![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 32, 28400-28410, August 9, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§¶,
§,
,
,
, and

§§
From the
Department of Biochemistry and Biophysics
and the 
Cancer Center, University of
Rochester, Rochester, New York 14642 and ** Departement
de Pharmacochimie Moleculaire et Structurale, U266 INSERM, URA D1500
CNRS, UER des Sciences Pharmaceutiques et Biologiques, 4, Avenue de
l'Observatoire, 75270 Paris Cedex 06, France
Received for publication, February 18, 2002, and in revised form, May 20, 2002
| |
ABSTRACT |
|---|
|
|
|---|
During and after minus-strand DNA synthesis,
human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT)
degrades the RNA genome. To remove RNA left after polymerization, the
RT aligns to cut 18 nucleotides in from the 5' RNA end. The enzyme then repositions, making a secondary cut 8 nucleotides from the RNA 5' end.
Transfer of the minus strong stop DNA during viral replication requires
cleavage of template RNA. Removal of the terminal RNA segment is a
special case because the RNA-DNA hybrid forms a blunt end, shown
previously to resist cleavage when tested in vitro. We show
here that the structure of the substrate extending beyond the RNA 5'
end is an important determinant of cleavage efficiency. A short
single-stranded DNA extension greatly stimulated the secondary cleavage. Annealing an RNA segment to the DNA extension was even more stimulatory. Recessing the DNA from a blunt end by even one nucleotide caused the RT to reorient its binding, preventing secondary cleavage. The presence of the cap at the 5' end of the viral RNA did
not improve the efficiency of secondary cleavage. However, NC protein
greatly facilitated the secondary cut on the blunt-ended substrate,
suggesting that NC compensates for the unfavorable substrate structure.
HIV-11 reverse
transcriptase is required for the conversion of the viral RNA genome to
double-stranded DNA. This multi-functional enzyme has RNA- and
DNA-dependent DNA polymerase, strand displacement, strand transfer, and RNase H activities. The RNase H activity degrades
the RNA genome during and after synthesis of the first or minus DNA
strand (1). The RNase H is used to clear the new minus DNA strand of
the genomic RNA fragments, in preparation for minus-strand transfer and
synthesis of the plus DNA strand. RNase H activity is also required for
the generation of the polypurine tract primers that initiate
plus-strand synthesis, and for the removal of the minus- and
plus-strand primers (Refs. 1 and 2 and reference therein).
HIV-1 RT is an asymmetric heterodimer comprising the p66 and p51
subunits (3-5). The structure of the p66 subunit is analogous to that
of a right hand with the palm, thumb, fingers, and connection subdomains and an RNase H subdomain. The polymerase active site is
located near the amino terminus of the p66, whereas the RNase H active
site is near the carboxyl terminus. Biochemical as well as structural
analyses show the spatial distance between the two active sites to be
about 18~19 nucleotides in length when RT is bound to a duplex
substrate (5-10). The active residues of the polymerase domain,
Asp-185, Asp-186, and Asp-110, reside within the palm subdomain (5).
The fingers, palm, and thumb subdomains of the p66 participate in
substrate binding (8, 10). The p51 subunit, a proteolytic product of
the p66, folds in a different conformation and does not contain any
catalytic sites (5, 8, 10, 11). This subunit primarily serves a
structural role in stabilizing the p66 subunit as well as positioning
the RNase H subdomain and the tRNA (12-14). The essential active site
residues of the RNase H domain include Asp-443, Asp-498, and Glu-478
(15, 16). The structure of the RNase H subdomain of HIV-1 RT resembles that of Escherichia coli RNase H except that RT lacks the
helix C motif, which in E. coli RNase H is important for
binding substrate (17, 18). The RNase H subdomain expressed
independently is inactive since it cannot bind the RNA/DNA hybrid
without the thumb and connection domains (19, 20).
During minus-strand synthesis, RT is positioned on the substrate with
its polymerase active site at the 3' terminus of the DNA primer. This
places the RNase H active site 18 nt away on the RNA template (21, 22),
allowing RT to make endonucleolytic cuts within the RNA as the RNA/DNA
substrate is created. This is the polymerase-dependent mode
of RNase H cleavage (6, 23). The RNase H activity is not strictly
coupled with the polymerase function. It is distributive, periodically
cleaving the RNA to leave fragments (24). Because a virus contains
50-100 copies of RT and only two RTs can be involved in synthesis at
any given time, the residual RTs are available to rebind and degrade
the fragmented genome. This mode of cleavage is referred to as the polymerase-independent RNase H and occurs in the absence of synthesis.
We have previously characterized the polymerase-independent RNase H
activity (25-28). Although the orientation of RT on the RNA/DNA hybrid
is the same as during polymerization, the recessed 5' end of the RNA
fragment directs the positioning (Fig.
1). Binding of RT to the RNA/DNA duplex
at the RNA fragment 5' end places the RNase H active site 18 nt into
the RNA, where the enzyme makes a primary cut. RT then positions 8-9
nt toward the 5' end of the RNA to make an 8-9-nt secondary product or
backward to the 3' end of the RNA, creating a 5-nt product (27, 28).
Ultimately the RNA is degraded into small fragments that dissociate or
are displaced during plus-strand synthesis. Interestingly, the primary, secondary, and 5-nt cuts are independent of each other, each with a
characteristic rate (27).
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (22K):
[in a new window]
Fig. 1.
Mechanism of polymerase-independent RNase H
cleavage. The schematic shows the positioning of the RT for
primary and secondary cuts during the polymerase-independent mode of
RNase H activity. The gray lines represent DNA, and the
black lines represent RNA. The rectangle
represents RT with the indents corresponding to the polymerase
(P) and the RNase H (H) active sites. The sizes
of cleavage products are indicated by the numbered brackets
and arrows.
Blunt end substrates in which the RNA 5' end and the DNA 3' end are flush display a diminished rate of secondary cleavage compared with substrates in which the RNA segment is recessed on the DNA (6, 27, 29-31). These results suggest that RT requires a 3' DNA extension to bind appropriately for secondary cleavage. Significantly, a blunt end intermediate is created during reverse transcription, when RT synthesizes to the 5' end of the RNA genome to create the minus strong stop DNA. Presumably the virus has evolved a mechanism to effectively remove this RNA. Previous work suggests a role for the viral nucleocapsid (NC) protein in degradation of blunt-ended RNA-DNA hybrids. Peliska et al. (32) demonstrate that the presence of NC enhanced the rate of cleavage of the 5'-terminal RNA segment of a blunt-ended RNA-DNA hybrid. They proposed that NC interacts with RT to tether the enzyme to the substrate for more effective cleavage. Although these studies were done before our understanding of primary and secondary cuts, they are useful in providing insights into RNase H mechanism. We were therefore interested in reexamining secondary cuts and the effects of NC using the authentic 5' end sequence of the genome.
Here we have examined structural features of the substrate that are
required to create RT RNase H secondary cuts. We determined how
different lengths of 3' DNA and 5' RNA overhangs compared with
blunt-ended hybrid influence the rate of the secondary cut. These
results show the region of the substrate that is important for contact
with the RT during secondary cleavage. Furthermore, we have determined
the rate of secondary cleavage on the natural blunt-ended substrate,
which contains a m7Gppp cap. Results show that the presence
of the cap does not facilitate secondary cleavages at the blunt end.
Nucleocapsid (NC), however, enhances the overall efficiency of RT RNase
H cuts on blunt-ended substrates while specifically increasing
secondary cut efficiency.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Materials-- Purified HIV reverse transcriptase (40,000 units/mg) was generously provided by Genetics Institute (Cambridge, MA). Oligonucleotides were purchased from Integrated DNA Technologies, Inc (Coralville, IA). The 18-nt RNA was purchased from Oligos Etc. (Wilsonville, OR). AccI, calf intestine phosphatase, dNTPs, rNTPs, DNase I, and polynucleotide kinase were purchased from Roche Molecular Biochemicals. The 32P isotope was purchased from PerkinElmer Life Sciences.
NC--
HIV-1 NCp7 (72 amino acids) was prepared by solid phase
chemical synthesis as described by de Rocquigny et al. (33).
HIV-1 NCp7 (55 amino acids) was generously provided by Dr. Robert J. Gorelick. NC stocks were resuspended in NC dilution buffer containing 50 mM Tris-HCl (pH 7.5) and 5 mM dithiothreitol
and stored in 5-10-µl aliquots at
80 °C until use. For RNase H
assays done in the presence of NC, the protein was added (3.5 nt/NC) to
the reaction and incubated at 37 °C for 5 min before the addition of
RT. For control reactions without NC, an equal volume of NC dilution
buffer was added instead.
Generation of in Vitro Transcribed RNA--
All RNAs were
generated by in vitro run-off transcription using the Ambion
T7-MEGAshortscript kit (Austin, TX) as per the manufacturer's
protocol. The 41-nt RNA was generated from AccI-linearized pBSM13+ plasmid as previously described (26). The 28-nt RNA corresponding to the viral sequence was transcribed from a synthetic double-stranded DNA fragment containing the T7 promoter. The template comprised the sequence
5'-CACGATCG TAATACGACTCACTATAGGGACTCTCTGGTTAGAGGAGATGAATT and
its complimentary strand. The capped 28-nt transcript was generated
using the Ambion mMessage mMachine RNA kit. To generate internally
labeled RNAs, [
-32P]CTP was included in the
transcription reaction.
Substrate Preparation--
The 41- and 28-nt RNAs were first
dephosphorylated by calf intestine phosphatase and 5' end-labeled using
[
-32P]ATP (6000 (222 TBq) Ci/mmol) and polynucleotide
kinase as previously described (26). All RNAs used in the study were
PAGE-purified and resuspended in 10 mM Tris-HCl, 1 mM EDTA buffer (pH 8.0). RNAs were quantitated by using
Ribogreen assay supplied by Molecular Probes (Eugene, OR). To generate
hybrid substrates, the labeled RNA was annealed to the appropriate DNA
template at a ratio of 1:3 in 50 mM Tris-HCl (pH 8.0), 80 mM KCl, and 1 mM dithiothreitol. Components
were mixed, heated to 95 °C for 5 min, and slow cooled to room temperature.
RNase H Assays--
Reactions were performed as described
previously (26). Briefly, reactions contained 50 mM
Tris-HCl (pH 8.0), 1 mM dithiothreitol, 1.0 mM
EDTA, 34 mM KCl, 4 nM substrate, and 32 nM HIV-1 RT. The reaction mixture was incubated for 2 min
at 37 °C to allow prebinding of RT to substrate. Reactions were then
started by the addition of the MgCl2 at 6 mM
final concentration and incubated at 37 °C. Reactions were
terminated at the appropriate time with a 2× termination dye (10 mM EDTA (pH 8.0), 90% formamide (v/v), and 0.1% xylene cyanol and bromphenol blue). Control reactions did not contain RT and
were incubated at 37 °C for a period equaling the longest experimental time point. RNA ladders were created by base hydrolysis and RNase T1 digestion. Samples were subjected to 10% (15% for 28-nt
RNA) denaturing polyacrylamide gel electrophoresis, visualized using a
Molecular Dynamics PhosphorImager, and analyzed using ImageQuant
software (version 1.2).
| |
RESULTS |
|---|
|
|
|---|
Synthesis of minus-strand DNA to the 5' end of the RNA template results in a blunt-ended substrate in which the DNA 3' end is flush with the RNA 5' end. Previously studies show that RNase H cleavage at such blunt ends is very inefficient (27). We hypothesized that the inefficiency in processing the 5'-most RNA segment is because the blunt end RNA-DNA substrate lacks structural features needed for positioning of the enzyme for secondary cuts. We therefore set out to define the necessary structure requirements and to determine whether the other reaction components present in vivo compensate for the missing structures.
Influence of DNA 3' Extensions on Secondary Cleavages--
We have
previously shown that a blunt end substrate in which the RNA 5' end
flush with the DNA 3' end sustains a particularly slow secondary
cleavage compared with an RNA that is recessed on the DNA template
(27). Because this suggested that the DNA 3' extension stimulates
secondary cleavage, we proposed to determine the minimum length of
extension necessary to affect the cleavage (Fig.
2, D-G). Substrates with 3'
end DNA extensions of 1, 3, 5, or 7 nt were generated by annealing the
5' end-labeled 41-nt RNA to a 51, 53, 55, or 57-nt DNA template (Fig.
2A, substrates 3, 4, 5, and
6). The recessed (Fig. 2A, substrate
1) and blunt end substrates (Fig. 2A, substrate
2) were used as controls. These substrates contained a 41-nt
RNA annealed to a 77-nt DNA to create the recessed substrate in which
the DNA 3' end extends 21 nt beyond the RNA 5' end or to a 50-nt DNA to
produce a substrate with the DNA 3' terminus flush with the RNA 5' end.
Equal amounts of each substrate were subjected to RNase H cleavage. As
previously shown (27, 28), the control substrate having the 21-nt 3'
DNA extension sustained an efficient secondary cut (Fig.
2B). The 8-nucleotide secondary product appeared within
15 s and became the major labeled product over the measured time
course. The primary product is created more rapidly (28) but did not
accumulate to a high level in this experiment because this 18-nt
fragment was processed efficiently into the secondary product. The
15-nt product was observed as a minor product, as shown before (27,
28). By 16 min the majority of the 41-nt RNA was cleaved into the
secondary product. In comparing cleavage patterns, processing of the
blunt-ended substrate over time was distinctly different, although the
same size products were generated: the 18-nt primary, 8-nt secondary,
and the 15-nt product (Fig. 2C). As previously shown (27),
although the 18-nt product was efficiently formed, it was poorly
processed to the 8-nt secondary product. Instead some accumulation of
the 15-nt product was observed with time. Unlike with the recessed
substrate, the secondary cut product with the blunt end substrate
appeared in detectable quantities only by 2 min and accumulated at a
slower rate. A reasonable explanation is that the RT cannot move
readily on the blunt end substrate to the appropriate position for the secondary cleavage. Instead, most enzymes move 3 nt to make the 15-nt
product. Over a longer time course, enzymes ultimately make the
secondary product.
|
When the template had a 1-nt DNA 3' extension, the overall cleavage product profile was similar to that of the blunt end substrate (compare Fig. 2D to Fig. 2C). The secondary cut was inefficient and not detectable until 2 min. At 16 min, the amount of 8-nt product formed was only 25% of that observed with the 21-nt overhang substrate. Extending the overhang to 3 nt noticeably enhanced the efficiency of the secondary cut (Fig. 2E). Here the 8-nt secondary product was detectable at the 1-min time point, a 2× faster rate than observed with the blunt end and 1-nt DNA overhang substrates. At 16 min, the secondary cut was about 40% of that observed with the 21-nt overhang substrate (compare Fig. 2E to Fig. 2C). Increasing the overhang to 5 and 7 nt further enhanced the secondary cut efficiency (compare Fig. 2, F and 2G, to Fig. 2C). The 8-nt product was detectable as early as 15 s and was about 50% of that formed by the 21-nt overhang substrate at 16 min. Although the cleavage efficiency was enhanced, it was still not as high as that observed with the 21-nt overhang (Fig. 2B). Because DNA 5' overhangs do not affect primary and secondary cleavages at the RNA 5' end (data not shown), differences in this region of the substrate could not explain the low efficiency of secondary cuts observed on substrates 2-6. Clearly the process of cleavage enhancement is gradual with the length of extension, suggesting that the longer 3' DNA extensions allow for the most optimal contacts with RT that are relevant to the secondary cut.
The Efficiency of Secondary Cleavage on 5' RNA
Extensions--
Because reduced 3' DNA extension inhibited secondary
cleavage, we determined the effect of continuing this structural change beyond the blunt configuration into what might be considered a negative
DNA extension (Fig. 3). RT normally
encounters such a substrate configuration during minus-strand
synthesis, where the extending primer terminus is recessed on the RNA
template. To test the effect of RNA 5' overhangs on secondary
cleavages, the 5' end-labeled 41-nt RNA was annealed to a 49-, 45-, 43-, or 41-nt DNA template to create hybrid substrates with 1-, 5-, 7-, or 9-nt 5' RNA single-strand extensions. The configuration at the RNA 3'/DNA 5' end was kept the same for these substrates (Fig.
3A, substrates 7, 8, 9, and 10). Equal amounts of each
substrate were subjected to RNase H, and the profiles of cleavage
products were compared with that of the blunt end hybrid substrate
(compare Figs. 3, B-E, to Fig. 2C).
Surprisingly, a 1-nucleotide RNA 5' extension eliminated the 8-nt
product (Fig. 3B). The 15-nt product was still produced but
with noticeably lower efficiency. More interestingly, efficiency of the
18-nt primary product formation was also reduced, with the product
accumulating only at the later time points. Instead, a 19-nt product
was generated with high efficiency, suggesting that on this substrate
most RTs use the DNA 3' end rather than the RNA 5' end for initial
alignment. The 19-nt product was then the result of a primary cleavage
in the polymerization-dependent binding mode for RNase H
cleavage.
|
As the RNA 5' end extension was further increased, the products of cleavage were consistent with DNA 3' end-directed alignment of the RT (Fig. 3). The 18-nt product, expected from RNA 5' end alignment, was very minor, suggesting that binding to generate this cut is unstable. The 15-nt product also was formed with less efficiency as the RNA overhang length increased. RNase H cleavages on the 3- and 5-nt RNA overhang substrates produced 21- and 23-nt primary cleavage products that accumulated with time, expected from 3' DNA end positioning (Fig. 3C and data not shown). As with the 1-nt overhang substrate, very few of these products sustained secondary cuts, suggesting that short RNA 5' overhangs restrict the realignment of RT for efficient secondary cleavage.
The 7- and 9-nt RNA 5' extension substrates produced the 25- and 27-nt products expected from RT alignment with the DNA 3' end (Figs. 3, D and E). Although trace amounts of the 15-nt product were observed at the later time points with the 7-nt RNA extension substrate (Fig. 3D), this product was almost undetectable with the 9-nt extension (Fig. 3E). In contrast to the situation with 1-, 3-, and 5-nt overhang substrates, the DNA 3'-directed primary cleavage products decreased with time. Specifically, the 25- and 27-nt primary cleavage products were further processed into smaller fragments. We interpret the major 18-19-nt product as the result of a secondary cut. Overall, the results show that the polymerization-directed binding orientation predominated on substrates with recessed DNA 3' ends. Primary cleavage products from this binding orientation were efficiently formed with all of the overhang substrates. However, subsequent secondary and smaller cleavages were facilitated only in the presence of overhangs of 7 nt and longer. This suggests that RT can utilize an RNA overhang of 7 nt or longer to position for secondary cleavages.
Presence of an Upstream RNA Oligomer Greatly Improves Secondary
Cleavage Efficiency--
We anticipated that the RT would have evolved
to efficiently cleave adjacent RNA segments annealed to a DNA, since
these substrate are structures likely to be formed during
polymerization of the minus DNA strand. To make such a substrate, we
annealed an 18-nt RNA oligomer immediately 5' of the RNA in the 77-nt
DNA/41-nt RNA substrate employed above (Fig. 3A, substrate
11). The 41-nt downstream RNA was 5' end-labeled, allowing
us to assess its cleavage efficiency in the context of an upstream
RNA-DNA hybrid region. Fig. 4 shows that
the expected 18- and 8-nt products appeared over time. Depletion of the
starting substrate and appearance of secondary cleavage products was
distinctly faster than in the absence of the upstream RNA primer
(compare with Fig. 2B). Other interesting products were also
observed. In the absence of the upstream RNA primer, the major
secondary product was 8 nt in length (Fig. 2B). The 7- and
9-nt products occurred to a much lesser extent than the 8-nt product.
When an RNA oligomer was annealed upstream of the 41-nt RNA (Fig. 4),
products shorter than 8 nt appeared and accumulated. These might be
made directly or result from additional cleavage of the 8-nt product. A
reasonable explanation is that the double-stranded hybrid is a
particularly good substrate for RT binding compared with the DNA single
strand extension. This allowed RT to stably translocate even further
from the primary cut site and to make very short products.
|
Influence of the 5' End Cap on the Formation of the Secondary Cut-- As discussed earlier, synthesis of the minus-strand strong stop DNA results in the formation of a blunt-ended hybrid substrate. Presumably efficient execution of both primary and secondary cuts is necessary for exposure of the strong stop DNA 3' terminus for minus-strand transfer. Therefore, RT must be able to cleave a blunt end substrate during reverse transcription. Because the viral genome is a messenger RNA that contains a 5' end m7Gppp cap, we examined whether the presence of the cap structure makes a blunt end substrate more receptive to secondary cleavage.
We synthesized a 28-nt RNA corresponding to the 5' terminus of the
HIV-1 genome (Fig. 5). To control the
positions of labeling and to facilitate annealing, base substitutions
were made mostly near the 3' end of the sequence (see "Experimental
Procedures"). The RNA oligomer was transcribed in vitro
with and without the 5' cap. Because the cap structure prevents 5'-end
labeling, the RNAs were internally labeled at positions 5, 7, and 9 from the 5' end. To distinguish cleavage products containing the RNA 5' end, an additional control substrate was generated in which the uncapped RNA was 5' end-labeled. We first used the 5' end-labeled and
internally labeled uncapped RNAs to create recessed and blunt end
hybrid substrates (Fig. 5A, substrate 12 and
13). The RNA was annealed to a 62-nt DNA template to create
a hybrid with a 28-nt DNA extension or to a 34-nt DNA template to
create the blunt end hybrid. The substrates labeled by either method
yielded a similar pattern of cleavage (Fig. 5, B-E). A
19-nt product was the first to appear and resulted from the primary
cut. The 7-8-nt product resulted from the secondary cut. A 13-nt
product was also detected. The difference in the size of the cleavage
products here from those seen with the 41-nt RNA substrates probably
reflects the difference in sequence between the two substrates.
Additional products 1-2 nt in length were made with the internally
labeled RNA and are evidence of wobbling of the enzyme during secondary cuts. As expected, the difference in labeling did not affect the cleavage efficiency. With the recessed RNA, both 5' end-labeled (Fig.
5B) and internally labeled (Fig. 5C) secondary
cut products appeared within 15 s. However, with the blunt end
RNA, secondary cleavage products were not evident until 1 min even
though the overall RNase H efficiency was similar to that of the
recessed RNA (Fig. 5, D and E).
|
Next we determined whether the presence of the cap influenced the
specificity or rate of secondary cleavage (Fig.
6). Recessed (Fig. 6, A and
B) and blunt end (Fig. 6, C and D)
hybrid substrates were compared. When resolved by gel electrophoresis,
both the starting RNA strand and 5' end cleavage products (equal to or longer than 8 nt) containing the cap structure migrated slightly more
slowly than the corresponding length uncapped RNA and its products.
Segments smaller than 8 nt, derived from either the capped or uncapped
RNA, migrated to equivalent positions because they resulted from
internal cuts and did not contain the cap structure. The capped RNA had
similar RNase H cleavage specificity and efficiency as the uncapped
RNA, indicating that the 5' end cap structure did not have a detectable
effect on the rate or specificity of cleavage.
|
Influence of the NC Protein on the Secondary Cut--
Peliska and
co-workers (32) show that NC enhanced cleavage of a blunt-ended RNA-DNA
hybrid substrate with a sequence derived from a 3' end region of the
HIV genome. The NC particularly stimulated generation of cleavage
products 7-9 nt in length. This prompted us to examine more closely
the effect of NC on both specificity and efficiency of RT RNase H
cleavages on various RNA/DNA hybrid substrates. The 72-amino acid form
of HIV-1 NC protein was used for this study. We first determined
whether NC enhanced cleavage of the recessed 41-nt RNA substrate. NC
had no significant effect on the specificity of cleavage (Fig.
7A). However, the
presence of NC only slightly increased both the overall cleavage
efficiency and the secondary cut efficiency by about 10% (Fig.
7B) and 25% (Fig. 7C), respectively.
|
We then tested the effect of NC on the cleavage of the blunt end 41-mer
RNA. Again, NC did not change the cleavage specificity (Fig.
8A). It
moderately increased the overall cleavage efficiency by about 20-35%
(Fig. 8B). However, the presence of NC had a striking effect
on the secondary cut efficiency, especially at earlier time points. In
the absence of NC, secondary cut products appeared only after 1 min.
However, the 8-nt product arose within 15 s in the presence of NC.
NC increased the secondary cut efficiency by 4-7-fold (Fig.
8C). These results suggest that the main effect of NC on
blunt end substrates is to stabilize RT binding for the secondary
cut.
|
Finally, we tested the effect of NC on cleavage of uncapped and capped
28-mer blunt end HIV RNA used previously (Fig.
9). Once again, NC did not change the
cleavage specificity (data not shown). For both uncapped and capped RNA
substrates, NC increased the cleavage rate. The overall cleavage was
increased by modest a 10-20%. However, the secondary cut rate was
increased by a factor of 2-3 (Fig. 9, A-D). Again, these
data indicate that the 5' cap structure does not affect the RNase H
cleavage even in the presence of NC. In addition, the 55-amino acid
form of HIV-1 NC was also tested for the experiments discussed above,
and similar results were obtained (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have previously examined the mechanism of the polymerization-independent mode of RNase H activity of the HIV RT (25-28). This mode is proposed to be employed by the RT to remove segments of RNA left annealed to the newly made minus-strand DNA. RT was shown to align to the 5' end of the RNA and to rapidly make a primary cut about 18 nt into the RNA (Fig 1) (25, 26, 28). The enzyme then repositions to make a secondary cut approximately in the middle of the 18-nt segment, producing segments small enough for rapid dissociation. Previously, we have shown that chemical modifications of the substrate that prevents the primary cut still allows the secondary cut, indicating that the cuts are not linked in an obligatory fashion (27).
In this study, we have further examined the structural features of the
substrate that allow efficient 5' RNA-directed RNase H activity. We
show that a blunt-ended RNA/DNA hybrid makes appropriate contacts with
the RT to sustain efficient primary cleavage. However, this substrate
lacks structures that allow effective positioning for secondary
cleavage. A critical parameter is the length of template DNA extension,
which greatly influences the binding orientation of the RT and,
consequently, the position and rate of RNase H-directed secondary
cleavages. Thus, when the substrate contains a DNA 3' extension,
secondary cuts are made with very high efficiency at a rate of 5.5 × 10
4 nM/ms (28). In contrast, on
blunt-ended substrates RT appears to be able to move effectively to
make a 15-nt product, but the rate at which this enzyme can position
for the secondary cut is very slow. Interestingly, this result shows
that a DNA extension as short as 3 nucleotides distinctly enhances the
rate of secondary cleavage. Greater extensions lead to further
enhancement. When the DNA 3' end is recessed on the RNA, the RNase H
cleavages indicate two binding orientations of RT on the substrate, the
RNA 5' end-directed orientation and the DNA 3' end-directed
orientation. The latter orientation is one where, in the presence of
dNTPs, RT can prime synthesis. When the DNA is recessed on the RNA by
several nucleotides, RNase H cuts are formed by RT predominantly
positioning in the polymerizing mode. In the absence of synthesis,
after making the primary cut, RT translocates to generate secondary
cuts that further fragment the RNA at the DNA primer terminus. The
mechanism involved is probably related to that employed by the RT to
make primary and secondary cuts during a pause in synthesis.
Remarkably, as little as a single nucleotide DNA recess allows only a
small minority of the RTs to engage in 5' RNA end-directed cleavage,
indicating that the natural positioning of the polymerase via the DNA
primer terminus is the highest affinity binding orientation on such duplexes.
After the primary cleavage, RT translocates 5' of this site to create subsequent cuts that further fragment the primary product. Apparently, such translocations are more efficiently supported on double-stranded regions than on single-stranded extensions. The presence of an immediately upstream RNA primer annealed to the DNA template not only causes an additional improvement in the rate of secondary cleavage but allows the RNA to be cut into even smaller pieces. Studies with E. coli RNase H show that the smallest products created are ~6 nt, suggesting that anything smaller cannot bind DNA with enough stability for RNase H recognition. This suggests that the normal 8-nt product made on a recessed RNA annealed to a DNA template is a manifestation of the distance that the RT can move from the primary cut site while still remaining bound. Presumably, as RT moves further onto the single strand DNA extension, binding stability is reduced. In the presence of an upstream RNA, RT slides further 5' to create cuts 2-5 nt from the 5' end. Such a mechanism can be thought to occur during the normal degradation of the genomic RNA, where adjacent RNA fragments enhance the overall efficiency of RNA removal.
An important step in the conversion of the viral single-stranded RNA to double-stranded DNA is the synthesis of minus strong stop DNA. Synthesis of this DNA is initiated at an internal position on the viral RNA and is extended to the 5' end of the genome. Degradation of the RNA frees the cDNA, allowing the minus strong stop DNA to anneal to complementary sequences near the 3' end of the viral RNA, thereby facilitating minus strong stop transfer. However, the RNA-DNA hybrid at the 5' end of the viral RNA should be resistant to cleavage because the fragment of RNA lacks the 3' DNA extension. We considered that additional factors present during viral replication might improve cleavage efficiency. One such factor is the message cap present at the 5' end of the natural HIV genome. However, examination of the cleavage of the RNA/DNA hybrid containing sequences from the 5' end of the HIV genome revealed that the presence of the message cap had little effect on the specificity or rate of cleavage.
Analyzing cleavage of a blunt-ended RNA-DNA hybrid having the sequence from the 3' end of the HIV genome, Peliska and Benkovic (32) observe that RNase H was enhanced in the presence of NC. Their model envisions that NC interacts both with RT and the RNA/DNA duplex to facilitate delivery of the substrate into the RNase H site, thereby enhancing the overall efficiency of cleavage. Expanding on their finding, we show that the presence of NC specifically enhances the secondary cleavage. This is a general effect that occurred with both the 41-nt RNA blunt hybrid substrate and the viral sequence of the minus strong stop DNA-RNA hybrid. Furthermore, the enhancement also occurred on capped viral RNA hybrid.
The NC-promoted increase in blunt end secondary cut efficiency on the 28-nt viral RNA was not as great as that observed on the 41-nt RNA substrate. This difference may derive from substrate length rather than sequences. In support of this, hybrid substrates containing 54- and 71-nt RNA segments corresponding to the 5' end of the HIV-1 genome showed a similar increase in secondary cleavage as observed with the 41-mer non-viral sequence in the presence of NC.2 The exact mechanism of how NC facilitates these cleavages is not clear. Possibly, NC increases RT binding on the substrate, particularly the sub-optimal binding during positioning for the secondary cut on a blunt-ended substrate, thereby preventing RT dissociation. Alternatively, NC may alter the structure of the RNA-DNA hybrid so that the substrate is more susceptible to RNase H cleavage. In this case a transient interaction of the RT at the secondary cut site would be more productive for cleavage. The greatly increased secondary cut on the blunt-ended substrate should further enhance the NC-facilitated strand annealing of the strong stop DNA 3' end and acceptor RNA, thereby increasing the overall efficiency of strand transfer.
Additionally, NC has been proposed to be necessary to prevent the minus strand strong stop DNA, which terminates in the very stable TAR hairpin, from folding back on itself and forming dead end synthesis products (34, 35). Such fold-back products if made in vivo would interfere with strand transfer, causing premature termination of reverse transcription.
Several previous studies have reported on secondary cleavages at the blunt end of the viral RNA. Studies from Levin and co-workers (36) show that the final product of donor RNA 5' end degradation during minus-strand transfer is 8 nt long in the absence of NC. This suggests that the secondary cut is linked to the transfer reaction. Our results agree with those of Guo et al. (36) and Peliska and Benkovic (31) in that RNase H cuts at the 5' end of this substrate result in products ~8 nt in length. Hughes and co-workers (37, 38) report a somewhat different observation while following RNA cleavage during minus strand strong stop DNA synthesis. In the absence or presence of NC, they observe the smallest cleavage product from the RNA 5' end to be 14 nt long. The authors also report that the 14-nt fragment is readily dissociated from the DNA, whereas NC keeps this fragment annealed. Although differing from our observations and those reported by others (31, 37-39), these results emphasize that the terminal RNA might not be cleaved at the same rate as internal RNA segments.
A number of previous reports examine the degradation of the RNA genome by HIV RT into small fragments and the role of the RNase H-directed secondary cut (6, 29-32). Secondary cleavage is observed during both polymerization-dependent RNase H activity and the polymerization-independent RNase H activity. When the RT is aligned to the polymerase active site, primary and secondary cleavages can be readily detected in the absence of dNTPs. Several groups have determined amino acid residues of HIV-1 RT that are important for the formation of the secondary cut. Studies have examined properties of mutant RTs with altered residues within the primer and template binding domains. Mutations Y232A (40, 41) and Y181C (42) enhance the binding of RT to the secondary cut site. The Y232A mutation in the primer grip region is thought to enhance binding to the DNA primer strand, thereby increasing secondary cut formation. The Y181C mutation is located close to the polymerase active site residues and may influence substrate contacts near this site. The contacts that this mutation may enhance within RT are further away from the RNase H active site than the primer grip and may require longer single strand extensions for stable protein-substrate interaction.
In this study we examined factors that facilitate secondary cuts during
RNase H cleavage. Results with the RNA/DNA duplexes containing various
lengths of 3' DNA or 5' RNA overhangs indicate that RT utilizes the
single-stranded extensions for movement and repositioning for efficient
secondary cleavage. In blunt-ended substrates, which lack this
structural feature, secondary cleavages became less efficient. This
prompted us to examine whether additional factors facilitate secondary
cuts on the blunt-ended replication intermediate. The cap structure did
not alter the cleavage efficiency. However, the viral NC protein
enabled the enzyme to bind in a manner allowing efficient secondary
cuts while also enhancing the overall RNase H activity.
| |
ACKNOWLEDGEMENTS |
|---|
We thank the Genetics Institute for recombinant HIV-1 RT and Dr. Robert J. Gorelick for HIV-1 NC (55 amino acids). We thank Drs. Baek Kim and Yi-Tao Yu for critical reading of the manuscript and Dr. Mark Hanson and Ricardo Roda for helpful discussions.
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant 49573 (to R. A. B. and P. J. F.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Contributed equally to this work.
¶ Supported by a fellowship from National Institutes of Health Grant T32 DE07207-09. Present address: Molecular Staging Inc., 300 George St., New Haven, CT 06511.
Present address: 800 Centennial Ave., Piscataway, NJ 08855.
§§ To whom correspondence should be addressed: Dept. of Biochemistry and Biophysics, Box 712, University of Rochester Medical Center, 601 Elmwood Ave., Rochester, NY 14642. Tel.: 585-275-2764; Fax: 585-271-2683; E-mail: robert_bambara@urmc.rochester.edu.
Published, JBC Papers in Press, May 21, 2002, DOI 10.1074/jbc.M201645200
2 Y. Chen, M. Balakrishnan, B. P. Roques, P. J. Fay, and R. A. Bambara, unpublished results.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HIV, human immunodeficiency virus; RT, reverse transcriptase; nt, nucleotide(s); NC, nucleocapsid.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Champoux, J. J. (1993) in Reverse Transcriptase (Skalka, A. M. , and Goff, S. P., eds) , pp. 103-117, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 2. | Telesnitsky, A., and Goff, A. P. (1993) in Reverse Transcriptase (Skalka, A. M. , and Goff, S. P., eds) , pp. 49-83, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 3. |
di Marzo Veronese, F.,
Copeland, T. D.,
DeVico, A. L.,
Rahman, R.,
Oroszlan, S.,
Gallo, R. C.,
and Sarngadharan, M. G.
(1986)
Science
231,
1289-1291 |
| 4. |
Lightfoote, M. M.,
Coligan, J. E.,
Folks, T. M.,
Fauci, A. S.,
Martin, M. A.,
and Venkatesan, S.
(1986)
J. Virol.
60,
771-775 |
| 5. | Jacobo-Molina, A., and Arnold, E. (1991) Biochemistry 30, 6351-6356[CrossRef][Medline] [Order article via Infotrieve] |
| 6. |
Gopalakrishnan, V.,
Peliska, J. A.,
and Benkovic, S. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10763-10767 |
| 7. |
Gotte, M.,
Maier, G.,
Gross, H. J.,
and Heumann, H.
(1998)
J. Biol. Chem.
273,
10139-10146 |
| 8. |
Jacobo-Molina, A.,
Ding, J.,
Nanni, R. G.,
Clark, A. D., Jr., Lu, X.,
Tantillo, C.,
Williams, R. L.,
Kamer, G.,
Ferris, A. L.,
Clark, P.,
Hizi, A.,
Hughes, S. H.,
and Arnold, E.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
6320-6324 |
| 9. |
Pullen, K. A.,
Ishimoto, L. K.,
and Champoux, J. J.
(1992)
J. Virol.
66,
367-373 |
| 10. |
Kohlstaedt, L. A.,
Wang, J.,
Friedman, J. M.,
Rice, P. A.,
and Steitz, T. A.
(1992)
Science
256,
1783-1790 |
| 11. | Hsiou, Y., Ding, J., Das, K., Clark, A. D., Jr., Hughes, S. H., and Arnold, E. (1996) Structure (Lond.) 4, 853-860[Medline] [Order article via Infotrieve] |
| 12. |
Peters, G.,
and Glover, C.
(1980)
J. Virol.
35,
31-40 |
| 13. |
Peters, G. G.,
and Hu, J.
(1980)
J. Virol.
36,
692-700 |
| 14. |
Cameron, C. E.,
Ghosh, M., Le,
Grice, S. F.,
and Benkovic, S. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6700-6705 |
| 15. |
Kanaya, S.,
Kohara, A.,
Miura, Y.,
Sekiguchi, A.,
Iwai, S.,
Inoue, H.,
Ohtsuka, E.,
and Ikehara, M.
(1990)
J. Biol. Chem.
265,
4615-4621 |
| 16. |
Mizrahi, V.,
Usdin, M. T.,
Harington, A.,
and Dudding, L. R.
(1990)
Nucleic Acids Res.
18,
5359-5363 |
| 17. | Katayanagi, K., Miyagawa, M., Matsushima, M., Ishikawa, M., Kanaya, S., Ikehara, M., Matsuzaki, T., and Morikawa, K. (1990) Nature 347, 306-309[CrossRef][Medline] [Order article via Infotrieve] |
| 18. |
Yang, W.,
Hendrickson, W. A.,
Crouch, R. J.,
and Satow, Y.
(1990)
Science
249,
1398-1405 |
| 19. |
Smith, J. S.,
and Roth, M. J.
(1993)
J. Virol.
67,
4037-4049 |
| 20. |
Smith, J. S.,
Gritsman, K.,
and Roth, M. J.
(1994)
J. Virol.
68,
5721-5729 |
| 21. |
Levin, J. G.,
Crouch, R. J.,
Post, K., Hu, S. C.,
McKelvin, D.,
Zweig, M.,
Court, D. L.,
and Gerwin, B. I.
(1988)
J. Virol.
62,
4376-4380 |
| 22. | Wohrl, B. M., Tantillo, C., Arnold, E., and Le Grice, S. F. (1995) Biochemistry 34, 5343-5356[CrossRef][Medline] [Order article via Infotrieve] |
| 23. |
Furfine, E. S.,
and Reardon, J. E.
(1991)
J. Biol. Chem.
266,
406-412 |
| 24. |
DeStefano, J. J.,
Mallaber, L. M.,
Fay, P. J.,
and Bambara, R. A.
(1994)
Nucleic Acids Res.
22,
3793-3800 |
| 25. |
DeStefano, J. J.,
Mallaber, L. M.,
Fay, P. J.,
and Bambara, R. A.
(1993)
Nucleic Acids Res.
21,
4330-4338 |
| 26. |
Palaniappan, C.,
Fuentes, G. M.,
Rodriguez-Rodriguez, L.,
Fay, P. J.,
and Bambara, R. A.
(1996)
J. Biol. Chem.
271,
2063-2070 |
| 27. |
Wisniewski, M.,
Balakrishnan, M.,
Palaniappan, C.,
Fay, P. J.,
and Bambara, R. A.
(2000)
J. Biol. Chem.
275,
37664-37671 |
| 28. |
Wisniewski, M.,
Balakrishnan, M.,
Palaniappan, C.,
Fay, P. J.,
and Bambara, R. A.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
11978-11983 |
| 29. |
Fu, T. B.,
and Taylor, J.
(1992)
J. Virol.
66,
4271-4278 |
| 30. | Gabbara, S., Davis, W. R., Hupe, L., Hupe, D., and Peliska, J. A. (1999) Biochemistry 38, 13070-13076[CrossRef][Medline] [Order article via Infotrieve] |
| 31. |
Peliska, J. A.,
and Benkovic, S. J.
(1992)
Science
258,
1112-1118 |
| 32. | Peliska, J. A., Balasubramanian, S., Giedroc, D. P., and Benkovic, S. J. (1994) Biochemistry 33, 13817-13823[CrossRef][Medline] [Order article via Infotrieve] |
| 33. | de Rocquigny, H., Ficheux, D., Gabus, C., Fournie-Zaluski, M. C., Darlix, J. L., and Roques, B. P. (1991) Biochem. Biophys. Res. Commun. 180, 1010-1018[CrossRef][Medline] [Order article via Infotrieve] |
| 34. |
Guo, J., Wu, T.,
Anderson, J.,
Kane, B. F.,
Johnson, D. G.,
Gorelick, R. J.,
Henderson, L. E.,
and Levin, J. G.
(2000)
J. Virol.
74,
8980-8988 |
| 35. | Guo, J., Henderson, L. E., Bess, J., Kane, B., and Levin, J. G. (1997) J. Virol. 71, 5178-5188[Abstract] |
| 36. |
Guo, J., Wu, T.,
Bess, J.,
Henderson, L. E.,
and Levin, J. G.
(1998)
J. Virol.
72,
6716-6724 |
| 37. |
Driscoll, M. D.,
Golinelli, M. P.,
and Hughes, S. H.
(2001)
J. Virol.
75,
672-686 |
| 38. |
Gao, H. Q.,
Sarafianos, S. G.,
Arnold, E.,
and Hughes, S. H.
(2001)
J. Virol.
75,
11874-11880 |
| 39. |
Ben-Artzi, H.,
Zeelon, E.,
Amit, B.,
Wortzel, A.,
Gorecki, M.,
and Panet, A.
(1993)
J. Biol. Chem.
268,
16465-16471 |
| 40. |
Ghosh, M.,
Howard, K. J.,
Cameron, C. E.,
Benkovic, S. J.,
Hughes, S. H.,
and Le Grice, S. F.
(1995)
J. Biol. Chem.
270,
7068-7076 |
| 41. | Guo, J., Wu, W., Yuan, Z. Y., Post, K., Crouch, R. J., and Levin, J. G. (1995) Biochemistry 34, 5018-5029[CrossRef][Medline] [Order article via Infotrieve] |
| 42. |
Archer, R. H.,
Dykes, C.,
Gerondelis, P.,
Lloyd, A.,
Fay, P.,
Reichman, R. C.,
Bambara, R. A.,
and Demeter, L. M.
(2000)
J. Virol.
74,
8390-8401 |
This article has been cited by other articles:
![]() |
V. Purohit, B. P. Roques, B. Kim, and R. A. Bambara Mechanisms That Prevent Template Inactivation by HIV-1 Reverse Transcriptase RNase H Cleavages J. Biol. Chem., April 27, 2007; 282(17): 12598 - 12609. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Song, M. Balakrishnan, Y. Chen, B. P. Roques, and R. A. Bambara Stimulation of HIV-1 Minus Strand Strong Stop DNA Transfer by Genomic Sequences 3' of the Primer Binding Site J. Biol. Chem., August 25, 2006; 281(34): 24227 - 24235. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Galetto, V. Giacomoni, M. Veron, and M. Negroni Dissection of a Circumscribed Recombination Hot Spot in HIV-1 after a Single Infectious Cycle J. Biol. Chem., February 3, 2006; 281(5): 2711 - 2720. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Schultz, M. Zhang, and J. J. Champoux Sequence, Distance, and Accessibility Are Determinants of 5'-End-directed Cleavages by Retroviral RNases H J. Biol. Chem., January 27, 2006; 281(4): 1943 - 1955. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Purohit, M. Balakrishnan, B. Kim, and R. A. Bambara Evidence That HIV-1 Reverse Transcriptase Employs the DNA 3' End-directed Primary/Secondary RNase H Cleavage Mechanism during Synthesis and Strand Transfer J. Biol. Chem., December 9, 2005; 280(49): 40534 - 40543. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Derebail and J. J. DeStefano Mechanistic Analysis of Pause Site-dependent and -independent Recombinogenic Strand Transfer from Structurally Diverse Regions of the HIV Genome J. Biol. Chem., November 12, 2004; 279(46): 47446 - 47454. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Klumpp, J. Q. Hang, S. Rajendran, Y. Yang, A. Derosier, P. Wong Kai In, H. Overton, K. E. B. Parkes, N. Cammack, and J. A. Martin Two-metal ion mechanism of RNA cleavage by HIV RNase H and mechanism-based design of selective HIV RNase H inhibitors Nucleic Acids Res., December 1, 2003; 31(23): 6852 - 6859. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-X. Wilhelm, M. Wilhelm, and A. Gabriel Extension and Cleavage of the Polypurine Tract Plus-strand Primer by Ty1 Reverse Transcriptase J. Biol. Chem., November 28, 2003; 278(48): 47678 - 47684. [Abstract] [Full Text] [PDF] |
||||
![]() |