 |
INTRODUCTION |
Most classes of cellular RNA (tRNA, mRNA, rRNA, and small
nuclear RNA) from all organisms contain post-transcriptionally modified nucleotides. Among these molecules, tRNAs are generally the most modified and contain the largest number of different modified nucleotides (81 different structures reported to date, see Ref. 1).
Although the function of most of these modified nucleotides remains
unclear, the role of modified nucleotides in the anticodon loop of
tRNA, especially at positions 34 and 37, begins to be well documented
(reviewed in Ref. 2 and 3). These modifications usually improve the
fidelity and efficiency of tRNA in decoding the genetic message in the
correct frame on the ribosome.
Pseudouridine (
),1 an
isomer of uridine, is by far the most frequently encountered modified
nucleotide in tRNA. Indeed,
is found almost universally at position
55 in the so-called T
loop and very often at position 13 in the
D-arm and at positions 38 and 39 of the anticodon stem and loop of a
large number of tRNA species from all organisms examined so far (Ref. 4
and also see www.uni-bayreuth.de/departments/biochemie/trna/).
Depending on the species and the origin of the tRNA molecule,
has
been also found at several other positions (for review see Ref. 5). Pseudouridines in tRNA are formed post-transcriptionally by a family of
enzymes called tRNA:
-synthases (6, 7). In Escherichia coli, four tRNA:
-synthases have been characterized so far:
TruA, TruB, and TruC modify uridines at position 38-40 (8), 55 (9), and 65 (10), respectively. RluA catalyzes the formation of
32 in
tRNA and
746 in 23 S rRNA (11). Disruption of truB or
rluA has no discernible effect on exponential growth rate
(as for the truC mutant) but confers a selective
disadvantage in competition with wild-type cells. However, this
phenotype for truB mutant is due to the absence of the
protein TruB and not to the absence of
55 per se (12). In
truA mutant cells, which are unable to modify the uridines
at positions 38, 39, and 40, a decrease in the rate of the
aminoacyl-tRNA selection step during translation depending on the
identity of the tRNA has been demonstrated (13). This observation could
explain the pleiotropic phenotype of truA mutant cells, like
derepression of his, leu, and ilv
operons, reduction of growth, and polypeptide chain elongation rates
(reviewed in Ref. 3). It has not been established whether these
phenotypes are linked to the lack of
in anticodon arm of the tRNA
or to the absence of the TruA protein per se.
In Saccharomyces cerevisiae, four tRNA:
-synthases have
been also characterized. Pus1p catalyzes the formation of
at
positions 26, 27, 28, 34, 35, 36, 65, and 67 in cytoplasmic tRNA (14) as well as position 44 in U2 small nuclear RNA (15). Pus3p, Pus4p, and
Pus6p act at positions 38, 39 (16), 55 (17), and 31 (18), respectively,
in both cytoplasmic and mitochondrial tRNAs (Fig. 1). None of these
identified tRNA:
-synthases in yeast is essential. However,
disruption of PUS3 gene leads to a slower growth rate
phenotype, especially at suboptimal temperatures (16, 19). Moreover,
combined disruptions of the PUS1 and LOS1 genes or the PUS1 and PUS4 genes cause lethality at
increased temperatures (20, 21). Los1p has been characterized as the
tRNA exportin in yeast and is required for the efficient nuclear export
of spliced tRNAs (22, 23). Accordingly, nuclear export of the minor
tRNA
and of a mutant
tRNA
, both substrates of Pus1p, is
impaired in a disrupted pus1 strain. Thus Pus1p is directly
implicated in the nuclear export of at least some tRNA species
(21).
One role of
is to stabilize the conformation of RNA by enhancing
local base stacking (Ref. 24 and reviewed in Ref. 25) and by
coordinating a structured water molecule between its N1-H and the
phosphate backbone (Ref. 26 and reviewed in Ref. 27). Changes in tRNA
structure, such as those induced by defective modification, may affect
the decoding properties of tRNA. For example, lack of
35 in yeast
and plant tRNA
(28, 29) and
38/39/40 in several E. coli tRNAs (Ref. 30 and reviewed
in Ref. 31) affect the misreading, readthrough, and/or +1 frameshift event(s).
Less is known concerning the enzymatic formation of 5-methylcytosine
(m5C) in tRNA. In S. cerevisiae, one single gene
product (Trm4p) catalyzes the formation of m5C at positions
34, 40, 48, and 49 in various cytoplasmic tRNAs (32) (Fig. 1). In
E. coli, none of the tRNAs sequenced so far harbors this
modified nucleotide (4). The role of m5C in tRNA is largely
ignored, except for the unique m5C40 in yeast
tRNA
, which plays an important role in the correct spatial organization of the anticodon arm and the
formation of a Mg2+-binding pocket (Ref. 33 and reviewed in
Ref. 34). Likewise, the unique m5C34 at the wobble position
of the anticodon loop in yeast SUP53 tRNA
affects the efficiency of
amber UAG codon suppression (35).
We have previously described a dual gene reporter that allows the
analysis of the effect of cis- and trans-acting
factors on translational recoding events, like readthrough and
frameshifting (36). This in vivo system has now allowed us
to test the role of specific modified nucleotides in tRNA, formed by
Pus1p, Pus3p, Pus4p, and Trm4p, on the efficiency of stop codons
readthrough and +1 frameshifting in yeast. We have found that the
absence of pseudouridine at positions 38 or 39 causes a detectable
defect on these recoding events.
 |
MATERIALS AND METHODS |
Yeast Strains and Plasmids--
The S. cerevisiae
strains used in this study are W303 (MATa, ade2,
his3-11, 15, leu2-3, trp1-1, ura3-1), FY73
(Mata, his-3
200, ura3-52), BY4742
(Mata, his3
1, leu2
0,
lys2
0, ura3
0), 74-D694 [psi
]
(Mata, ade 1-14, trp1-289, his3
200, leu2-3, 112, ura3-52, [psi
]), 74-D694 [PSI+]
(Mata, ade 1-14, trp1-289, his3
200,
leu2-3, 112, ura3-52, [PSI+]) and their respective derivative
deleted mutants as indicated in Fig. 2 and Table II. Deleted strains
for TRM4 (32) and PUS4 (17) were described
previously. ResGen (Invitrogen, The Netherlands) provided the BY4742
pus1
strain. All mutant pus3
strains were
from this study and are described below. These strains were grown in
minimal media supplemented with the appropriate amino acids to allow
maintenance of the different plasmids. Reporter plasmids were
constructed by cloning a double-stranded oligonucleotide containing the
recoding sequence in the unique MscI site present between
lacZ and luc genes of pAC99 (37). The list of the
oligos is shown in Table I. All constructs were verified by sequencing
the region of interest with an ABI310 automatic sequencer. These
plasmids were transformed into the different yeast strains described
above (refer to figure and table legends) by the lithium acetate method
(38).
Quantification of Recoding Efficiency--
Luciferase and
-galactosidase activities were assayed in the same crude extract as
described previously (36). The assays were carried out using at least
three independent transformants that were grown in the same conditions.
Luciferase/
-galactosidase ratio obtained with test construct is
normalized to the ratio obtained with the in-frame control (pAC-TQ for
readthrough and pAC-TTy for frameshifting) and expresses readthrough or
frameshift efficiency.
Preparation of Disrupted pus3
Yeast Strains--
Yeast mutant
strains bearing a deletion of the PUS3 open reading frame
were prepared by the one-step gene replacement approach (39). The
kanr gene was amplified from plasmid pF6A-kanMX2
by PCR using two oligonucleotides
(CTCGAGGTGCCCACATGCAATCTTTACTGCCCTACTATAACCTCCCTTGACAGCTGAAGCTTCGTACGC and
GAAAAGAAATATAGTCTTCAAGGTTATATTATACAGGTTTATATATTATTGCATAGGCCACTAGTGGATCTG) complementary to the kanMX2 cassette and to 50 nucleotides 5' upstream
and 3' downstream to the PUS3 gene, respectively. The haploid yeast strains BY4742, 74-D694 [psi
] and 74-D694 [PSI+] were made competent by lithium acetate/PEG-4000 treatment and transformed by the purified PCR product. G418-resistant
transformants were analyzed for correct integration by PCR
amplification with specific oligonucleotides.
Cloning of the Wild-type PUS3 Gene and Site-directed
Mutagenesis--
The PUS3 gene and its 5'- and 3'-UTR was
amplified by PCR from total yeast genomic DNA using primers
CCCGAGATTATCCCATTCCAATGAC and ATGAAAAGAAATATAGTCTTCAAGG. The purified
PCR product was cloned at the unique SmaI site of the pRS315
vector. In order to inactivate Pus3p, a mutation was introduced using
an ExSiteTM PCR-based kit (Stratagene), to change an
aspartate residue into an alanine (position 151 of the wild-type
protein) with oligonucleotides gcagatgtggcagaacagccaagggagttagcgcc and
ggcgctaactcccttggctgttctgccacatctgc, where c and g in small
letters and bold indicate the point mutation. The sequence of these two
PUS3 genes was verified. The resulting plasmids were then
transformed into the BY4742 pus3
strain.
32P Labeling of
tRNA
, in Vitro Assay, and
Analysis of Modified Nucleotides--
The gene of the yeast
tRNA
was amplified from
plasmid pUN100-tQ using two complementary oligonucleotides, one bearing
a T7 promoter sequence and the other the MvaI restriction site as described previously (21). In vitro transcription of the substrate tRNA
using
[
-32P]CTP and the in vitro enzymatic assay
for testing formation of modified nucleotides in tRNA transcript were
described previously (40). The yeast S10 extracts were used at 0.2 mg/ml final concentration. The modified synthetic
[
-32P]CTP-tRNA
transcript was phenol-extracted, precipitated, and redissolved in 50 mM NH4 acetate, pH 4.6, for further hydrolysis
with 0.1 units of RNase T2 (Sigma). Each hydrolysate was
chromatographed in two-dimensions on TLC plates (Schleicher & Schuell;
10 × 10 cm) using the chromatographic solvent system N/N
as described previously (40). Radioactive spots were revealed and
quantified after exposure of the plates to a PhosphorImager screen
(Amersham Biosciences).
Immunochemical Assay--
Recombinant Pus3p was expressed in the
E. coli BL21 (DE3) strain and purified from the inclusion
bodies by extraction from a denaturing polyacrylamide
gel.2 Antibodies against
Pus3p were prepared in rabbits by a standard immunization procedure
after three injections of 0.25 mg of recombinant Pus3p per rabbit at
20-day intervals. S10 extracts from different strains (refer to legend
of Fig. 3) were applied onto a 8% acrylamide gel and
electrophoretically separated under denaturing conditions as described
by Laemmli (69). Proteins were transferred onto a polyvinylidene
difluoride membrane (Hybond-P, Amersham Biosciences). Blotting was
performed in 25 mM Tris, 192 mM glycine buffer
for 1 h at 80 V. For immunochemical detection the membrane was
saturated by blocking agent (low fat milk) and incubated with the
polyclonal antibodies against Pus3p. The membrane was then incubated
with the anti-rabbit IgG-alkaline phosphatase conjugate (Sigma).
Alkaline phosphatase activity was revealed using substrates
5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium (Sigma).
 |
RESULTS |
The Test Systems--
Mature transfer tRNA contains a large
variety of modified nucleotides. To test individually their importance
for the accurate translation of the mRNA in S. cerevisiae, we checked two different processes as follows:
codon-anticodon recognition by stop codon readthrough efficiency and
processivity of the decoding process by the occurrence of frameshift
events. Two model systems were used (Table
I). The first one is based on the UAG
readthrough of the TMV replicase cistron and allowed us to measure
readthrough efficiency. This sequence contains a UAG termination codon
embedded in a very peculiar nucleotide context and promotes a high
level of spontaneous termination readthrough in yeast (36, 41). When
the UAG stop codon is replaced by UAA or UGA, high readthrough efficiencies were also obtained (42). The second system is based on the
slippery sequence of the Ty1 retrotransposon, consisting of the
heptanucleotide CUU AGG C, where AGG is a poorly recognized arginine
codon. Slow decoding of this codon provides a translational pause
that allows slippage of the
tRNA
from the leucine codon CUU to
the leucine codon UUA. This results in incorporation of the
major tRNA
in the A+1-site of
the ribosome (43).
The sequences described above were inserted between the
lacZ-luc dual reporter of pAC99 (37), where
lacZ is used as an internal reference for translation
efficiency. With constructs pAC-TMV (UAG), pAC-TAA, and pAC-TGA (see
Table I), ribosomes that terminate at the stop codon express only
-galactosidase, whereas those that read through the termination site
also express luciferase. In pAC-Ty1, the luc gene is fused
in the +1 frame downstream of the frameshift site making luciferase
activity a measure of the efficiency of +1 frameshifting.
Only Deletion of the PUS3 Gene Affects Readthrough and +1
Frameshift Efficiencies--
These constructs were used to transform
various yeast strains that were defective for the activity of a given
tRNA modification enzyme, namely the pus1
,
pus3
, pus4
, and trm4
strains.
The enzymes Pus1p, Pus3p, Pus4p, and Trm4p catalyze the formation of
different modified nucleotides in yeast tRNA (see Fig.
1). Each transformed yeast strain was
grown in minimal medium supplemented with the appropriate amino acids
at 28 °C, and the ratios of luciferase/
-galactosidase activities
were then determined. These results were normalized as described in
Fig. 2 and compared with the ratios
obtained with the corresponding wild-type strains. For each wild-type
strain (indicated in black in Fig. 2), readthrough
efficiencies of the three stop codons ranged between 13 and 25% for
UAG, 8 and 11% for UGA and 5.5 and 7% for UAA, although the
frameshift efficiencies ranged between 22 and 44%. These values are in
good agreement with those obtained with other yeast strains (42) as
well as with another system depending on a lacZ reporter for
Ty1 frameshifting (43). The recorded efficiencies were not
significantly different when wild-type strains are compared with their
corresponding tRNA modification defective mutants (indicated in
white in Fig. 2), except for the pus3
strain.
Compared with the wild-type strain, the readthrough efficiency of the
pus3
strain was reduced by a factor of 1.9, 2.2, or 1.4 on the stop codons UAG, UGA, and UAA, respectively. Moreover, the
pus3
strain was the only mutant strain tested in this
study that reduced the +1 frameshift efficiency on the Ty1 slippery
site by a factor 1.8.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 1.
Type and location of modified nucleotides
catalyzed by Pus1p, Pus3p, Pus4p, and Trm4p in cytoplasmic tRNAs.
Positions of modified nucleotides in tRNA are indicated in
parentheses accordingly to the standard numbering convention
(4). Asterisk ( *) corresponds to the
pseudouridine that is catalyzed by Pus1p and another yet unidentified
pseudouridine synthase (14).
|
|

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of gene deletions
pus1 ,
pus3 ,
pus4 , and trm4
on termination readthrough and Ty1 frameshifting. Wild-type
yeast strain BY4742, 74-D694[psi ], FY73, and W303 and their deleted
derivative strain (pus1 , pus3 ,
pus4 , and trm4 , respectively, as indicated)
were transformed with either pAC-TMV, pAC-TGA, pAC-TAA, pAC-TQ,
pAC-Ty1, or pAC-TTy (see Table I) and grown at 28 °C to reach
A600 = 1.5. Luciferase/ -galactosidase
ratio obtained with pAC-TMV, pAC-TGA, pAC-TAA, or pAC-Ty1 was
normalized to the control ratio (100%) obtained with the in-frame
control (pAC-TQ for readthrough and pAC-TTy for frameshifting). The
normalized luciferase/ -galactosidase ratio (in %) expresses
readthrough efficiency on UAG, UGA, or UAA stop codon and frameshifting
on Ty1-programmed frameshift site. The assays were carried out using at
least three independent transformants. The S.E. of all data presented
in this work is <10%.
|
|
The Reduction of Readthrough Efficiency in the pus3
Strain Is
Solely Due to the Lack of
38/39 in tRNA--
Because readthrough
efficiency was directly influenced by the competition between eRF1 and
the suppressor tRNA in the A-site of the ribosome (44) as well as by
the presence of modified nucleotides in the anticodon arm (reviewed in
Ref. 3), the effect observed with the pus3
strain
suggested that the absence of pseudouridine in position 38 or 39 in
yeast natural suppressor tRNA (no tRNA in yeast harbors
at both
position 38 and 39, see Ref. 4) caused a reduction in their ability to
decode a stop codon. To verify that this effect was actually due to the
absence of
38 or
39 and not to the absence of the Pus3p protein
per se, we introduced a point mutation that changed the
aspartate residue in position 151 into alanine
(pus3[D151A]). This aspartate residue is part of a
characteristic motif among various RNA-pseudouridine synthases (6) and
in particular in E. coli TruA (aspartate residue 60) which
catalyzes the formation of
38/39/40 in bacterial tRNA. Its mutation
into alanine has been shown to abolish the activity of the TruA enzyme
(45).
We first verified that Pus3[D151A]p, when expressed in the
pus3
strain, was unable to catalyze the formation of
38 or
39 in tRNA. S10 extracts prepared from the wild-type and
pus3
strains as well as from the pus3
strain expressing the mutant Pus3[D151A]p protein were used to test
pseudouridine formation in an in vitro transcribed and
[
-32P]CTP-labeled yeast
tRNA
. This tRNA normally bears
several modified nucleotides, among them are pseudouridines at
positions 28, 38, and 55. These pseudouridines can be all formed in vitro and identified as a single radiolabeled spot on
thin layer cellulose plates after two-dimensional chromatography of RNase T2 hydrolysates (21). As shown in Fig.
3, panel A, the S10 extracts
from the wild-type strain modified this tRNA giving rise to 2.1 mol of
pseudouridine per mol of tRNA after 1 h of incubation. In
contrast, the extract from the pus3
strain, which is
unable to modify the uridines at positions 38 or 39 (16), produced only
1.3 mol of pseudouridine per mol of tRNA. Exactly the same result was
obtained with the extract derived from the pus3
cells carrying the pus3[D151A] gene, confirming that the
Pus3[D151A]p protein is catalytically inactive. This was not due to
the instability of the mutant Pus3[D151A]p protein because it was
expressed normally, as verified by Western blot analysis (Fig. 3,
panel B).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 3.
Thermosensitivity of the
pus3 strain is due to the absence
of 38/ 39 in
tRNA. Panel A, in vitro time course
formation of pseudouridine 28, 38, and 55 on T7-transcript of synthetic
tDNA gene (radiolabeled
with [ -32P]CTP) at 30 °C. Incubation was performed
with S10 extracts prepared from a wild-type (WT,
filled circles) and from a pus3 strain
(open circles) both transformed with pRS315, and from a
pus3 strain transformed with pRS315 containing the mutant
pus3[D151A] (open squares). Panel B,
Western blot analysis, using a Pus3p rabbit polyclonal antibody, of S10
extracts of wild-type (WT) and pus3 strains,
both transformed with a pRS315 vector, and pus3 strain
transformed with the same plasmid containing the PUS3 or the
mutant pus3[D151A] gene as indicated. Arrow
indicates the Pus3p protein; M indicates molecular weight
markers in thousands. Panel C, kinetics of growth at
39 °C in minimal media of the same strains as indicated in
panel B.
|
|
The pus3
strain was transformed with a pRS315 centromeric
plasmid harboring either the mutant pus3[D151A] or the
wild-type PUS3 gene under its natural promoter, and the
growth rates of the resulting strains were compared. By taking into
account that the slow growth phenotype of the pus3
strain
was particularly strong at suboptimal growth temperature (16), the
growth rate was measured at 39 °C. From the results shown in Fig. 3
(panel C), generation times of 730 and 190 min can be
estimated for the pus3
and wild-type strains,
respectively. When the wild-type PUS3 gene was expressed in
the pus3
strain, the wild-type growth rate was restored
(black squares in Fig. 3, panel C). In contrast, the mutant pus3[D151A] gene expressed from the same vector
(white squares) was unable to complement the growth defect
of the pus3
strain. This demonstrates that the slow
growth phenotype of pus3
strain is due to the absence of
38 or
39 in the anticodon arm of tRNA.
Next, we tested the readthrough efficiency in the wild-type BY4742
strain, the corresponding pus3
strain, and
pus3
expressing wild-type Pus3p or Pus3[D151A]p. These
four strains were cotransformed with the pAC-TMV vector (UAG stop
codon, see Table I). The results are shown in Fig.
4. Clearly, the readthrough efficiency of
the wild-type strain (21.3%) was restored upon transformation of the pus3
strain with wild-type PUS3 gene (20.3%),
whereas the percentage of readthrough remained the same when
pus3
was transformed with either empty pRS315 or the same
plasmid harboring the pus3[D151A] gene (10.5 and 10.2%,
respectively). The difference in the readthrough efficiencies on the
UAG stop codon between wild-type [psi
] BY4742 (21.3%)
and 74-D694[psi
] (12.7%, Fig. 2) probably reflects the difference of the genetic background between these two strains. However, the reduction in readthrough efficiency on the UAG stop codon
was similar in the corresponding pus3
strains (by a
factor 1.9 in the mutant 74-D694 and 1.8 in the mutant BY4742),
indicating that the effect of the absence of pseudouridine 38 or 39 on
readthrough is independent of a particular genetic background.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of the absence of
38/ 39 in tRNA on UAG
termination readthrough. Readthrough efficiency was measured at
28 °C using the pAC-TMV system. Data (expressed in %, see legend
Fig. 2) correspond to those obtained with wild-type BY4742 (WT) strain
transformed with a pRS315 vector and the BY4742 pus3
strain transformed with empty pRS315 or the same plasmid containing the
PUS3 gene or the mutant pus3[D151A] gene, as
indicated.
|
|
In addition, as for the growth rate, the ratio of readthrough
efficiency in the wild-type strain over the readthrough efficiency in
the pus3
strain was higher at 36 than 28 °C for each
of the three stop codons (compare values in boldface italic in
parentheses in Table II). However, the
absolute values of readthrough efficiencies in each case were lower at
36 than at 28 °C. The effect of temperature on readthrough levels
has been observed previously (37) with similar readthrough-promoting
sequences.
View this table:
[in this window]
[in a new window]
|
Table II
Effect of the PUS3 gene deletion on termination readthrough at 28 or
36 °C in yeast strain BY4742
Wild-type (WT) BY4742 yeast strain and its pus3
derivative strain were transformed with one of the three plasmids
harboring the test sequence as indicated. Stop codons are indicated in
parentheses. Cells were grown at either 28 or 36 °C as indicated.
The frequencies of readthrough are expressed in % (see legend Fig. 2).
Numbers in bold and italic in parentheses indicate ratios of
readthrough efficiency in the wild-type strain over the readthrough
efficiency in the pus3 derivative strain.
|
|
Taken together, these results show that the reduction of readthrough
efficiency in the pus3
strain was due solely to the absence of the catalytic activity of Pus3p, i.e. the lack of
pseudouridine 38 or 39 in the anticodon arm of yeast natural suppressor tRNAs.
Lack of
in tRNA
but Not
in tRNA
and
tRNA
Affects +1
Frameshifting--
The results obtained above (Fig. 2) show that among
the four deletions tested (pus1
, pus3
,
pus4
, and trm4
), only pus3
has an inhibitory effect on the programmed +1 frameshifting, using the
pAC-Ty1 test system. This particular recoding system was demonstrated to depend on the interplay between three different tRNAs (Fig. 5, panel A) as follows:
tRNA
bound at the decoding P-site
of the ribosome, an incoming very minor
tRNA
(46) that normally binds in
the A-site (in-frame), and a major tRNA
(46) that can potentially
bind to the +1 out-of-frame codon (43). It is important to note that the yeast tRNA
, which harbors an
unmodified uridine residue at the wobble position of its
anticodon, can translate all six leucine codons in
vitro, thus both CUU and UUA (47). Therefore, it has been proposed
that at the frameshift site (Leu Arg/Gly)/(CUU-AGG-C), the near-cognate
peptidyl-tRNA
forms 2 bp with
leucine codon CUU and, subsequently, has a certain probability to slip
+1 onto the other leucine codon UUA, probably during transient
occupation of the A-site by the major
glycyl-tRNA
. The probability of
such a frameshift event was shown to depend on the delay (pause) during
translation due to the limiting amount of the incoming
arginyl-tRNA
(Ref. 43 and reviewed
in Ref. 48). Moreover, it has been shown recently (13, 30) that in a
bacterial system the presence or absence of certain modified
nucleotides within the anticodon loop of tRNA also affect the
probability of a frameshift event, possibly by affecting the rate at
which the incoming tRNA in the A-site will be recruited by the
mRNA-peptidyl-tRNA ribosome complex or by affecting the probability
of peptidyl-tRNA slippage in the P-site.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5.
A model for the mechanism of programmed +1
frameshifting in S. cerevisiae. Panel
A, model of +1 frameshifting in recoding site from the yeast
retrotransposon Ty1 (adapted from Ref. 51). The frameshift site is a
heptamer CUU.AGG.C in which CUU is the slippery codon in the P-site
decoded by tRNA , AGG is a poorly
recognized codon by the minor tRNA
in the A-site and GG.C is a codon decoded by the major
tRNA in the A+1-site. Watson/Crick
pairing is indicated by a line and a G.U type of wobble
pairing by a dot. The presence of at position 38 or 39 is indicated next to the tRNA. Panel B, shifty stop
constructs used in this study. Symbols are the same as
above. UGA stop codon is indicated in bold. Purine-purine
clash is indicated by a X, and U* indicates an
unknown modified uridine. eRF1 and eRF3 are the
eukaryotic release factors.
|
|
Inspection of the modified nucleotides content in yeast tRNA reveals
that, among other modified nucleotides,
55 (catalyzed by Pus4p) is
present in all mature cytoplasmic tRNAs;
27 (catalyzed by Pus1p),
39 (catalyzed by Pus3p), and m5C48 (catalyzed by Trm4p)
are present in tRNA
, whereas
38
and m5C49 (catalyzed by Pus3p and Trm4p, respectively) are
present in tRNA
(4).
tRNA
has not been sequenced so
far; however, according to its gene sequence it contains U27, A38, G39,
U48, and G49 (4). Therefore, one can expect the presence of
27 in
the corresponding mature tRNA (14) but not of
38/39 or
m5C48/49. As shown in Fig. 2 and Table
III (2nd line, 3rd column), the absence
of pseudouridine 38 and/or 39 in the pus3
strain reduced
+1 frameshift efficiency by a factor 1.8 (indicated in boldface italic
in Table III) as compared with the wild-type strain, whereas the
absence of the modifications catalyzed by Pus1p or Pus4p or Trm4p, from
the three involved tRNAs
(tRNA
, tRNA
, and
tRNA
) had no effect on the
efficiency of Ty1 + 1 frameshift process. However, because
39 or
38 was present in both tRNA
and
tRNA
(see Fig. 5, panel
A), the role of these pseudouridines in the Ty1 + 1 frameshift
event may be obscured by a possible compensatory effect.
View this table:
[in this window]
[in a new window]
|
Table III
Effect of the PUS3 gene deletion on the +1 frameshift efficiency
Wild-type (WT) and mutant pus3 of 74-D694
[psi ] and 74-D694 [PSI+] strains were transformed with
one of the five plasmids harboring the test sequence as indicated. +1
frameshifting and readthrough efficiencies were measured at 28 °C,
and the data were expressed in % (see legend Fig. 2). Numbers in bold
and italic in parentheses correspond to ratios of recoding efficiency
in the wild-type strain over the recoding efficiency in the
pus3 derivative strain. NA, not applicable.
|
|
To clarify this problem, we used three new programmed +1 frameshift
systems, pAC-FST3, pAC-FST4 ,and pAC-FST5 (Table I and Fig. 5,
panel B). These constructs carry +1 "shifty stops,"
i.e. they consist of a frameshift-inducing codon followed by
an in-frame termination opal codon UGA. The frameshift-inducing codons
used in these constructs (CUU for leucine, CCG for proline, and GCG for
alanine) were chosen because they promote the highest level of +1
frameshifting compared with other codons in yeast (49). According to
previous work, the frameshift-inducing codons CUU, CCG, and GCG will be
read by tRNA
,
tRNA
, and
tRNA
, respectively (43, 50). At
least two of these three tRNAs are abundant (major) tRNAs in yeast
(tRNA
and
tRNA
, see Ref. 46). All three
tRNAs are substrates for yeast Pus3p (16). Moreover, the tRNA that has
to decode the +1 A-site of the ribosome is a major
tRNA
lacking
38 or
39 (Fig.
5, panel B). This allowed us to determine the effect of the
absence of pseudouridine only on the tRNA decoding the
frameshift-inducing codons. The data obtained for the frameshift event
expressed in percent for the wild-type 74-D694 [psi
] and its corresponding pus3
mutant are reported in Table III
(2nd and 3rd columns). The results indicate that in the wild-type
[psi
] strain, the level of frameshifting obtained with
the pAC-FST constructs is very low compared with that observed with the
pAC-Ty1 vector. This result confirms our earlier work with pAC-FST3
(42). However, using the pAC-FST5 (sequence GCG.UGA.C instead of
CUU.UGA.C) in another yeast strain (387-1D), more than
30% frameshift efficiency has been reported (51). These
differences are probably due in part to the different genetic
backgrounds of the yeast strains used in the two studies. When the same
experiments were performed in 74-D694[psi
] cells lacking
Pus3p, a slight reduction of the frameshift efficiency was observed
upon transformation with pAC-FST3, whereas no detectable effect was
measured with either pAC-FST4 or pAC-FST5 (see numbers in boldface
italic in the 3rd column of Table III).
We have demonstrated previously that restricting the availability of
release factors in S. cerevisiae stimulates +1 frameshifting on the slippery site CUU.UGA.C (pAC-FST3, see Ref. 42), most probably by increasing the translational pause in the A-site. In order
to increase +1 frameshift efficiency, we used the yeast strain
74-D694[PSI+], in which the eRF3 termination factor was partially
depleted by aggregation. Readthrough efficiency on the UGA stop codon
in the [PSI+] wild-type and pus3
strains (see pAC-TGA
in Table III) was higher than that observed in the [psi
] strain (see also Fig. 2). However, the effect of the PUS3
gene deletion was approximately the same because the readthrough
efficiency was again reduced by a factor of 1.8. If the absence of
39 in tRNA
had no effect on the
frameshift mechanism in pAC-FST3 (CUU.UGA.C), an increase of the
+1 frameshift efficiency with the system (Leu(
) RF/Asp)/(CUU-UGA-C)
in a pus3
strain could be expected, possibly due to an
increase of the pause in the A-site of the ribosome containing the opal
UGA stop codon. In contrast, by using the 74-D694[PSI+]
pus3
strain, we observed a clear "inhibitory" effect
of the PUS3 gene deletion on the +1 frameshift mechanism
with pAC-FST3 but not with the two other systems tested ((Pro(
)
RF/Asp)/(CCG-UGA-C), pAC-FST4; (Ala(
) RF/Asp)/(GCG-UGA-C), pAC-FST5,
see numbers in boldface italic in the 5th column of Table III).
Noteworthy, the [PSI+] trait does not modify the +1 frameshift
efficiency on the Ty1 slippery site in the wild-type and
pus3
strains (see PAC-Ty1 in Table III), indicating that
aggregation of eRF3 does not interfere with the mechanism of Ty1
frameshifting that occurs at a run of sense codons.
These results show that an unmodified U39 in the slippery
tRNA
reduces +1 frameshift
efficiency, whereas an unmodified uridine residue at position 38 in the
non-slippery tRNA
or
tRNA
has no effect on +1 frameshifting.
 |
DISCUSSION |
Naturally occurring tRNAs contain a variety of modified
nucleotides. The role of these modified nucleotides is not always fully
understood. However, some modified nucleotides in the anticodon arm of
tRNA appear to improve the efficiency of the translational process
(reviewed in Refs. 2 and 3). One way to study in vivo the
role of modified nucleotides is the use of nonsense suppression assays
in mutant strains lacking the gene coding for a given tRNA modification
enzyme (see for example Refs. 52 and 53). In these assays, the
efficiency of suppression of a stop codon is an indication of the
translational activity of a suppressor tRNA.
Another way is the use of programmed frameshift assays, which allow the
determination of the contribution of a modified nucleotide on reading
frame maintenance (13, 30). These systems have been mainly used in
prokaryotes, and only limited data are available for eukaryotic systems.
In this work, we used the dual gene reporter approach (36) to analyze
the effect of trans-acting factors on translational recoding
events in yeast. In particular, we studied the effect of the absence of
a given tRNA modification enzyme on both programmed translational
readthrough and +1 frameshift events, using yeast strains devoid of
Pus1p, Pus3p, Pus4p, or Trm4p activity (see Fig. 1). In this in
vivo system, only the tRNAs that are naturally present in yeast
will lead to stop codon readthrough or +1 frameshifting. Identification
of the so-called natural suppressors harboring a near-cognate
anticodon is not easy, and in fact several concurrent near-cognate
tRNAs can usually bind to a given stop codon, yet with different
efficiencies (for review, see Ref. 54). In yeast, it has been clearly
shown that three naturally occurring tRNAs, specific for tyrosine,
tryptophan, and lysine, can suppress the amber UAG stop codon within a
readthrough site closely related to that of TMV replicase,
tRNA
being the most efficient,
followed by tRNA
, and then
tRNA
(55).
Inhibition of Pseudouridinylation at Position 38 or 39 Leads to Decreased Readthrough Efficiencies--
Among other modified
nucleotides (see Ref. 4), yeast
tRNA
contains
at positions
35, 39, 55, and 5-methylcytosine (m5C) at position 48, tRNA
contains
at positions
26, 27, 28, 39, and 55, and tRNA
contains
at positions 27, 39, and 55. In our experiments, the deletion of the TRM4 gene does not affect readthrough
efficiency on the UAG stop codon in the TMV context. Therefore, the
absence of m5C48 in the m5C-containing
tRNA
does not detectably affect
its suppressor efficiency. However, the lack of an effect in
trm4
cells may also result from stronger competition
by the two other potential natural suppressors
tRNA
and/or
tRNA
. In yeast, all tRNA species contain
at position 55 (except initiator tRNA), which is catalyzed by Pus4p. The absence of an effect on the efficiency of UAG, UGA, and
UAA stop codon readthrough in the pus4
strain indicates
that
55 has no influence on the incorporation of these termination suppressors to the A-site of the ribosome. Alternatively, a possible effect may be compensated by the fact that the tRNAs present in the A-
and the P-site both contain or lack
55. Noteworthy, disruption of
PUS4 (as of TRM4) has no detectable effect on
yeast cell growth (17, 32). Lack of TruB in E. coli, the
homologue of the yeast Pus4p, does not affect the growth rate but
confers a selective disadvantage to the mutant when it is competing
against the wild-type strain. However, this effect was shown to be due
to the absence of the protein itself rather than to the inhibition of
55 synthesis in tRNA (12). We did not obtain an effect on the
efficiency of stop codon readthrough with the yeast pus1
strain, despite the fact that the three natural yeast suppressors of
UAG in the TMV context are all substrates of Pus1p. The presence of
35 in tRNA
was shown to be
necessary for efficient suppression in vitro of the UAG of
TMV RNA (29), probably because it stabilizes the codon-anticodon
interaction (56). However, formation of
35 in
tRNA
remains unaffected in a
pus1
strain, although recombinant Pus1p can catalyze
in vitro the formation of
35 in a transcript of intron-containing tRNA
(14). This is because S. cerevisiae contains a yet unidentified
tRNA:pseudouridine-35 synthase, which has overlapping specificity with
Pus1p (14). The absence of a detectable effect on UAG stop codon
readthrough efficiency within the TMV context after deletion of
PUS1 indicates that
at positions 26-28 in
tRNA
and
at position 27 in
tRNA
does not influence their
competition with tRNA
for reading UAG in the A-site of the ribosome. This conclusion does not
contradict earlier work concerning the importance of the type of base
pair at positions 27-43 of the anticodon helix on suppression readthrough of UAG stop codon by E. coli su7 G36 suppressor
tRNA
(57). In this latter case,
the in vivo suppression test involved suppressor
tRNATrp, which contains the anticodon CUG. As a result, no
competition should take place with other potential natural suppressor
tRNA harboring a near-cognate anticodon. It is also possible that in yeast, the presence of
instead of U at positions 26, 27, and/or 28, although probably stabilizing the anticodon arm (56), has no important
influence on the accuracy of codon reading on eukaryotic ribosomes.
Therefore, the only known function of the Pus1p-catalyzed modifications
remains their involvement in the transport of tRNA from the nucleus to
the cytoplasm (21).
Of the four mutant yeast strains we examined (pus1
,
pus3
, pus4
, and trm4
), only
deletion of the PUS3 gene coding for the tRNA:pseudouridine-38/39 synthase affects cell growth (16). Here we
have shown that the decreased growth rate of the pus3
strain is due to the absence of
at position 38 or 39 in the anticodon arm of tRNA and not to the absence of the Pus3p protein itself. Indeed, a Pus3[D151A]p, which is catalytically inactive, is
unable to restore a wild-type growth rate at 39 °C. This control experiment was essential because the slow growth phenotype of various
strains lacking a modification enzyme is not always correlated to the
absence of the corresponding tRNA modifications, because the enzyme may
be involved in additional functions besides modifying tRNA. For
example, in E. coli the presence of the enzymes TruB or
RluD, two pseudouridine synthases catalyzing
formation at position
55 in tRNA (9) or
at positions 1911, 1915, and 1917 in 23 S RNA
(58), respectively, is required for efficient cell growth. Deletion of
the genes coding for these enzymes led to growth defects. However,
these phenotypes could be complemented by the corresponding mutated
genes, which encoded inactive enzymes (12, 59). Likewise, for the
dimethylase Dim1p, which catalyzes the formation of the conserved
m26A at positions 1779 and 1780 on yeast 18 S rRNA (60), it was demonstrated that the lethality resulting from
deletion of the DIM1 gene was essentially due to a defect in
pre-rRNA processing and not to the lack of m26A
at positions 1779 and 1780 on the mature 18 S rRNA (61).
In yeast, our results clearly indicate that deletion of the
PUS3 gene reduces the readthrough efficiency on all of the
three stop codons UAG, UAA, and UGA within a programmed readthrough TMV
context. This reduction of readthrough efficiency is due to the absence
of
at position 38 or 39 in tRNA, and the effect becomes even more
drastic after increasing the temperature of cell growth to 36 °C.
Because all three yeast natural suppressors of the UAG stop codon
harbor a pseudouridine at position 39, it can be reasonably concluded
that this modification improves the efficiency of tRNA on decoding the
UAG stop codon. The same conclusion was reached for
at positions
38-40 catalyzed by TruA (also called HisT) for the suppression of the
amber stop codon in bacteria. Indeed, the activity of supE
amber suppressor, a derivative of tRNA
in E. coli, was
shown to be almost abolished when
at both positions 38 and 39 were
lacking (53). Similarly, the absence of
at position 39 in
supF, a mutated suppressor
tRNA
in Salmonella
typhimurium, reduced readthrough efficiency on UAG by about 40%
(52). This effect seems to apply also on the misreading process.
Indeed, during histidine starvation of E. coli truA mutants,
a reduction of mistranslation efficiency of histidine codons has been
observed. This effect is probably due to the absence of pseudouridine
in the anticodon arm of tRNA (62). Noteworthy, the aminoacylation capability of tRNAHis was not affected in a truA
mutant (63), and pseudouridines at positions 38, 39, or 40 are not
major identity elements for the aminoacylation systems analyzed so far
(reviewed in Ref. 64). Altogether, these results demonstrate that the
presence of pseudouridine(s) at positions 38, 39, and/or 40 of the
anticodon arm in tRNA facilitates codon reading on the ribosome,
probably by stabilizing the codon-anticodon interaction and that this
property is important in both eukaryotic and prokaryotic cells.
Lack of
38 or
39 in tRNA Influences Ribosome
Frameshifting--
We have used the programmed Ty1 frameshift assay
(Figs. 2 and 5) (36) to test the effect of selected tRNA modifications on maintenance of correct reading frame during the translation process
in yeast. Again, our results indicate that, among the four gene
deletions we tested, pus1
, pus4
, and
trm4
do not affect +1 frameshift efficiency in the Ty1
retrotransposon context. From these results we conclude that absence of
the universally conserved
at position 55 in the three tRNAs
involved (i.e. tRNA
, tRNA
, and
tRNA
, see Fig. 5) has no
detectable effect on the efficiency of +1 frameshifting. The same
conclusion can be reached for the lack of m5C at position
48 in the variable loop of tRNA
, m5C at position 49 at the T-stem of
tRNA
, or the absence of
27 in
tRNA
and probably also in
tRNA
(this mature tRNA has not been sequenced so far). Notably, a +1 frameshift suppressor
tRNA
has been identified in yeast
mitochondria (65). This mutant bears a C to U base change at position
42, thus leading to a G°U wobble at base pair 28-42 of the anticodon
helix. As a consequence of this point mutation, U27 (5'-adjacent to
G28) is no longer modified into
27. It was concluded that the +1
frameshift suppressor phenotype, observed in mitochondrial ribosomes,
might result from the absence of
27 or from the base change at
position 42, or both. However, what is true for the mitochondrial,
prokaryote-like, translation machinery may not necessarily apply to the
cytoplasmic translation process.
In contrast, deletion of PUS3 caused a substantial reduction
of +1 frameshift efficiency in the context of both pAC-Ty1 and pAC-FST3
(see Fig. 5 and Table III). According to previous results (43), the
frameshift event observed with the programmed Ty1 sequence depends on
the ability of peptidyl-tRNA
(a
39-containing tRNA) to slip from the leucine codon CUU in the normal
frame of the P-site to the leucine codon UUA in the P + 1-site. The
probability of this event would depend on the translational pause due
to the limiting amount of the incoming minor
arginyl-tRNA
. In the case of
pAC-FST3, the shift from CUU to the phenylalanine codon UUU in the +1
frame has never been proved. By taking into account that the absence of
39 in the slippery tRNA
evidently weakens the codon-anticodon interaction, as discussed above
for the termination suppression phenomena, we now propose two
non-exclusive alternative explanations for the effect observed in the
pus3
strain. In the first case, the frequency of slipping
of the U39-containing peptidyl-tRNA
is simply reduced,
because the interaction of the UAG anticodon with the +1 near-cognate codon UUA (or UUU) in the P + 1-site of the ribosome is further weakened compared with the in-frame near-cognate codon CUU. In the
second case, the reduced binding affinity of undermodified leucyl-tRNA
for codon CUU in the
incoming A-site of the ribosome allows the minor
tRNA
to be incorporated in place
of tRNA
. Despite the fact that
this minor tRNA
harbors an unusual
C33 instead of U33, it is able to compete with tRNA
for reading the leucine
codons CUU and CUC (50). Once in the P-site, this non-slippery
tRNA
will not allow the ribosome
to shift from the normal to the +1-frame of the mRNA (50).
The two other frameshift systems we studied, pAC-FST4 and pAC-FST5,
depend on a different mechanism. As pointed out before for the Ty3
frameshift system, peptidyl-tRNA
, decoding the alanine GCG codon in the P-site stimulates an out-of-frame binding of a major tRNA in the A+1-site, without itself slipping on the
mRNA (Ref. 50 and reviewed in Ref. 48). The same explanation prevails for peptidyl-tRNA
,
decoding the proline CCG codon in the P-site of the ribosome (50).
Indeed, these two tRNAs cannot slip in the +1 frame, because of a
GXG clash in the middle of the codon-anticodon interaction.
In this frameshift mechanism, the probability of frameshifting may not depend on the strength of the codon-anticodon interaction, as in the
slippery Ty1 mechanism, but rather to other types of interactions. These may be between the two tRNAs, one in the P-site and the other in
the A+1-site, and/or between tRNA and rRNA. Whatever the mechanism, the
absence of an effect with pAC-FST4 and pAC-FST5 in the
pus3
strain favors the idea that
38 has no influence on this type of RNA-RNA interactions.
Unlike our observations with the yeast pus3
strain,
mutation of the truA gene, the homologue of PUS3,
in S. typhimurium has been shown to increase +1 frameshift
efficiency of a shifty stop programmed recoding system. This
effect was observed for a tRNA decoding the leucine codon CUA in the
P-site of the ribosome (30). It is important to note that a different
set and relative abundance of tRNALeu, harboring distinct
patterns of modified nucleotides (including
in the anticodon arm),
exists in E. coli (and possibly in S. typhimurium) and in S. cerevisiae (66, 67). Therefore,
it can be suggested that in S. typhimurium the lack of
in the CUA cognate tRNALeu allows another more
frameshift-inducing competitor tRNA, possibly one of the other
near-cognate tRNALeu, to be incorporated in the A-site of
the ribosome. The competition between these two tRNAs in S. typhimurium would be analogous to the one we discussed above
between tRNA
and
tRNA
on the programmed Ty1
frameshift event in yeast, except that in our case the absence of
39
in tRNA
might favor the
incorporation of the non-frameshift inducing competitor
tRNA
in the A-site of the
eukaryotic ribosome.
Altogether, our results demonstrate that the presence of pseudouridine
at position 38 or 39 in tRNA enhances termination readthrough and +1
frameshifting in yeast. It is also noticeable that the growth of
pus3
mutant cells is impaired. These observations
strongly support the idea that translational accuracy is optimal ra