Ion and Its Binding Site--
Sequence homologies
and the structure of the metal binding domain classifies VMP3 as a
member of the MA clan of zinc-dependent metalloproteinases,
as defined in the MEROPS protease data base (25). Clan MA contains
metalloendopeptidases in which the zinc ligands are in the motif
HEXXHXXGXXH, i.e. the
ligands are the three histidines. The glutamate is required for
catalysis, and the conserved glycine allows the formation of a
-turn
that brings the zinc ligands together; in addition, water is used as a
nucleophile, which is bound by a single zinc ion ligated to the three
histidines (26). Altogether the MEROPS data base contains ~1300
metalloproteinases carrying a HEXXH motif; apparently, there
must be something different in VMPs, since their motif is
QEXXH. In metallopeptidases outside clan MA sometimes amino
acid residues other than histidines are used as zinc ligands (1), but
to our knowledge a glutamine has never been described before. The
preference of VMP3 for copper seems to be the solution to this puzzle:
except for VMP3 all other metallopeptidases of clan MA use zinc as the
divalent metal cation; even metallopeptidases outside clan MA normally
use zinc. Previously, copper has not been described as a catalytic
metal ion in metalloproteinases. In most cases copper is an inhibitor
of metalloproteinases, although in some cases a partial reactivation in
the presence of copper could be obtained in reconstitution experiments
(27).
In contrast to metalloproteinases, copper is known as a co-factor in
electron transfer (e.g. plastocyanin, phytocyanin) or oxygen
utilization enzymes (e.g. cytochrome c oxidase,
superoxide dismutase); however, these enzymes do not use glutamine as a
metal ligand either, but mostly histidine, as with the metalloproteinases.
The fact that all cloned VMP genes code for a
QEXXHXXGXXH motif suggests that the
whole VMP family uses copper as a metal ligand. One might speculate
that using this metal and the
QEXXHXXGXXH motif is common to all
metalloproteinases from Volvox. However, this is not the
case: there are at least two cDNAs coding for putative
metalloproteinases in Volvox, which carry a "normal" HEXXHXXGXXH motif; one cDNA,
LSG2, is preferentially expressed during late somatic cell
phase (28), and the other is stimulated by the sex
pheromone,2 but both do not
belong to the VMP family. In the related unicellular alga
Chlamydomonas there is also a zinc metalloproteinase with a
HEXXHXXGXXH motif, the gamete lytic
enzyme that degrades cell walls of gametes during mating (29), but it
does not belong to the VMPs either. Also, searches in the
Chlamydomonas EST data base (30) did not reveal any VMP
homologues in the unicellular relative.
Timing of VMP3 Synthesis, a Hint to Its Biological
Function--
VMP3 synthesis increases significantly ~3 h after
addition of the sex-inducing pheromone, but this is by far not the only pheromone-induced protein detectable: beside VMPs, several other ECM
glycoproteins have been identified that are synthesized shortly after
this stimulus (21, 31). The majority of those proteins fit into a
single family of ECM glycoproteins, the pherophorins. Pherophorins
represent the earliest biochemical response to the pheromone and they
carry a C-terminal domain that shares homology with the sex-inducing
pheromone. Interestingly, in some pherophorins this C-terminal domain
soon becomes proteolytically liberated (32), and the start of this
cleavage process coincides with the onset of VMP3 synthesis. Seen from
this angle, members of the VMP family look like candidates for this
task, especially since cleavage of pherophorins has been proposed as
part of a novel signal amplification process that is required to get
the exquisite sensitivity of the sexual inducing system (32). The main
objective of future investigations should be the identification of the
real substrates of VMPs. Since the ECM shows a distinct structural
architecture, and ECM glycoproteins like pherophorins are found in
defined ECM zones, each VMP could be responsible for cleavage of a
specific ECM glycoprotein, e.g. a pherophorin, within a
specific ECM zone. Consequently, VMP3 would be responsible for the
DZ.
As demonstrated previously, synthesis of VMP mRNAs is
triggered not only by the sex-inducing pheromone, but also by wounding of the organism (2). Thus, the VMP metalloproteinases also seem to
serve a function in ECM repair or remodeling after wounding. Apparently, the simple multicellular alga Volvox responds to
environmental stimuli and wounding in much the same way as observed in
higher organisms.
Interchangeable Modules in ECM Glycoproteins--
Strikingly,
VMP3, as well as the rest of the VMP family, exhibit not only
functional, but also structural, similarities to the MMPs of animals:
they all show a modular assembly. In comparison of VMPs with, for
example, human MMP-1 (collagenase 1), the following consistencies
become apparent: both have a cleavable N-terminal signal peptide,
followed by a globular domain carrying the catalytic center. Behind the
catalytic domain a proline-rich linker region is attached in both,
MMP-1 and all VMPs. In MMP-1 the proline-rich linker region on its part
is connected to a hemopexin domain, which may help to bind the enzyme
to the ECM (1); similarly, in VMP4 the proline-rich linker is connected
to the C1/C2 domains, which seem to be tandemly repeated protein
binding sites (2). There are no C1/C2 domains in the VMPs 1-3, but
also extended poly(hydroxy)proline domains are suggested to be
responsible for anchoring extracellular proteins within the ECM (21).
In contrast to most MMPs, VMP3, and presumably the rest of the VMP
family, do not make use of propeptides for delayed enzymatic activation.
Apart from the HR and proteinase domains of VMPs many other modules
with a variety of functions have already been identified in ECM
proteins of Volvox (21), suggesting that different modules have been combined or exchanged during evolution to yield chimeric and
multifunctional polypeptides.
 |
ACKNOWLEDGEMENTS |
We thank Dr. M. Sumper for critical reading
of the manuscript, Dr. R. Deutzmann for sequencing peptides, L. Borkner
for her assistance in cloning and performing in-gel assays and N. Poulsen for proofreading.
 |
FOOTNOTES |
*
This work was supported by the Deutsche
Forschungsgemeinschaft (SFB 521).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Lehrstuhl Biochemie I,
Universität Regensburg, Universitätsstr. 31, D-93053 Regensburg, Germany. Tel.: 49-941-943-2835; Fax: 49-89-2443-54854; E-mail: armin.hallmann@gmx.de.
Published, JBC Papers in Press, May 28, 2002, DOI 10.1074/jbc.M203925200
2
A. Hallmann, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
MMP, matrix
metalloproteinase;
FZ, flagellar zone;
BZ, boundary zone;
CZ, cellular
zone;
DZ, deep zone;
ECM, extracellular matrix;
HPLC, high performance
liquid chromatography;
RT, reverse transcription.
 |
REFERENCES |
| 1.
|
Barrett, A. J.,
Rawlings, N. D.,
and Woessner, J. F.
(1998)
Handbook of Proteolytic Enzymes
, Academic Press, San Diego
|
| 2.
|
Hallmann, A.,
Amon, P.,
Godl, K.,
Heitzer, M.,
and Sumper, M.
(2001)
Plant J.
26,
583-593[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Kirk, D. L.,
Birchem, R.,
and King, N.
(1986)
J. Cell Sci.
80,
207-231[Abstract]
|
| 4.
|
Starr, R. C.,
and Jaenicke, L.
(1974)
Proc. Natl. Acad. Sci. U. S. A.
71,
1050-1054[Abstract/Free Full Text]
|
| 5.
|
Tschochner, H.,
Lottspeich, F.,
and Sumper, M.
(1987)
EMBO J.
6,
2203-2207[Medline]
[Order article via Infotrieve]
|
| 6.
|
Wenzl, S.,
and Sumper, M.
(1982)
FEBS Lett.
143,
311-315
|
| 7.
| Provasoli, L., and Pintner, I. J. (1959) in The Ecology of
Alga (Tyron, C. A., and Hartman, R. T., eds) pp. 84-96,
Pymatuning Laboratory of Field Biology, Special Publication no. 2, University of Pittsburgh, Pittsburgh, PA
|
| 8.
|
Davies, G. E.,
and Stark, G. R.
(1970)
Proc. Natl. Acad. Sci. U. S. A.
66,
651-656[Abstract/Free Full Text]
|
| 9.
|
Mort, A. J.,
and Lamport, D. T. A.
(1977)
Anal. Biochem.
82,
289-309[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Kleiner, D. E.,
and Stetler-Stevenson, W. G.
(1994)
Anal. Biochem.
218,
325-329[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Horton, R. M.,
Hunt, H. D., Ho, S. N.,
Pullen, J. K.,
and Pease, L. R.
(1989)
Gene (Amst.)
77,
61-68[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, 2nd Ed.
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 13.
|
Hallmann, A.,
and Sumper, M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
11562-11566[Abstract/Free Full Text]
|
| 14.
|
Schiedlmeier, B.,
Schmitt, R.,
Müller, W.,
Kirk, M. M.,
Gruber, H.,
Mages, W.,
and Kirk, D. L.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
5080-5084[Abstract/Free Full Text]
|
| 15.
|
Cresnar, B.,
Mages, W.,
Müller, K.,
Salbaum, J. M.,
and Schmitt, R.
(1990)
Curr. Genet.
18,
337-346[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Maidment, J. M.,
Moore, D.,
Murphy, G. P.,
Murphy, G.,
and Clark, I. M.
(1999)
J. Biol. Chem.
274,
34706-34710[Abstract/Free Full Text]
|
| 17.
|
Delorme, V. G. R.,
McCabe, P. F.,
Kim, D.-J.,
and Leaver, C. J.
(2000)
Plant Physiol.
123,
917-927[Abstract/Free Full Text]
|
| 18.
|
Liu, Y.,
Dammann, C.,
and Bhattacharyya, M. K.
(2001)
Plant Physiol.
127,
1788-1797[Abstract/Free Full Text]
|
| 19.
|
Rudolph, R.
(1990)
in
Modern Methods in Protein and Nucleic Acid Research
(Tschesche, H., ed)
, pp. 149-171, de Gruyter, Berlin
|
| 20.
|
Hallmann, A.,
and Kirk, D. L.
(2000)
J. Cell Sci.
113,
4605-4617[Abstract]
|
| 21.
|
Sumper, M.,
and Hallmann, A.
(1998)
Int. Rev. Cytol.
180,
51-85[Medline]
[Order article via Infotrieve]
|
| 22.
|
Andres, D. A.,
Goldstein, J. L., Ho, Y. K.,
and Brown, M. S.
(1993)
J. Biol. Chem.
268,
1383-1390[Abstract/Free Full Text]
|
| 23.
|
Wenzl, S.,
Thym, D.,
and Sumper, M.
(1984)
EMBO J.
3,
739-744[Medline]
[Order article via Infotrieve]
|
| 24.
|
Sumper, M.,
Nink, J.,
and Wenzl, S.
(2000)
Eur. J. Biochem.
267,
2334-2339[Medline]
[Order article via Infotrieve]
|
| 25.
|
Rawlings, N. D.,
and Barrett, A. J.
(2000)
Nucleic Acids Res.
28,
323-325[Abstract/Free Full Text]
|
| 26.
|
Gomis-Rüth, F. X.,
Stöcker, W.,
Huber, R.,
Zwilling, R.,
and Bode, W.
(1993)
J. Mol. Biol.
229,
945-968[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Gomis-Rüth, F. X.,
Grams, F.,
Yiallouros, I.,
Nar, H.,
Kusthardt, U.,
Zwilling, R.,
Bode, W.,
and Stöcker, W.
(1994)
J. Biol. Chem.
269,
17111-17117[Abstract/Free Full Text]
|
| 28.
|
Shimizu, T.,
Inoue, T.,
and Shiraishi, H.
(2002)
Gene (Amst.)
284,
179-187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Kinoshita, T.,
Fukuzawa, H.,
Shimada, T.,
Saito, T.,
and Matsuda, Y.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
4693-4697[Abstract/Free Full Text]
|
| 30.
|
Asamizu, E.,
Miura, K.,
Kucho, K.,
Inoue, Y.,
Fukuzawa, H.,
Ohyama, K.,
Nakamura, Y.,
and Tabata, S.
(2000)
DNA Res.
7,
305-307[Abstract]
|
| 31.
|
Hallmann, A.,
Godl, K.,
Wenzl, S.,
and Sumper, M.
(1998)
Trends Microbiol.
6,
185-189[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Sumper, M.,
Berg, E.,
Wenzl, S.,
and Godl, K.
(1993)
EMBO J.
12,
831-836[Medline]
[Order article via Infotrieve]
|
| 33.
|
Templeton, N. S.,
Brown, P. D.,
Levy, A. T.,
Margulies, I. M.,
Liotta, L. A.,
and Stetler-Stevenson, W. G.
(1990)
Cancer Res.
50,
5431-5437[Abstract/Free Full Text]
|
| 34.
|
Collier, I. E.,
Wilhelm, S. M.,
Eisen, A. Z.,
Marmer, B. L.,
Grant, G. A.,
Seltzer, J. L.,
Kronberger, A., He, C. S.,
Bauer, E. A.,
and Goldberg, G. I.
(1988)
J. Biol. Chem.
263,
6579-6587[Abstract/Free Full Text]
|
| 35.
|
Pak, J. H.,
Liu, C. Y.,
Huangpu, J.,
and Graham, J. S.
(1997)
FEBS Lett.
404,
283-288[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. Aono, T. Inoue, and H. Shiraishi
Genes Specifically Expressed in Sexually Differentiated Female Spheroids of Volvox carteri
J. Biochem.,
October 1, 2005;
138(4):
375 - 382.
[Abstract]
[Full Text]
[PDF]
|
 |
|