HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 32, 29197-29209, August 9, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/32/29197    most recent M111991200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Guerrero-Esteo, M. Articles by Bernabéu, C. Search for Related Content PubMed PubMed Citation Articles by Guerrero-Esteo, M. Articles by Bernabéu, C. Social Bookmarking                      What's this?

Extracellular and Cytoplasmic Domains of Endoglin Interact with the Transforming Growth Factor- Receptors I and II^*

Mercedes Guerrero-Esteo, Tilman Sánchez-Elsner^§, Ainhoa Letamendia^¶, and Carmelo Bernabéu

From the Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Velázquez 144, Madrid 28006, Spain

Received for publication, December 17, 2001, and in revised form, May 9, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Endoglin is an auxiliary component of the transforming growth factor- (TGF-) receptor system, able to associate with the signaling receptor types I (TRI) and II (TRII) in the presence of ligand and to modulate the cellular responses to TGF-1. Endoglin cannot bind ligand on its own but requires the presence of the signaling receptors, supporting a critical role for the interaction between endoglin and TRI or TRII. This study shows that full-length endoglin interacts with both TRI and TRII, independently of their kinase activation state or the presence of exogenous TGF-1. Truncated constructs encoding either the extracellular or the cytoplasmic domains of endoglin demonstrated that the association with the signaling receptors occurs through both extracellular and cytoplasmic domains. However, a more specific mapping revealed that the endoglin/TRI interaction was different from that of endoglin/TRII. TRII interacts with the amino acid region 437-558 of the extracellular domain of endoglin, whereas TRI interacts not only with the region 437-558 but also with the protein region located between amino acid 437 and the N terminus. Both TRI and TRII interact with the cytoplasmic domain of endoglin, but TRI only interacts when the kinase domain is inactive, whereas TRII remains associated in its active and inactive forms. Upon association, TRI and TRII phosphorylate the endoglin cytoplasmic domain, and then TRI, but not TRII, kinase dissociates from the complex. Conversely, endoglin expression results in an altered phosphorylation state of TRII, TRI, and downstream Smad proteins as well as a modulation of TGF- signaling, as measured by the reporter gene expression. These results suggest that by interacting through its extracellular and cytoplasmic domains with the signaling receptors, endoglin might affect TGF- responses.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Members of the transforming growth factor- (TGF-)¹ superfamily (1, 2) exert their biological effects through binding to a heteromeric complex containing two different transmembrane serine/threonine kinases known as type I and type II signaling receptors (3, 4). Upon ligand binding to the type II receptor, the association between type I and type II receptors is induced, leading to phosphorylation and activation of the type I receptor by the constitutively active type II receptor (4, 5). Then, activated type I receptor propagates intracellular signal to the nucleus by phosphorylating members of the Smad family of proteins (4, 6, 7).

The TGF- receptor complex also contains two auxiliary co-receptors named endoglin and betaglycan (8-10). These are transmembrane proteins with large extracellular domains and serine/threonine-rich cytoplasmic regions without consensus signaling motifs. Endoglin binds TGF-1, TGF-3, activin-A, BMP-2, and BMP-7 in the presence of the signaling receptor types I and II (8, 11, 12) and modulates TGF-1-dependent cellular responses (11, 13, 14). It is highly expressed on endothelial cells and several lines of evidence support an important role for endoglin in cardiovascular development and vascular remodeling. Thus, endoglin expression is regulated during heart development in humans and chicken (15, 16), and genetic inactivation of endoglin in the mouse shows that embryos homozygous for mutant endoglin die at 10-10.5 days postcoitum due to vascular and cardiac anomalies (17-19). Furthermore, genes encoding endoglin and ALK-1 (a type I TGF- receptor) are targets for the autosomal dominant disorder known as hereditary hemorrhagic telangiectasia (20-22). Despite the data supporting an important role for endoglin in the TGF- system, the molecular basis of endoglin function is still poorly understood.

Several lines of evidence suggest that endoglin is not a receptor per se: (a) in endothelial cells, only a small percentage of endoglin molecules is capable of binding TGF-; (b) endoglin does not bind ligand on its own but requires the presence of the signaling receptors (11, 12), (c) even in the presence of the signaling receptors, ligand association with endoglin can only be visualized in the presence of a cross-linking agent (12); and (d) cross-linking of endoglin transfectants with radiolabeled TGF- showed the existence of ligand-free endoglin associated with TGF--loaded signaling receptors (11). All of these data suggest that endoglin association with the signaling receptors is critical for endoglin access to ligand and for its modulation of the ligand-induced cellular responses. Here, we have investigated the domains involved in the association between endoglin and the signaling receptors as well as the consequences of this interaction on the phosphorylation status of the proteins involved.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Culture and Transfections-- The monkey kidney COS-7 and the rat myoblast L₆E₉ cell lines were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum in 5% CO₂ at 37 °C in a humidified atmosphere. COS-7 cells were transiently transfected with expression vectors encoding wild type and mutant constructs of endoglin, TRI, or TRII using LipofectAMINE Plus as indicated by the manufacturer (Invitrogen). Functional assays were carried out 48 h after transfection. Treatment of cells with recombinant human TGF-1 (Peprotech) was performed at a concentration of 10 ng/ml for 30 min.

Expression Vectors-- Wild type human endoglin cDNA subcloned into the pCMV5 vector (11) was used to derive the truncated endoglin constructs by PCR amplification. The resulting PCR fragments were cloned into pDisplay (Invitrogen) expression vector, which allows expression of proteins on the cell surface. All endoglin constructs expressed from pDisplay contain the influenza hemagglutinin epitope HA at the NH₂ terminus. The oligonucleotides used to prime the PCR synthesis of endoglin fragments were as follows: TMCT-Endo (amino acids 573-658), GAAGATCTAACATCATCAGCCCTGAC and TCCCCGCGGGGCTATGCCATGCTGCT; EC-Endo (amino acids 26-586), GGGGCCCAGCCGGCCGAAACAGTCCATTGT and TCCCCGCGGGGCCTTTGCTTGT; ECTM-Endo (amino acids 26-614), GGGGCCCAGCCGGCCGAAACAGTCCATTGT and TCCCCGCGGTCAGTAGATGTACCA; 558-Endo (amino acids 26-558), GGGGCCCAGCCGGCCGAAACAGTCCATTGT and TCCCCGCGGCCCGGTCTTGGG; 437-Endo (amino acids 26-437), GGGGCCCAGCCGGCCGAAACAGTCCATTGT and TCCCCGCGGTTTCCGCTGTGG; 437/586-Endo (amino acids 437-586), GGGGCCCAGCCGGCCGAAAAAGGTGCACTGC and TCCCCGCGGGCCTTTGCTTGT. The oligonucleotides were designed to introduce a SfiI restriction site at the 5'-end (except for the TMCT-Endo mutant, which contains a BglII restriction site) and a SacII site at the 3'-end of the endoglin DNA fragments. The reverse primers for TMCT-Endo and ECTM-Endo include a stop codon. All primer sequences for this study are given from 5' to 3'. Full-length endoglin was also subcloned into the pDisplay vector to generate an HA epitope-tagged endoglin. The construct was engineered by PCR using forward primer that included a SfiI restriction site (GGGGCCCAGCCGGCCGAAACAGTCCATTGT) and reverse primer that included a stop codon and a SacII site (TCCCCGCGGGGCTATGCCATGCTGCT).

The pCMV5 expression constructs containing cDNAs for TRII/HA (tagged at the COOH terminus with the influenza hemagglutinin (HA) epitope), HA/TRII (K277R) (tagged at the NH₂ terminus with the HA epitope), TRI/HA, TRI (T204D)/HA, and TRI (K232R)/HA have been described (23) and were a generous gift from Dr. Liliana Attisano (University of Toronto, Canada).

GST Fusion Constructs-- To generate the GST-Ecyt fusion protein, the cytoplasmic domain of endoglin was amplified by PCR, using forward (5'-GAATTCTGGTACATCTACTCGCACACGC-3') and reverse (5'-GGCTATGCCATGCTGCTGGTGG-3') primers, and the product was cloned into pGEX-1T (Amersham Biosciences). To generate the GST-GS/TRI fusion protein, the juxtamembrane and GS domains of TRI (amino acids 146-207) were amplified by PCR, using forward (5'-CGGGATCCATCTGCCACAACCGC-3') and reverse (5'-CGGAATTCTTGTAACACAATAGTTCTCGC-3') primers, and the product was cloned into pGEX4T-3 (Amersham Biosciences). Plasmids encoding GST-Smad2, GST-Smad3, and GST-Smad4 were kindly provided by Dr. Liliana Attisano (University of Toronto). Fusion proteins were expressed and purified according to the manufacturer's instructions.

Antibodies-- The endoglin-specific monoclonal antibodies P4A4 and P3D1 have been previously described, and they recognize epitopes contained within the fragments Tyr²²⁷-Gly³³¹ and Glu²⁶-Gly²³⁰ of human endoglin, respectively (24). For recognition of TRII and TRI, specific polyclonal antibodies were used (C16 and V22, respectively; Santa Cruz Biotechnology Inc., Santa Cruz, CA). Proteins tagged with the influenza virus HA epitope were detected with the monoclonal antibody 12CA5 (Roche Molecular Biochemicals).

Immunoprecipitation and Western Blot Analyses-- Cells were lysed at 4 °C for 30 min with lysis solution (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1% digitonin, 1 mM NaF, 10 mM NaVO₄, 1 mM Mo₂VO₄, and a mixture of protease inhibitors). Aliquots of total cell lysates containing equivalent amounts of total protein were precleared for 4 h with protein G or protein A coupled to Sepharose (Amersham Biosciences) at 4 °C. Specific immunoprecipitations of the precleared lysates were carried out in the presence of the appropriate antibody, using protein G- or protein A-Sepharose. After overnight incubation at 4 °C, immunoprecipitates were isolated by centrifugation and washed three times with lysis buffer. When required, immunoprecipitates were incubated with alkaline phosphatase (Roche Molecular Biochemicals) at 37 °C for 1 h. Total lysates and the precipitated proteins were separated by SDS-PAGE and electrotransferred to a polyvinylidene difluoride membrane for immunodetection with the indicated antibody. Immunodetection was performed with the SuperSignal chemiluminescent substrate (Pierce) according to the manufacturer's instructions.

Flow Cytometry Analysis-- COS cells were transiently transfected with the indicated HA-tagged endoglin constructs. After 48 h, cells were incubated with the mouse monoclonal antibody 12CA5 (against the influenza virus HA epitope; Roche Molecular Biochemicals) for 30 min at 4 °C. After two washes with phosphate-buffered saline, fluorescein isothiocyanate-labeled F(ab')2 rabbit anti-mouse Ig was added, and incubation proceeded for an additional period of 30 min at 4 °C. Finally, cells were washed twice with phosphate-buffered saline, and their fluorescence was estimated with an EPICS-CS (Coulter Cientifica), using logarithmic amplifiers. Results are expressed as an expression index calculated as the percentage of marker-positive cells multiplied by their mean fluorescence intensity.

Phosphorylation Assays in Vitro-- Immunoprecipitates of TRI or TRII were washed twice with lysis buffer, washed once with kinase buffer (50 mM Tris-HCl, pH 7.5, 5 mM MnCl₂, 5 mM MgCl₂, 1 mM CaCl₂), and resuspended in 40 µl of kinase buffer with 5 µM ATP, 1 µCi of [-³²P]ATP (3000 Ci/mmol; Amersham Biosciences), and 2 µg of recombinant GST, GST-Ecyt, GST-GS/TRI, GST-Smad2, GST-Smad3, or GST-Smad4. The reaction was incubated for 30 min at 37 °C. Phosphorylation was stopped by the addition of Laemmli sample buffer, and the products were resolved by SDS-PAGE. The incorporation of [³²P]phosphate was visualized by autoradiography. Assays for TR-II kinase activity were performed as described above but without adding GST proteins.

Phosphorylation Assays in Vivo-- COS-7 cells were transfected with TRI, TRII, and endoglin, as indicated. After 48 h, the cells were washed in phosphate-free medium (ICN Biomedicals) and metabolically labeled with 0.5 mCi/ml [³²P]orthophosphate for 3 h. Cells were washed with phosphate-buffered saline, lysed with lysis buffer, and immunoprecipitated with the appropriate antibodies. Immunoprecipitates were analyzed on SDS-polyacrylamide gels, and radiolabeled bands were detected by autoradiography and quantified by densitometry using a PhosphorImager 410 and ImageQuant software.

Luciferase Assays-- The pARE-lux reporter vector, encoding the activin response element of Xenopus mix.2 promoter fused to the luciferase reporter gene, and the TGF- transcriptional co-activator Fast-1 have been previously described (25-27). L₆E₉ myoblasts were selected for these studies, because they do not express endoglin or its homologue betaglycan, and they have proved to be a useful model system to analyze the function of endoglin and betaglycan in TGF- responses (11, 28). Activity of the TGF- reporter construct was determined by transient transfection of L₆E₉ myoblasts using Superfect (Qiagen). Briefly, cells in 24-well plates were transfected with the pARE reporter and the endoglin or Fast-1 expression vectors at densities of 5 × 10⁴ cells/well. The amount of DNA in each transfection was normalized by using the corresponding insertless expression vector as carrier. After 24 h, cells were washed with Dulbecco's modified Eagle's medium before incubation with 5 ng/ml TGF-1 for an additional 24-h period. Relative luciferase units from triplicate samples were determined in a TD20/20 luminometer (Promega, Madison, WI). Each transfection experiment was performed at least four times with different DNA preparations. Correction for transfection efficiency was made by cotransfection with the -galactosidase expression vector pCMV--galactosidase, and the corresponding enzymatic activity was determined using the Galacto-Light kit (Tropix). The mean and S.D. were calculated and experimental results of the promoter constructs were displayed either as arbitrary units of luciferase activity, or as a -fold induction with respect to the corresponding untreated sample.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Endoglin Associates with the TGF- Signaling Receptors in the Absence of Exogenous Ligand-- To study the interaction of endoglin with TRI or TRII, COS cells were transfected with the corresponding expression vectors in the absence of exogenous ligand, and cell lysates were subjected to specific immunoprecipitation, followed by Western blot analysis. As shown in Fig. 1, endoglin co-immunoprecipitates with either TRI or TRII as revealed by immunodetection with antibodies to TRI and TRII, respectively (lanes 3 and 6). Although the transfected COS cells express low levels of signaling receptors, no association between endoglin and the endogenous receptors could be detected (lanes 1 and 4). These results demonstrate that endoglin interacts with TRI and with TRII in the absence of exogenous TGF- and that the formation of the endoglin-TRI or endoglin-TRII complexes does not require the presence of TRII or TRI, respectively.

View larger version (14K): [in this window] [in a new window]   Fig. 1.   Endoglin interacts with TRI and TRII in the absence of exogenous ligand. COS-7 cells were transiently transfected with expression vectors encoding endoglin, TRI, or TRII, as indicated. Cell lysates were immunoprecipitated (IP) with a mixture of P3D1 and P4A4 anti-endoglin (upper panels) or anti-TRI or anti-TRII (middle panels) antibodies. Immunoprecipitates were subjected to SDS-PAGE under reducing conditions, followed by Western blot (WB) with the indicated antibodies to allow the detection of co-immunoprecipitated proteins. As a control for transfection, total lysates (TL) were analyzed by Western blot (lower panels). This is a representative experiment of at least three different ones.

Formation of Endoglin-TRI and Endoglin-TRII Complexes Is Not Affected by the Activation State of the Signaling Receptors-- To analyze whether the complex formation of endoglin with TRI or TRII was affected by the activation state of the signaling receptors, experiments were performed in the presence of exogenous ligand or signaling receptors with varying catalytic activities. First, COS cells were transfected with endoglin and TRI or TRII and cultured with different concentrations of fetal calf serum, either in the absence or in the presence of 10 ng/ml exogenous TGF-1. Fetal calf serum is a minor source of TGF-, and preliminary experiments indicated that 0.2% is the minimal concentration of fetal calf serum required for cell viability. As shown in Fig. 2A, the amount of TRI (left upper panel) or TRII (right upper panel) co-immunoprecipitated by anti-endoglin antibodies is similar for all treatments, suggesting that the addition of exogenous ligand does not affect the formation of endoglin-TRI or endoglin-TRII complexes. Since the active TGF- receptor signaling complex requires both TRI and TRII, endoglin association was analyzed when both signaling receptors were cotransfected (Fig. 2B). Again, exogenous TGF- did not affect the formation of endoglin complexes with TRI or TRII. Next, COS cells were transfected with expression vectors for endoglin as well as wild type and different kinase mutant versions of the signaling receptors. As shown in Fig. 2C, the constitutively active TRI (T204D) mutant, the constitutively inactive TRI (K232R) mutant, and the wild type TRI construct were able to associate with endoglin (upper left panel). Similarly, the kinase-inactive TRII (K277R), and the wild type TRII constructs showed interaction with endoglin (upper right panel). Taken together, these results suggest that endoglin association with TRI and TRII is independent of the activation state of the signaling receptors.

View larger version (36K): [in this window] [in a new window]   Fig. 2.   Effect of the activation state of the TGF- system on the endoglin association with the signaling receptors. A and B, the presence of TGF- does not affect the association between endoglin and TRI or TRII. COS-7 cells were transiently transfected with expression vectors encoding HA-endoglin, TRI, or TRII and cultured in the presence of 10% (A) or 0.2% (A and B) fetal calf serum and recombinant TGF-1 at 10 ng/ml, as indicated. Total lysates were immunoprecipitated (IP) with anti-endoglin (P3D1 and P4A4), anti-TRI, or anti-TRII antibodies. Immunoprecipitates were electrophoresed by SDS-PAGE under reducing conditions, followed by Western blot (WB) with anti-HA, anti-TRI, or anti-TRII antibodies (upper panels). As a control for transfection, recombinant proteins were analyzed in total lysates (TL) by Western blot (lower panels). C, full-length endoglin associates with TRI and TRII kinases independently of their activation state. COS-7 cells were transiently transfected with expression vectors encoding endoglin, wild type TRI kinase, constitutively active TRI kinase (T204D), kinase-deficient TRI (K232R), wild type TRII, and kinase-deficient TRII (K277R) as indicated. Total lysates were immunoprecipitated with anti-endoglin antibodies (P3D1 and P4A4), and immunoprecipitates were electrophoresed by SDS-PAGE under reducing conditions, followed by Western blot with anti-TRI or anti-TRII antibodies (upper panels). As a control for transfection, recombinant proteins were analyzed in total lysates by Western blot (lower panels). Results shown in A and B are representative of four different experiments.

The Extracellular Domain of Endoglin Interacts with TRI and TRII-- To identify the region(s) involved in the association with the signaling receptors, several truncated versions of endoglin were generated (Fig. 3). Construct HA-TMCT-Endo lacks the extracellular domain, HA-EC-Endo lacks the cytoplasmic and transmembrane regions, and HA-ECTM-Endo only lacks the cytoplasmic domain. Additional mutants encoding only part of the extracellular domain (558-Endo, 437-Endo, and 437/586-Endo) were also analyzed. Constructs 437-Endo and 437/586-Endo were generated around the arginine at position 437, because several lines of investigation suggest that this residue might define a protein domain: (a) it is located at a putative protease cleavage site of the protein; (b) artificial constructs truncated at position 437 can be expressed upon transfection of mammalian cells; and (c) its codon is located in the border between exons 9b and 10 (29). In order to facilitate the analysis of the mutants, all constructs contained an epitope tag of HA at the amino terminus. Transfection of these constructs in COS cells confirmed that all mutant versions of endoglin were expressed as evidenced by Western blot analysis (Fig. 3B). Since the wild type endoglin is a disulfide-linked dimer (30), we analyzed whether the truncated forms were also disulfide-linked by subjecting the lysates to electrophoresis under reducing or nonreducing conditions. As shown in Fig. 3B, all of the constructs were expressed in a dimeric form. Interestingly, the smallest construct, TMCT-Endo, contains only one cysteine residue at position 582 of the extracellular domain, suggesting its involvement in the dimerization process. This was further demonstrated by generating the mutant construct TMCT-Endo/C582G, where the cysteine at 582 has been replaced by a glycine. Transfection of this mutant yielded a monomeric form of endoglin, as opposed to the dimer obtained with the TMCT-Endo plasmid (Fig. 3C). Furthermore, similar to the wild type endoglin, all of the truncated forms were also expressed at the cell surface as demonstrated by flow cytometry analysis (Fig. 3D).

View larger version (28K): [in this window] [in a new window]   Fig. 3.   Generation of different truncated forms of endoglin. A, schematic representation showing the names and the endoglin protein sequences. Numbers indicate the amino acid of endoglin (starting at the N terminus) that limit the corresponding fragment. The position of extracellular (EC), transmembrane (TM), and cytoplasmic (CT) domains, is indicated. As described under "Experimental Procedures," all of the constructs contain the leader sequence of the IgG and the HA epitope at the N terminus, and some constructs (EC-Endo, 558-endo, 437-Endo, and 437/586-Endo) encode the transmembrane domain of the pDisplay vector. The number of amino acid residues, corresponding to each endoglin construct expressed at the cell surface, is included in parenthesis. B, Western blot analysis of endoglin mutants. Total lysates from COS cells transiently transfected with expression vectors encoding the indicated forms of endoglin were subjected to SDS-PAGE under either reducing (R) or nonreducing (NR) conditions, followed by Western blot (WB) with anti-HA antibody. Analysis of the recombinant proteins under reducing and nonreducing conditions demonstrates that all of the constructs are expressed in a dimeric form. C, Western blot analysis of TMCT-Endo and TMCT-Endo/C582G mutants. Total lysates from COS cells transiently transfected with TMCT-Endo and TMCT-Endo/C582G expression vectors were subjected to SDS-PAGE, followed by Western blot with anti-HA antibody. Analysis of the recombinant proteins under either reducing or nonreducing conditions demonstrates that TMCT-Endo is expressed in a dimeric form, whereas TMCT-Endo/C582G yields a monomer. D, flow cytometry analysis. COS-7 cells were transiently transfected with expression vectors encoding the indicated forms of endoglin and 48 h later were collected and analyzed by immunofluorescence flow cytometry with anti-HA antibodies. Data are shown as an expression index (percentage of positive cells multiplied by their mean fluorescence intensity). Results shown in B and C are representative of four different experiments, whereas those in D are representative of two different experiments.

To investigate whether the extracellular domain of endoglin was involved in the association with the signaling receptors, HA-ECTM-Endo, TRI, and TRII were expressed upon transfection in COS cells. Immunoprecipitation analysis with anti-TRI and anti-TRII demonstrated that HA-ECTM-Endo was co-precipitated only when TRI or TRII were expressed (Fig. 4A), indicating that the extracellular domain of endoglin interacts with both signaling receptors. Parallel studies with HA-EC-Endo construct, which does not contain the transmembrane domain of endoglin, revealed similar levels of truncated protein co-precipitated with anti-TRI and anti-TRII (Fig. 4A), further confirming the involvement of the extracellular domain and suggesting a nonrelevant role for the transmembrane region in the interaction with the signaling receptors. Next, the interactions of different truncations of the extracellular domain of endoglin with TRI and TRII were analyzed. Immunoprecipitation studies with anti-endoglin, anti-TRI, and anti-TRII demonstrated that HA-558-Endo, HA-437-Endo, and HA-437/586-Endo co-precipitated with TRI, whereas only HA-558-Endo and HA-437/586-Endo co-precipitated with TRII (Fig. 4, B and C). These results suggest that (a) TRII interacts with residues 437-558 of the extracellular domain of endoglin, a region proximal to the transmembrane domain and (b) TRI interacts not only with residues 437-558 but also with a second region comprised between amino acids 26 and 437 of the extracellular domain of endoglin.

View larger version (25K): [in this window] [in a new window]   Fig. 4.   Analysis of the interaction between the extracellular domain of endoglin and TRI and TRII. A, the extracellular domain of endoglin associates with TRI and TRII. COS-7 cells were transiently transfected with expression vectors encoding HA-ECTM-Endo, HA-EC-Endo, TRI, or TRII, as indicated. Total lysates were immunoprecipitated (IP) with anti-TRI or anti-TRII antibodies, and immunoprecipitates were electrophoresed by SDS-PAGE under reducing conditions. The presence of endoglin was revealed by Western blot (WB) with anti-HA antibodies (upper panels). As a control for transfection, recombinant proteins were analyzed in total lysates (TL) by Western blot (lower panels). B and C, mapping the extracellular regions of endoglin involved in the association with TRI and TRII. COS-7 cells were transiently transfected with TRI, TRII, HA-EC-Endo, HA-437-Endo, HA-558-Endo, or HA-437/586-Endo, as indicated. Total lysates were immunoprecipitated with a mixture of P3D1 and P4A4 antibodies (-endoglin), anti-TRI, or anti-TRII, and immunoprecipitates were electrophoresed by SDS-PAGE under reducing conditions. The presence of TRI, TRII, or endoglin was revealed by Western blot with anti-TRI, anti-TRII, or anti-HA antibodies, respectively. As a control for transfection, recombinant proteins were analyzed in total lysates by Western blot. TRI coprecipitates with the truncated endoglin mutants EC-Endo, 558-Endo, and 437-Endo, whereas TRII only coprecipitates with EC-Endo and 558-Endo (B). TRI and TRII coprecipitate with the truncated endoglin mutant 437/586-Endo (C). Results shown in A-C are representative of at least four different experiments.

The Cytoplasmic Domain of Endoglin Interacts with TRI and TRII-- When studying the interaction between two different transmembrane proteins, it is important to assess both the involvement of their extracellular domains and that of their cytoplasmic domains. Endoglin is constitutively phosphorylated in Ser/Thr residues (31, 32), and both signaling receptors are Ser/Thr kinases (33, 34), thus providing a hint for the participation of their cytoplasmic domains in protein association. To study the interaction between endoglin cytoplasmic domain and TRI or TRII, the HA-TMCT-Endo construct (lacking the extracellular domain) was co-transfected with wild type or kinase mutants of TRI and TRII (Fig. 5). Immunoprecipitation analysis with anti-TRI and anti-TRII demonstrated that the cytoplasmic domain of endoglin associates with TRI when the kinase domain is inactive (K232R) but not with the constitutively active (T204D) form (Fig. 5A). In the same experiment, a weak band of endoglin was found associated with the wild type TRI. This association is probably due to the TRI activation induced by oligomerization of the signaling receptors that occurs upon transfection (35, 36). In addition, the cytoplasmic domain of endoglin interacts with both the active (wild type) and inactive (K277R) forms of TRII (Fig. 5B). These results demonstrate that the endoglin cytoplasmic domain interacts with TRI and with TRII.

View larger version (25K): [in this window] [in a new window]   Fig. 5.   The cytoplasmic domain of endoglin associates with TRI and TRII. COS-7 cells were transiently transfected with expression vectors encoding HA-TMCT-Endo, wild type TRI, constitutively active TRI kinase (T204D), kinase-deficient TRI (K232R), wild type TRII, and kinase-deficient TRII (K277R), as indicated. TRI or TRII constructs were immunoprecipitated (IP) from total lysates with anti-TRI or anti-TRII antibodies, and immunoprecipitates were subjected to SDS-PAGE under reducing conditions. The presence of endoglin was revealed by Western blot (WB) with anti-HA antibodies (-HA). As a control for transfection, recombinant proteins were analyzed in total lysates (TL) by Western blot. A, HA-TMCT-Endo coprecipitates with the kinase-deficient form of TRI (K232R) but not with the constitutively active TRI kinase (T204D). B and C, HA-TMCT-Endo coprecipitates with both wild type (wt) TRII and kinase-deficient TRII (K277R) but shows a different electrophoretic migration in each case. The addition of alkaline phosphatase to immunoprecipitates (rightmost lane), indicates that the lower electrophoretic migration is due to endoglin phosphorylation. It is worth noting that the intensity of the endoglin band associated with the TRII (K277R) is similar to that of the phosphatase-treated sample of TRII (wt), suggesting that the lower intensity displayed by the untreated TRII (wt) immunoprecipitate is probably due to a higher heterogeneity of the associated endoglin band. Results shown in A-C are representative of at least five different experiments.

The Cytoplasmic Domain of Endoglin Is Phosphorylated by TRI and TRII-- A detailed analysis of the bands separated by SDS-PAGE, corresponding to the endoglin cytoplasmic domain, revealed that the electrophoretic mobility of the HA-TMCT-Endo associated with the constitutively active TRII (wild type) was lower than that of the HA-TMCT-Endo associated with the kinase-inactive (K277R) form of TRII (Fig. 5, B and C; upper panels). Similar electrophoretic differences were observed when analyzing the endoglin cytoplasmic domain in total lysates derived from cells overexpressing either the wild type or the constitutively inactive form of TRII, respectively (Fig. 5, B and C; lower panels). It is well known that phosphorylated proteins migrate more slowly that the unphosphorylated forms, suggesting that the electrophoretic differences observed above might be due to different phosphorylation states of endoglin. This interpretation would be compatible with the fact that the migration displayed by HA-TMCT-Endo is dependent on the activation state of the associated kinase. To confirm this hypothesis, co-precipitates of HA-TMCT-Endo and constitutively active TRII were treated or not with alkaline phosphatase. As shown in Fig. 5C, upon phosphatase treatment, endoglin associated with wild type TRII showed an electrophoretic mobility identical to that of endoglin associated with the constitutively inactive TRII, suggesting that endoglin not only associates with TRII but is also a substrate for TRII.

At variance with TRII, no changes in the electrophoretic mobilities among the HA-TMCT-Endo constructs associated with the different versions of TRI were observed (Fig. 5A). Since the cytoplasmic domain of endoglin associates with the kinase-inactive but not with the constitutively active form (Fig. 5A), it is possible that, if phosphorylated by TRI, the endoglin cytoplasmic domain would be detached from the active kinase complex.

To further analyze the phosphorylation of endoglin by the signaling receptors, in vitro and in vivo studies were carried out. First, immunoprecipitates of TRI, TRII, or their mutant forms were incubated with a GST fusion protein containing the cytoplasmic domain of endoglin (GST-Ecyt) in the presence of [-³²P]ATP to allow kinase activity. As shown in Fig. 6A, the active forms of TRI (T204D) and TRII (wild type) are able to phosphorylate the endoglin cytoplasmic domain. The wild type TRI also displays endoglin phosphorylation activity despite the absence of TGF- activation. This is probably due to the TRI activation induced by oligomerization of the signaling receptors that occurs upon transfection (35, 36). By contrast, no significant endoglin phosphorylation was observed in the presence of inactive signaling receptors (TRI/K232R and TRII/K277R), excluding the possible contribution of endogenous signaling receptors due to heteromeric associations with the recombinant constructs. As a negative control for specificity in all samples, no phosphorylation could be observed when using GST alone as a substrate. Next, we analyzed endoglin phosphorylation in vivo. Cells transfected with full-length endoglin and signaling receptors were metabolically labeled with [³²P]orthophosphate, and the phosphorylation state of endoglin was analyzed by immunoprecipitation followed by SDS-PAGE analysis (Fig. 6B). In mock-transfected cells, a basal level of endoglin phosphorylation was observed (lane 2), probably due to the endogenous signaling receptors. Upon transfection with the wild type TRI (lane 6) and TRII (lane 3), a marked increase in endoglin phosphorylation levels could be detected. Also, the constitutively kinase-active TRI (T204D) yielded similar levels of endoglin phosphorylation as the wild type form (data not shown). By contrast, expression of the kinase-inactive forms of TRI (lane 7) and TRII (lane 4) yielded background signals, supporting the specificity of the wild type signaling receptor-induced endoglin phosphorylation. In addition, experiments performed with the truncated form TMCT-Endo, lacking the extracellular domain of endoglin, resulted in a similar phosphorylation pattern by the wild type and mutant forms of the signaling receptors (data not shown), indicating that phosphorylation of endoglin occurs at the serine/threonine-rich cytoplasmic domain.

View larger version (29K): [in this window] [in a new window]   Fig. 6.   Endoglin phosphorylation by TRI and TRII kinases. A, the cytoplasmic domain of endoglin is phosphorylated by TRI and TRII kinases in vitro. COS-7 cells were transiently transfected with HA-tagged wild type TRI kinase, constitutively active TRI kinase (T204D), kinase-deficient TRI (K232R), wild type TRII, and kinase-deficient TRII (K277R), as indicated. Cells were collected 48 h later, and their lysates were immunoprecipitated (IP) with anti-HA antibodies. Immunoprecipitates were incubated with equal amounts of GST or GST-Ecyt proteins in kinase buffer containing [-32P]ATP, and phosphorylation was allowed to proceed. Samples were analyzed by SDS-PAGE followed by autoradiography. The positions of GST and GST-Ecyt are indicated by arrowheads. As a control for transfection, recombinant TRI and TRII proteins were analyzed in total lysates (TL) by Western blot (WB). B, endoglin is phosphorylated by TRI and TRII kinases in vivo. COS-7 cells were transiently transfected with full-length endoglin, wild type TRI kinase, kinase-deficient TRI (K232R), wild type TRII, and kinase-deficient TRII (K277R), as indicated. Cells were metabolically labeled 48 h later with [32P]orthophosphate, lysed, and cell lysates were immunoprecipitated with anti-endoglin antibodies (P4A4 and P3D1). Immunoprecipitates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. As a control for transfection, recombinant endoglin, TRI, and TRII proteins were analyzed in total lysates by Western blot. C, radiolabeled bands from B were quantified by densitometry. The sample number is the same as in B. Results shown in A-C are representative of at least four different experiments.

Endoglin Expression Modulates the Phosphorylation State of TRII and TRI-- The phosphorylation state of TRII and TRI plays a critical role in TGF--induced cell signaling (35, 36). Since endoglin not only associates with these signaling receptors but is also a substrate for their kinase activity, we analyzed whether endoglin expression affected the phosphorylation state of TRII and TRI. Thus, in vivo and in vitro studies were carried out. First, we investigated the effect of endoglin expression on TRII phosphorylation after metabolic labeling with [³²P]orthophosphate. Immunoprecipitation of transfected TRII from endoglin-deficient cells resulted in a broad band (between 70 and 90 kDa) of the autophosphorylated kinase (Fig. 7A), as previously described (35). Similar experiments with cells cotransfected with full-length endoglin yielded a weaker TRII band overlapping with a strong signal at 90 kDa of phosphorylated endoglin (Fig. 7A). Since the overlapping between TRII and endoglin bands interfered with the estimation of TRII phosphorylation levels, we decided to carry out experiments using a smaller endoglin construct, HA-TMCT-Endo, which contains only the transmembrane and cytoplasmic domains. Thus, cotransfection of HA-TMCT-Endo resulted in a marked decrease of TRII phosphorylation levels (Fig. 7, B and C; compare lane 3 with lane 1). As expected, no significant phosphorylation was obtained in the presence of the kinase-inactive mutant of TRII (lane 4). Since TRII is constitutively autophosphorylated (35, 37), we analyzed whether the decrease of TRII phosphorylation levels observed in vivo was due to a decreased autokinase activity of TRII. Thus, anti-TRII immunoprecipitates from cell lysates, containing or not containing full-length endoglin, were incubated with [-³²P]ATP, and the radiolabeled TRII was analyzed by SDS-PAGE (Fig. 7, D and E). As expected, the TRII present in endoglin-deficient cells (lane 2) showed a clear autophosphorylating activity as compared with a negative control (lane 1). Interestingly, co-expression of endoglin resulted in a markedly reduced level of TRII phosphorylation (lane 3), suggesting that endoglin inhibits the autophosphorylation of TRII. As expected, the kinase-inactive mutant showed background levels of phosphorylation either in the presence (lane 4) or in the absence of endoglin (not shown). These results suggest that endoglin expression inhibits the phosphorylation of TRII.

View larger version (29K): [in this window] [in a new window]   Fig. 7.   TRII phosphorylation is diminished in the presence of endoglin. A, COS-7 cells were transiently transfected with HA-endoglin and wild type TRII, as indicated. Cells were metabolically labeled with [32P]orthophosphate and lysed, and cell lysates were immunoprecipitated (IP) with anti-TRII antibodies. Immunoprecipitates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. As a control for transfection, recombinant endoglin and TRII proteins were analyzed in total lysates (TL) by Western blot (WB). B, COS-7 cells were transiently transfected with HA-TMCT-Endo, wild type TRII, and kinase-deficient TRII (K277R), as indicated. Cells were metabolically labeled with [32P]orthophosphate and lysed, and cell lysates were immunoprecipitated with anti-TRII antibodies. Immunoprecipitates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. As a control for transfection, recombinant endoglin and TRII proteins were analyzed in total lysates by Western blot. C, radiolabeled bands from B were quantified by densitometry. The sample number is the same as in B. D, COS-7 cells were transiently transfected with HA-endoglin, wild type TRII, and kinase-deficient TRII (K277R), as indicated. Cell lysates were immunoprecipitated with anti-TRII antibodies, immunoprecipitates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. The data show that the autophosphorylation capacity of TRII kinase is diminished in the presence of endoglin. As a control for transfection, recombinant endoglin and TRII proteins were analyzed in total lysates by Western blot. E, radiolabeled bands from D were quantified by densitometry. The sample number is the same as in D. Results shown in A-E are representative of at least four different experiments.

The phosphorylation state of specific Ser/Thr residues in the TRII is able to regulate its kinase activity (2-4). Since the juxtamembrane and GS regions of TRI are direct substrates for the TRII kinase, we investigated whether the endoglin-dependent modulation of the TRII phosphorylation affected the TRI phosphorylation. Anti-TRII immunoprecipitates from cell lysates, with or without endoglin, were incubated with a recombinant protein containing the juxtamembrane and GS regions of TRI (GST-GS/TRI) in the presence of [-³²P]ATP, and the radiolabeled substrate was analyzed by SDS-PAGE (Fig. 8, A and B). In the absence of endoglin, TRII induced the specific phosphorylation of GST-GS/TRI (lane 2), as compared with a negative control (lane 1). However, upon endoglin expression, a markedly enhanced phosphorylation of the GST-GS/TRI protein was observed (lane 4). These results suggest that endoglin expression leads to an increased phosphorylation of the TRI within the juxtamembrane and GS regions. This observation was confirmed by analyzing the effect of endoglin expression on TRI phosphorylation after metabolic labeling with [³²P]orthophosphate. As depicted in Fig. 8, C and D, the basal phosphorylation levels of TRI (lane 3) were clearly increased when endoglin was cotransfected (lane 4).

View larger version (36K): [in this window] [in a new window]   Fig. 8.   TRI phosphorylation is enhanced in the presence of endoglin. A, phosphorylation of the juxtamembrane and GS regions of TRI in vitro. COS-7 cells were transiently transfected with HA-endoglin and wild type TRII, as indicated. Cell lysates were immunoprecipitated (IP) with anti-TRII antibodies, and immunoprecipitates were incubated with GST or GST-GS/TRI in the presence of [-32P]ATP. Phosphorylated substrates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. The data show that the phosphorylation of the juxtamembrane/GS regions of TRI is increased in the presence of endoglin. As a control for transfection, recombinant endoglin and TRII proteins were analyzed in total lysates (TL) by Western blot (WB). B, radiolabeled bands from A were quantified by densitometry. The sample number is the same as in A. These results are representative of at least four different experiments. C, phosphorylation of TRI in vivo. COS-7 cells were transiently transfected with HA-endoglin and wild type TRI, as indicated. Cells were metabolically labeled with [32P]orthophosphate, lysed, and cell lysates were immunoprecipitated with anti-TRI antibodies. Immunoprecipitates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. As a control for transfection, recombinant endoglin and TRI proteins were analyzed in total lysates by Western blot. D, radiolabeled bands from C were quantified by densitometry. The sample number is the same as in C. These results are representative of at least four different experiments.

Overall, these results indicate that endoglin modulates the phosphorylation levels of both signaling receptors.

Effect of Endoglin on TGF- Signaling-- Since endoglin associates with the signaling receptors and modulates their phosphorylation status, we examined whether endoglin expression affected Smad phosphorylation and TGF- gene responses. In the TGF- signaling pathway, phosphorylation of Smad2 and Smad3 by TRI is a necessary step for downstream signal transduction. Anti-TRI immunoprecipitates from cell lysates, with or without endoglin, were incubated with Smad2, Smad3, or Smad4 recombinant proteins in the presence of [-³²P]ATP, and radiolabeled Smad proteins were analyzed by SDS-PAGE (Fig. 9, A and B). In the absence of endoglin, specific phosphorylation of Smad2 and Smad3 could be observed, whereas the presence of endoglin induced an increased phosphorylation of Smad2 but not Smad3 (Fig. 9B). As expected, no phosphorylation was found in Smad4, which lacks the TRI target sequence within the MH2 domain. Since these results suggest that endoglin expression leads to an increased phosphorylation of Smad2, we investigated the reporter expression of the mix.2 gene promoter, whose activation by TGF-/activin involves the formation of a transcriptional complex composed of Smad2/Smad4 and Fast-1 (26). L₆E₉ cells were transfected with the pARE-lux reporter vector in the absence or in the presence of endoglin (Fig. 9, C and D). Endoglin was able to consistently increase the TGF- responsiveness in a dose-dependent fashion, as analyzed by both absolute activity (Fig. 9C) and -fold induction with respect to untreated samples (Fig. 9D). Interestingly, the basal activity of the pARE reporter vector was inhibited with increasing concentrations of endoglin, consistent with the reported role of endoglin in the absence of exogenous TGF- (38). Taken together, these results suggest that endoglin is able to increase the Smad2-mediated TGF- responses of the mix.2 gene promoter.

View larger version (33K): [in this window] [in a new window]   Fig. 9.   Endoglin modulates downstream TGF- signaling. A, phosphorylation of Smad proteins in vitro. COS-7 cells were transiently transfected with HA-endoglin and wild type TRI, as indicated. Cell lysates were immunoprecipitated (IP) with anti-TRI antibodies, and immunoprecipitates were incubated with GST-Smad2, GST-Smad3, or GST-Smad4 in the presence of [-32P]ATP. Phosphorylated substrates were subjected to SDS-PAGE under reducing conditions, and radiolabeled bands were detected by autoradiography. The data show that the phosphorylation of GST-Smad2 is increased in the presence of endoglin. As a control for transfection, recombinant endoglin and TRI proteins were analyzed in total lysates (TL) by Western blot (WB). The position of the different GST constructs is indicated. B, radiolabeled bands from A were quantified by densitometry. The sample number is the same as in A. These results are representative of at least three different experiments. C and D, analysis of TGF--induced reporter gene expression. L6E9 cells were transiently cotransfected with the pARE reporter construct, Fast-1, and increasing concentrations of an expression vector encoding endoglin. TGF-1 was added 24 h after transfection, and luciferase activity was determined 48 h after transfection. C shows the relative luciferase units of treated and untreated samples; numbers above the open bars indicate the actual values of untreated cells for comparative purposes. D shows the TGF- -fold induction values with respect to untreated controls. This is a representative experiment of four different ones with similar results.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Several laboratories have previously shown that endoglin forms heteromeric complexes with several members of the TGF- signaling receptor family in the presence of ligand (8, 11, 12, 13, 32, 39). Here, we show that full-length endoglin physically interacts with TRI and TRII, and this interaction is not modified by the presence of exogenous ligand or by the activation state of the signaling kinases. This finding is compatible with the existence of ligand-free endoglin forming a complex with ligand-bound signaling receptors (11) as well as with the requirement of signaling receptors for ligand binding to endoglin (11, 12). Also, the direct interaction of endoglin with TRI and TRII is supported by the existence of ligand-independent complexes of endoglin and ALK-1 in endothelial cells (40, 41). We have observed that the formation of the complex endoglin-TRI or endoglin-TRII does not require the presence of TRII or TRI, respectively. This finding agrees with the fact that endoglin is co-immunoprecipitated with TRII·TGF-, ActRII-activin-A, or ActRII-BMP-7 complexes, despite the absence of the corresponding type I receptor in the cell (12). Taken together, these results provide a solid molecular basis for ligand binding to endoglin. Thus, endoglin could bind first to the signaling receptors, and this interaction would then allow ligand access to endoglin.

Generation of a panel of endoglin constructs (Fig. 3) has facilitated a more detailed analysis of the association between endoglin and the signaling receptors. Similar to the wild type endoglin, the mutant forms were expressed as disulfide-linked dimers. Interestingly, mutation of Cys⁵⁸² abrogated the formation of disulfide linkages in the smallest construct (Fig. 3C), indicating its direct involvement in interchain disulfide bonds. Other cysteine residues contained within the endoglin fragment Cys³³⁰-Cys⁴¹² have been previously proposed as candidates in endoglin disulfide formation (29, 42), but Cys⁵⁸² is the first one to be specifically identified.

Analysis on the physical association between endoglin mutants and the signaling receptors has revealed that both the extracellular and cytoplasmic domains participate in this association. Thus, several interaction sites can participate in the formation and stabilization of the endoglin complexes, similarly to the contact sites mapped within the TRI·TRII (34, 43) or betaglycan-TRII (44) complexes. Despite the structural homology between TRI and TRII, they show two major differences in their association with endoglin. First, the interaction of TRII with the extracellular domain of endoglin maps within the transmembrane proximal region 437-558, whereas TRI interacts not only with fragment 437-558, but also with the N-terminal region(s) located above residue 437. Second, the interaction of TRI with the cytoplasmic domain of endoglin can only be detected when its kinase domain is inactive; by contrast, both active and inactive forms of TRII can associate with the cytoplasmic domain of endoglin. Upon interaction with the signaling receptors, the cytoplasmic domain of endoglin is phosphorylated by TRI or TRII. This finding fully agrees with the fact that endoglin is constitutively phosphorylated in Ser/Thr residues (31, 32) and forms heteromeric complexes with the signaling receptors displaying Ser/Thr kinase activity (33, 34). Once phosphorylated by the respective kinase, the cytoplasmic domain of endoglin remains bound to the TRII, whereas it is released from TRI. Since the kinase activity of TRI is only induced in the presence of ligand, these results suggest that the cytoplasmic domain of endoglin dissociates from TRI upon exposure to members of the TGF- family. This is not surprising, since in many enzymatic systems the kinase/substrate association is usually transient. In fact, a similar transient interaction has been described for TRI-mediated phosphorylation of R-Smads (45). In contrast, the association of TRII with the cytoplasmic domain of endoglin seems to be stable even after phosphorylation has occurred. Similarly, phosphorylation of TRI by TRII kinase does not affect the TRI·TRII association (43). Interestingly, at variance with our endoglin data, the interaction of the TRII with the cytoplasmic domain of betaglycan does not occur with a kinase-inactive version of the receptor (44). Since the TRII is constitutively active within the cell (35), our results suggests that the constitutive phosphorylation of endoglin is mainly due to this kinase. Nevertheless, although we find that TRI or TRII is able to phosphorylate endoglin, we cannot exclude the possibility that some of the 19 Ser/Thr residues within the cytoplasmic domain are targeted by additional Ser/Thr kinases. In this regard, putative consensus motifs for protein kinase C and casein kinase have been identified within the cytoplasmic sequence (31) (data not shown).

The high degree of homology between the cytoplasmic domains of endoglin and betaglycan suggests a conserved function/regulation for these domains. Supporting this view, Blobe et al. (44) have described that the cytoplasmic domains of betaglycan and TRII interact specifically, and this interaction results in the phosphorylation of the betaglycan cytoplasmic domain, in agreement with the results shown here for endoglin. Both endoglin and betaglycan contain PDZ class I binding motifs (Ser/Thr-X-Ala/Val) at their homologous cytoplasmic regions. Recently, GIPC was identified as a PDZ domain-containing protein able to interact with betaglycan cytoplasmic domain and regulate TGF- signaling (46), although the possible association of GIPC with the endoglin cytoplasmic region remains to be established.

Endoglin has been shown to modulate cellular responses to TGF-1 (11, 13, 14). However, the molecular mechanism of this modulation is not known. The data shown here suggest that endoglin might regulate TGF- signaling by its direct interaction with the signaling receptors. Recently, betaglycan has been reported to inhibit TGF- signaling by preventing the association between TRI and TRII, an interference mediated by the glycosaminoglycan modification of betaglycan (47). Unlike betaglycan, endoglin does not seem to affect the formation of TRI·TRII complexes (12). This, and the absence of glycosaminoglycan recognition motifs in the endoglin molecule, suggests a functional mechanism for endoglin distinct from that reported for betaglycan (47). Endoglin could regulate either