|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 35, 31567-31576, August 30, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Immunology Division, Department of Pediatrics, Faculty of
Medicine, Université de Sherbrooke,
Sherbrooke, Quebec J1H 5N4, Canada
Received for publication, March 20, 2002, and in revised form, June 17, 2002
Desensitization of G-protein-coupled
receptors may involve phosphorylation of serine and threonine
residues. The leukotriene B4 (LTB4)
receptor (BLT1) contains 14 intracellular serines and threonines, 8 of
which are part of consensus target sequences for protein kinase C (PKC)
or casein kinase 2. In this study, we investigated the importance of
PKC and GPCR-specific kinase (GRK) phosphorylation in BLT1
desensitization. Pretreatment of BLT1-transfected COS-7 cells with PKC
activators caused a decrease of LTB4-induced inositol
phosphate (IP) accumulation. This reduction was prevented with the PKC
inhibitor, staurosporine, and not observed in cells expressing a BLT1
deletion mutant (G291stop) lacking the cytoplasmic tail. Moreover
LTB4-induced IP accumulation was significantly inhibited by
overexpression of GRK2, GRK5, and especially GRK6, in cells expressing
wild type BLT1 but not in those expressing G291stop. GRK6-mediated
desensitization correlated with increased phosphorylation of BLT1. The
G319stop truncated BLT1 mutant displayed functional characteristics
comparable with wild type BLT1 in terms of desensitization by GRK6, but
not by PKC. Substitution of Thr308 within a putative casein
kinase 2 site to proline or alanine in the full-length BLT1 receptor
prevented most of GRK6-mediated inhibition of LTB4-induced
IP production but only partially affected LTB4-induced BLT1
phosphorylation. Our findings thus suggest that Thr308 is a
major residue involved in GRK6-mediated desensitization of BLT1 signaling.
Leukotriene B4
(LTB4)1 is a
powerful inflammatory mediator derived from lipoxygenation of
arachidonic acid. It is rapidly synthesized by phagocytic cells,
principally neutrophils, upon challenge with a variety of stimuli (1).
LTB4 exerts a wide range of biological actions, such as
neutrophil chemotaxis, chemokinesis, aggregation, degranulation, and
induction of cation fluxes (reviewed in Ref. 2). We and others have
also shown LTB4 to modulate immune responses, including
transcription of interleukin-2 receptor- In 1997, a high affinity human LTB4 receptor (BLT1) was
cloned (6, 7). It is a 352-amino acid protein with less than 36%
homology with other receptors, suggesting that it belongs to a separate
G protein-coupled receptor (GPCR) subfamily. Recently, a second human
receptor for LTB4 (BLT2) was cloned and shown to have lower
affinity for LTB4 and wider tissue distribution (8, 9). The
recent development of mice with disrupted BLT1 suggests a major role
for BLT1 in acute inflammation and immediate hypersensitivity as well
as in leukocyte functions such as chemotaxis and firm adhesion to
endothelium in response to LTB4 (10, 11). Devchand and
collaborators (12) have also shown that LTB4 can bind to the peroxisome proliferator-activated receptor The BLT1 signaling pathway involves the activation of phosphoinositide
(PI)-specific phospholipase C (PLC)- After exposure to an agonist, cellular responses to subsequent stimuli
are usually attenuated; this phenomenon is known as desensitization
(18). Agonist stimulation through GPCRs is regulated at different
levels; homologous desensitization is rapid and involves uncoupling
from the G-protein, Ser/Thr phosphorylation of the ligand-occupied
receptor by GPCR-specific kinases (GRKs), and binding of members of the
arrestin family, which could act as adaptors between the receptor and
components of the internalization machinery (18). Although receptor
phosphorylation does not seem to be a prerequisite to arrestin binding,
it has been shown to promote their association and receptor
internalization via clathrin-coated vesicles (19, 20). The internalized
receptors are then exposed to phosphatases and to the acidic
environment of the early vesicles, which usually leads to ligand
dissociation, receptor resensitization, and, eventually, recycling to
the cell surface. A percentage of the receptors, instead of
recycling to the cell surface, can be targeted to lysosomes, which
leads to down-regulation of the number of receptors and requires
synthesis of new receptors for complete cellular resensitization
(21).
Other kinases such as protein kinase C (PKC) and protein kinase A,
activated during the signaling cascade, also play a role in the
modulation of the cellular response by directly phosphorylating receptors and other components of signalization (22-26). These second
messenger-dependent kinases mediate homologous as well as
heterologous desensitization, since receptors that did not trigger
their activation may also be targeted. GPCRs, like BLT1, can contain
motifs of recognition by casein kinases (CKs) in their intracellular
loops and cytoplasmic tail. The CK1 Rapid desensitization of BLT1 signaling is observed after stimulation
with LTB4. This may involve early uncoupling of the receptor from its transductional elements, followed, in some cells, by
down-regulation of high affinity LTB4 receptors; this
latter stage may involve phosphorylation of the receptor or associated proteins, since PKC activation by other routes also down-regulates LTB4 binding sites (30). Reexpression of receptors on the
cell surface is rapid and appears to be associated with recycling of internalized receptors in certain cell types (31). LTB4
receptors can undergo both agonist- and phorbol ester-induced
desensitization (31-34). In vivo desensitization has also
been demonstrated in rabbit neutrophils after LTB4 exposure
(32).
As deduced from its amino acid sequence, BLT1 contains a GPCR
signature, no consensus tyrosine kinase phosphorylation site, two
consensus CK2 phosphorylation sites at positions
Ser200/Ser202 and
Thr308/Ser310, and multiple serine and
threonine residues in the cytoplasmic loops and C-terminal tail. Six of
them (Ser125, Ser216, Thr219,
Ser314, Thr315, and Thr324) are
within consensus phosphorylation sites for PKC. Whereas accumulating
data have allowed definition of a consensus recognition site for CK,
none has been established for GRKs. However, both types of kinases
share a preference for Ser/Thr residues within an acidic environment
(reviewed in Refs. 18 and 35).
Little is known about the structure/function elements of BLT1. In the
present study, we examined the potential contribution of PKC and GRK in
heterologous and homologous desensitization of BLT1. We identified a
structural determinant essential for LTB4-induced BLT1
desensitization mediated by GRK6.
Reagents--
cDNAs encoding G Construction of Myc-tagged Wild Type (WT) and Mutant
Receptors--
The cloning of WT BLT1 cDNA in the pJ3M expression
vector (36) was previously described (13). In this construction, the N-terminal initiator methionine was replaced by the Myc sequence MEQKLISEEDLSRGSPG, resulting in a Myc epitope-tagged BLT1 protein. Each
mutant BLT1 is identified by the original amino acid followed by the
residue number, which is replaced by a stop codon or substituted for
another amino acid. The C-terminal deletion mutant G291stop was
constructed using a cassette formed by two oligonucleotidess: G291stop-FWD (5'-CGCGTGCGCCGGCGGCTAGCA-3') and G291stop-RVS
(5'-GATCTGCTAGCCGCCGGCGCA-3'). This product was subcloned into the
MluI and BglII restriction sites of pJ3M-WT BLT1,
eliminating the cytoplasmic tail. The G319stop mutant receptor was
constructed using PCR amplification with the BLT1-FWD (13) and the
G319stop-RVS (5'-GGCCGGGCCCACTACCCTCGGCGCGTGCTGGACGCCTCGG-3') or
the SST/A-RVS (5'-
GCTGCCCCCGCGGCGCGCGGCGGCCGCCTCGGAACCCGTGCCCTCTAGCAGCTTGGC-3').
In order to construct the following mutant BLT1 (T308P/S310A, T308P,
and S310A), the sequence encoding the cytoplasmic tail of BLT1 was
first transferred into the pUC31 vector. New unique restriction sites
were available, and a cassette generated by the annealing product of
the two primers T308P/S310A-RVS
(5'-GGCGCGTGCTGGAGGCCTCGGCCCCGGGGCCCTCCAGCAGC-3') and T308P/S310A-FWD
(5'-CTGGAGGGCCCCGGGGCCGAGGCCTCCAGCACGCGCCGC-3') replaced the
original sequence, which substituted amino acids Thr308 and
Ser310, respectively, for proline and alanine. The
introduction of silent SmaI and StuI restriction
sites allowed us to use this construction to create the single
mutations T308P, T308A, and S310A, using, respectively, the following
sets of primers: T308P-RVS (5'- CCTCGGAACCGGGGCCCTCCAGCAGC-3') and T308P-FWD (5'-CTGGAGGGCCCCGGTTCCGAGG-3'), T308A-RVS
(5'-CCTCGGAACCGGCGCCCTCCAGCAGC-3') and T308A-FWD
(5'-CTGGAGGGCGCCGGTTCCGAGG-3'), and S310A-RVS (5'- CCTCGGCACCCGTGCCCTCCAGCAGC-3') and S310A-FWD
(5'-CTGGAGGGCACGGGTGCCGAGG-3'). The C-tail containing the
mutations was then subcloned into pSP64-BLT1 WT, generating the
full-length receptor containing the specific mutation. cDNAs
of mutant receptors were then sequenced (University of Calgary,
Alberta, Canada) to confirm proper incorporation of stop codon or amino
acid substitution and integrity of the receptor sequence. cDNAs
corresponding to WT and truncated mutant BLT1 receptors were then
cloned into the pcDNA3 vector (Invitrogen, Carlsbad, CA). GRK2
(37), GRK3 (38), GRK5 (39, 40), and GRK6 (41) cDNAs were also in
pcDNA3. The human G Cell Culture and Transfection--
COS-7 cells were grown in
Dulbecco's modified Eagle's medium with high glucose, supplemented
with 5% fetal bovine serum and gentamicin sulfate (40 µg/ml). For
transfection, cells were plated in 30-mm dishes (2.0 × 105 cells/dish) and transiently transfected, the following
day, with constructions encoding WT or mutant BLT1 in combination with
cDNA of G Radioligand Binding Assay--
COS-7 cells expressing WT or
mutant BLT1 receptors were harvested and washed twice in
phosphate-buffered saline and twice in Hepes-Tyrode's buffer
containing 0.1% (w/v) bovine serum albumin (45) in which cells were
also resuspended for the assay. Competition binding curves were carried
out on 2 × 105 cells with 0.25 nM
[3H]LTB4 and increasing concentrations of
nonradioactive LTB4 for 2 h at 4 °C. Free
radioactivity was separated from cells by centrifugation and a double
wash with 1 ml of Hepes-Tyrode's buffer. Radioactivity contained in
the cell pellet was counted in a scintillation Inositol Phosphate Determination--
Transiently transfected
COS-7 cells were labeled and stimulated with LTB4, IP were
extracted, and radioactivity was counted as described previously (13).
In some experiments, cells were pretreated with PKC activators
(mezerein, phorbol esters (4 Phosphorylation--
Forty-eight hours after transfection, cells
were washed twice with Tris-buffered saline and then radiolabeled with
[32P]orthophosphate (50 µCi/dish) for 2 h at
37 °C, in phosphate-free modified Eagle's medium, pH 7.4. Agonist
was applied as indicated in the figure legends in the presence of the
phosphatase inhibitor calyculin A (10 nM). Treatment was
stopped by transferring the plates onto ice, removing the medium, and
washing once with ice-cold Tris-buffered saline. Cells were harvested
with 1 ml of Tris-buffered saline, followed by a brief centrifugation.
The supernatant was then discarded, and cells were immediately used for immunoprecipitation.
Immunoprecipitation--
Cells were lysed in 500 µl of
radioimmunoprecipitation assay buffer (50 mM Tris-Cl, pH
7.5, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, 5 mM EDTA, 1 µg/ml leupeptin, 5 µg/ml aprotinin, 10 µg/ml soybean trypsin inhibitor, 100 µg/ml
4-(2-aminoethyl)-benzenesulfonyl fluoride, 40 µg/ml
1-chloro-3-tosylamido-7-amino-2-heptanone, 1 mM
Na3VO4, 10 nM calyculin A). Samples
were precleared for 45 min at 4 °C using Protein A-Sepharose.
Supernatants were collected and incubated for 1 h with anti-Myc
antibody (9E10 hybridoma; American Tissue Culture Collection, Manassas,
VA). The mixture was then incubated for 2 h at 4 °C with 50 µl of Protein A-Sepharose with gentle mixing. Protein A-Sepharose was
pelleted by brief centrifugation, washed three times in
radioimmunoprecipitation assay buffer, and resuspended in SDS-PAGE
sample loading buffer (2% SDS, 50 mM Tris-HCl, pH 6.8, 10% glycerol, 5% Flow Cytometry Studies--
COS-7 cells transiently transfected
with the Myc-tagged WT or mutant BLT1 receptors were subjected to flow
cytometry analysis. 2.5 × 105 cells were labeled, as
previously described (13), with anti-Myc, followed by incubation with
fluorescein isothiocyanate-conjugated goat anti-mouse IgG antibody
(Bio/Can Scientific, Mississauga, Ontario, Canada). All measures
were performed on a FACScan flow cytometer (Becton-Dickinson).
Statistical Analysis--
Data were analyzed for statistical
significance using Student's paired t test or analysis of
variance, as appropriate. Differences were considered significant at
p < 0.05.
In the present study, we used a cotransfection system in COS-7
cells to define the signaling pathways involved in heterologous and
homologous desensitization of BLT1. In addition, we defined a
structural determinant of BLT1, which is targeted by a specific GRK.
Binding Characteristics--
COS-7 cells were transiently
transfected with cDNAs for WT BLT1 or constructions of BLT1 in
which either the receptor was truncated or specific residues were
substituted (Fig. 1). Cell surface
expression of WT and mutant receptors was confirmed by flow cytometry
using an antibody directed against the Myc tag at the N terminus of
each receptor. No specific labeling or 3H-LTB4
binding could be detected on whole cells transfected only with
pcDNA3 (data not shown). On the other hand, whole cells expressing WT and mutant forms of BLT1 showed specific
[3H-LTB4]binding, which was displaced in a
concentration-dependent manner by unlabeled
LTB4 (0-500 nM). The nonlinear regression analysis of these competition binding curves revealed the presence of
one class of binding sites exhibiting high affinity for
LTB4 (dissociation constant (Kd) = 1.01 ± 0.13 nM). Moreover, the addition of the Myc
epitope did not alter the affinity for LTB4 as compared
with the reported Kd (6, 46, 47). Compared with the
WT receptor, all mutant receptors displayed similar affinity for the
LTB4. Similar Bmax values were also
observed, ranging from 1.5 × 104 to 2.8 × 104 sites, with the exception of the mutant G291stop, which
was expressed at higher levels. Binding characteristics are shown in
Table I.
Ligand-induced IP Production--
As previously shown (13),
LTB4 induces a significant increase in IP accumulation in
COS-7 cells cotransfected with BLT1 and G
Pretreatment of these cells with the nonphorbol PKC activator mezerein
caused a time- and concentration-dependent inhibition of
ligand-induced IP accumulation (Fig. 2,
A and B). It reached 30-40% of inhibition at 60 min at 1 µM mezerein and was prevented by concomitant
treatment with the PKC inhibitor, staurosporine (Fig. 2C).
Similar findings with 4
As part of the general regulation of BLT1 responsiveness, homologous
desensitization of BLT1 signaling has been demonstrated in various
systems and models (32-34). We further investigated the mechanism
involved in this homologous inactivation of BLT1 by targeting specific
GRKs. The expression of the GRK2, -3, -5, and -6 was assessed by
Western blot analysis of a total cell lysate from transfected COS-7
cells (Fig. 3A), indicating
that equal amounts of transfected cDNA resulted in similar
expression levels of GRKs. When COS-7 cells were cotransfected with
either GRK2, -3, -5, or -6, together with BLT1 and G BLT1 Determinants Involved in GRK6-mediated
Desensitization--
To further define the structural elements
involved in BLT1 desensitization, we constructed two deletion mutant
receptors (G291stop and G319stop) and compared them with WT receptor.
The G291stop mutant receptor, with complete removal of the C terminus
tail, was deprived of three of the six potential PKC phosphorylation sites as well as one of the two potential CK2 sites, whereas the G319stop was deprived of only one of the potential PKC sites (Fig. 1).
Ligand binding studies on COS-7 cells transfected with equal amounts of
cDNA encoding for either the G291stop mutant receptor or the WT
BLT1 showed higher numbers of binding sites in the former, whereas the
affinity was identical (Kd, 1.01 ± 0.15 versus 1.01 ± 0.13 nM, respectively)
(Table I).
Ligand-induced IP accumulation was markedly enhanced in G291stop as
compared with WT BLT1 (Fig. 5,
A and B). Not only was the maximal accumulation
of IP 3-fold greater than in cells expressing the WT receptor, but a
significant increase in IP production was seen at concentrations of
LTB4 as low as 0.01 nM, at which the WT BLT1
was unresponsive. This enhanced IP production was evident whether cells
were cotransfected with G
Interestingly, pretreatment of G291stop-expressing cells with PMA
failed to reduce ligand-induced IP production (Table II), suggesting
that all significant phorbol-dependent PKC phosphorylation sites had been removed in the G291stop mutant receptor. Moreover, overexpression of GRK6 did not impair G291stop mutant receptor signaling in terms of LTB4-induced IP accumulation (Fig.
5C).
In contrast, the G319stop mutant receptor responded to LTB4
in a manner similar to WT BLT1, in terms of IP production (Fig. 6, A and B), except
that the G319stop was also able to respond to lower concentrations of
LTB4. G319stop mutant was inhibited by GRK6 overexpression
to a degree similar to WT BLT1 (Fig. 6C). This suggested
that the segment of BLT1 between amino acids 291 and 319 was essential
for desensitization by GRK. This segment contains two potential PKC
phosphorylation sites and a potential CK2 consensus site (Fig. 1). The
candidate phosphorylation site for LTB4-triggered
homologous desensitization of BLT1 thus appeared to be the CK2 site,
which could also be used by GRKs.
We used site-directed mutagenesis to disrupt the CK2 site and examine
its potential implication in GRK6-mediated BLT1 desensitization. Threonine 308 and serine 310 were changed to proline and alanine, respectively. In addition to an increased IP production compared with
the WT receptor (data reported in the legend to Fig.
7), the T308P mutant receptor was totally
resistant to GRK6-mediated desensitization of IP accumulation
(93.8 ± 5.2% of control without GRK6), in contrast to WT BLT1
(33.2 ± 3.1%) in response to 100 nM LTB4
(Fig. 7). The double mutation, T308P/S310A, was equally resistant to
desensitization by GRK6 (88.5 ± 8.4%) (Fig. 7). On the other
hand, the single S308A mutation had no significant effect (47.1 ± 5.8%), showing an inhibition similar to that of the WT BLT1. Since
changing Thr308 to proline may have affected the general
conformation of the C tail, we also substituted it for alanine. The
T308A mutant receptor, when coexpressed with GRK6, was also resistant
to desensitization (80.6 ± 2.5%), albeit to a lesser degree than
T308P (Fig. 7).
GRK6 Phosphorylates BLT1--
It is well accepted that
agonist-dependent desensitization by GRKs is mediated by
their phosphorylation of the occupied receptor (18). To this end, we
sought to determine whether GRK6-mediated inhibition of BLT1 IP
response involved phosphorylation of BLT1, since Thr308 is
essential for BLT1 desensitization. COS-7 cells expressing BLT1 were
metabolically labeled with [32P]orthophosphate and
exposed to 100 nM LTB4. BLT1 was then
immunoprecipitated, and the phosphorylation of BLT1 was visualized by
autoradiography (Fig. 8). Only a slight
increase in BLT1 phosphorylation was observed upon agonist stimulation
when cells were transfected with BLT1 cDNA alone (Fig. 8,
lanes 5 and 6). Phosphorylated BLT1
proteins were observed as a diffuse band between 48 and 98 kDa, which
represents differentially N-glycosylated forms of
BLT1.2 The coexpression of
GRK6 led to an increase in BLT1 phosphorylation (Fig. 8A,
lanes 7 and 8). In contrast to its
strong effect on desensitization by GRK6, substitution of
Thr308 to alanine only marginally reduced GRK6-mediated
phosphorylation of BLT1 (Fig. 8A, lanes
11 and 12). These findings suggest that GRK6-mediated, agonist-dependent, phosphorylation of BLT1
and desensitization of its response in terms of IP production may involve different structures.
In the present study, we investigated the structural elements
involved in the heterologous and homologous desensitization of the
human high affinity LTB4 receptor. We have shown that GRK6 targets Thr308 within a putative CK2 site to alter BLT1
responsiveness in COS-7 cells.
When LTB4 binds to BLT1, it purportedly changes the
conformation of the receptor leading to the activation of PI-specific PLC- GPCR phosphorylation by serine and threonine kinases is commonly
associated with desensitization, be it homologous, ligand-induced desensitization or heterologous desensitization resulting from cross-talk with other receptors or from PKC activation. Analysis of
BLT1 amino acid sequence revealed numerous putative consensus sites for
PKC ((S/T)XR) (50), suggesting that BLT1 might be subjected
to regulation by PKC. As a result of PKC activation, partial but
significant reduction of BLT1-mediated IP production was observed. Our
data are in accordance with results obtained in neutrophils and
eosinophils in which PKC activation potently inhibited agonist-mediated
BLT1 responsiveness (30, 31, 33, 51). Furthermore, removing three of
the six putative intracellular PKC sites, by truncation of the
cytoplasmic tail, generated a mutant receptor (G291stop) totally
resistant to PMA-induced inhibition of LTB4-triggered IP
production. These results indicate that BLT1 signaling via the PLC As with the platelet-activating factor and chemokine receptors
expressed in rat basophil leukemia (RBL-1) cells, phosphorylation of
one or more components of the signaling pathway may account for a major
part of heterologous desensitization (23, 24, 26). In fact, several
components of the signaling machinery have been shown to be modulated
by second messenger-activated kinases: G-proteins (22, 25) and PLC Results obtained with the G291stop mutant receptor suggest that
desensitization through activation of PKC might act directly at the
receptor protein level, targeting structural determinants of the
cytoplasmic tail of BLT1. Interestingly, the putative PKC phosphorylation sites located upstream of the cytoplasmic tail, within
the intracellular loops of BLT1, appear not to be implicated in this
heterologous desensitization.
As with many GPCRs, it would appear that GRKs are involved to a major
degree in agonist-dependent BLT1 desensitization. Our data
demonstrate that BLT1 signaling can be inhibited by both second
messenger-activated kinases and specific GRKs. Overexpression of GRKs
in COS-7 cells, which express lower GRK levels than other cell lines
(52), revealed BLT1 as a substrate for GRK2, GRK5, and especially GRK6.
We and others have shown that promyelocytic HL-60 cells differentiated
toward the monocyte/macrophage or neutrophil lineages developed
specific high affinity receptors for LTB4 (47, 53). This
increased expression of BLT1 correlates with higher levels of GRK2 and
GRK6 mRNA in myeloid cells (54). Consequently, we further
investigated structural elements involved in BLT1 regulation by GRK6.
Compared with GRK2/3, GRK6 has been demonstrated to play a major role
in attenuation of receptor signaling in only a small group of GPCRs,
including the Whereas overexpression of GRK6 could readily inhibit
LTB4-induced IP production by WT BLT1 as well as by the
partially truncated G319stop mutant, it had no effect on G291stop BLT1
mutant. These findings indicated that a segment (residues 291-319) of
the carboxyl terminus, which includes several Ser/Thr residues,
contained the main site(s) of regulation involved in GRK6-mediated
desensitization of BLT1.
Since several potential phosphorylation sites are distributed
throughout the intracellular segments of BLT1, as seen with other GPCRs
(18), the C-tail, and the third intracellular loop appeared as probable
targets for kinases to mediate receptor desensitization. Our initial
results with truncated receptors showed, however, that desensitization
of BLT1 was largely dependent on a proximal portion of the C-tail.
Hence, we attempted to identify specific residues targeted by GRK6. CK1
and -2 phosphorylate Ser and Thr within an acidic environment (35, 50).
Moreover, CK1 GRK2/3 have substrate specificities similar to CK (18, 50, 60), whereas
GRK5 and GRK6 prefer Ser and Thr residues downstream of basic amino
acids (18, 60). Moreover, Hall et al. (61) have mapped the
phosphoacceptor site for GRK6 involved in constitutive phosphorylation
of the nonreceptor protein NHERF, which totally correlates with
previous phosphopeptide mapping studies (60, 61). GRK subtype
preferences, however, may not be always restricted to such
environmental specificities, as observed by Oppermann and collaborators
(62). They noticed that GRK3 could target phosphoacceptor
residues not confined to the vicinity of acidic amino acids in the
chemokine receptor CCR5 and, consequently, proposed that the general
conformation of the receptor may be as important in substrate
specificity as the environment of the phosphoacceptor residues. In this
context, GRK6 could easily use the putative CK2 site in the 291-319
segment of BLT1. Cotransfection studies using point mutations of BLT1
within this segment indicated that Thr308 was crucial for
GRK6-mediated desensitization.
Although CK inhibitors did not affect BLT1 desensitization, we cannot
rule out the possibility that CK2 is involved in some form of
regulation of BLT1 function or responsiveness. Little information is
available on GPCR regulation by CKs in comparison with the numerous
substrates identified for CK2 (reviewed in Ref. 35) and other CK
subtypes. Tobin and collaborators (27) have shown that CK1 Interestingly, mutating residue Thr308 to proline (T308P)
completely prevented GRK6-mediated desensitization of BLT1 signaling. Proline residues are frequently found in transmembrane Several lines of evidence indicate that GRKs interact with regions of
the receptor that may be distinct from their site of phosphorylation,
as elegantly proposed by Pitcher et al. (18). Assessment of
the phosphorylation of BLT1 suggested that substitution of
Thr308 only partially prevented GRK6-mediated
phosphorylation of the receptor as compared with the WT. If
Thr308 was the only target of GRK6, mutating this site to
alanine would be expected to produce a receptor resistant to
GRK6-mediated desensitization and phosphorylation. However, GRK6 did
phosphorylate the T308A mutant receptor, suggesting the presence of
other phosphoacceptor residues, which may not be necessarily linked to
desensitization. In another system, epinephrine-induced phosphorylation
of the Recently, it was shown that serine and threonine residues in the C-tail
of the type 1 dopamine receptor (D1R) can be sorted according to their
ability to participate in D1R desensitization or internalization (66).
By extrapolation, phosphorylation of other cytoplasmic residues of BLT1
may be related to other functions, such as receptor internalization.
Direct evidence for a role of GRKs in LTB4-induced BLT1
phosphorylation and function in leukocytes may have to await the
availability of selective GRK inhibitors. It must be noted, however,
that GRK overexpression in COS-7 cells was not able to completely
abrogate LTB4-induced BLT1-mediated signaling, suggesting
that homologous desensitization could involve other events independent
of GRK6-mediated phosphorylation.
In conclusion, our findings in the present study indicate that: 1) the
cytoplasmic tail of BLT1 is not involved in ligand binding, G-protein
coupling, or PLC activation but contains elements that regulate
homologous and heterologous desensitization; 2) PKC activators inhibit
LTB4-induced IP production; 3) consensus PKC sites in the C
terminus tail of BLT1, but not those located within the intracellular
loops, are required for heterologous desensitization; 4) GRK6-mediated
BLT1 desensitization is dependent on the 291-319 segment of the C
terminus tail; 5) amino acid substitution of phosphoacceptor
Thr308 within the putative CK2 site practically abolishes
GRK6-induced desensitization of BLT1; and 6) in contrast to
GRK6-mediated desensitization, GRK6 phosphorylation of BLT1 is not
restricted to residue Thr308.
We have defined a region within BLT1, involved in
ligand-dependent, GRK6-mediated desensitization, and have
identified Thr308 as the crucial targeted amino acid.
*
This work was supported by the Medical Research Council of
Canada and by a Studentship from the Fonds pour les Chercheurs et
l'Aide à la Recherche (to R. G.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, June 20, 2002, DOI 10.1074/jbc.M202723200
2
R. Gaudreau, J. Harris, M. Rola-Pleszczynski,
and J. Stankova, manuscript in preparation.
The abbreviations used are:
LTB4, leukotriene B4;
CK, casein kinase;
G-protein, GTP-binding regulatory protein;
GPCR, G-protein-coupled
receptor;
GRK, GPCR kinase;
IP, inositol phosphate(s);
PI, phosphoinositide;
PKC, protein kinase C;
PLC, phospholipase C;
PMA, phorbol 12-myristate 13-acetate;
WT, wild type.
Threonine 308 within a Putative Casein Kinase 2 Site of the
Cytoplasmic Tail of Leukotriene B4 Receptor (BLT1) Is
Crucial for Ligand-induced, G-protein-coupled Receptor-specific
Kinase 6-mediated Desensitization*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
, interleukin-6, and
c-fos in NK cells and monocytes (2-5).
with low affinity and may have a role in activating genes that terminate
inflammatory processes.
via pertussis toxin-sensitive (Gi/Go) and pertussis
toxin-resistant (G16, G14) heterotrimeric
guanine nucleotide-binding regulatory proteins (G-proteins) (6, 13).
Hydrolysis of phosphatidylinositol 4,5-bisphosphate yields inositol
phosphates (IP) and diacylglycerol; inositol 1,4,5-trisphosphate
triggers the subsequent increase in intracellular Ca2+
concentration, a major player in the signaling pathway of BLT1 (6,
14-17).
was shown to act as a GRK for
the muscarinic M1 and M3 receptors (27, 28). Although Hanyaloglu and
collaborators (29) reported that phosphorylation of CK2 sites of the
thyrotropin-releasing hormone receptor is necessary for
-arrestin-dependent receptor internalization, there is
no clear evidence, as yet, for a role for CK2 in either receptor activation or desensitization of other GPCRs.
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
14,
G16, and PLC2 were generous gifts from
Dr. M. I. Simon (California Institute of Technology,
Pasadena, CA); the pJ3M expression vector (36) was a generous gift
from Dr. J. Chernoff (Fox Chase Cancer Center, Philadelphia, PA).
cDNAs encoding GRK2, -3, -5, and -6 were generous gifts from Dr.
Jeffrey Benovic (Thomas Jefferson University, Philadelphia, PA). Other materials and their sources were as follows: LipofectAMINE, Geneticin, and all culture media from Invitrogen; 4-(2-aminoethyl)-benzenesulfonyl fluoride, aprotinin, bovine serum albumin, calyculin A, leupeptin, mezerein, phorbol 12-myristate 13-acetate (PMA), Protein A-Sepharose, soybean trypsin inhibitor, staurosporine,
1-chloro-3-tosylamido-7-amino-2-heptanone, and Triton X-100 from Sigma;
broad range molecular weight markers and Bio-Rad protein assay from
Bio-Rad; casein kinase 2 inhibitor 5,6-dichloro-1--D-ribofuranosylbenzimidazole, and
PKC inhibitor GF109203X from Calbiochem; fetal bovine serum from
BIO MEDIA Canada Inc., Drummondville, Quebec, Canada; FuGENE-6
Transfection reagent, Pwo polymerase from Roche
Molecular Biochemicals; restriction endonuclease from Promega (Madison,
WI); T4 DNA ligase, [32P]orthophosphate, and
[3H]myo-inositol from Amersham Biosciences;
LTB4 from Cayman Chemical, Ann Arbor, MI; perchloric acid
from VWR Canlab, Ville Mont-Royal, Quebec, Canada; fluorescein
isothiocyanate-conjugated goat anti-mouse antibody from BIO/CAN
Scientific, Mississauga, Ontario, Canada; gentamicin sulfate from
Schering Canada Inc., Pointe-Claire, Quebec, Canada; CK1 inhibitor
N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide from
Toronto Research Chemicals Inc. (North York, Ontario, Canada).
16 and murine G14
and PLC2 cDNAs were contained in the pCIS and pMT2
under the cytomegalovirus promoter, respectively (42-44).
16, G14, or
PLC2. In some experiments, cDNA encoding GRK2, -3, -5, or -6 were also added, as indicated in the figure legends. Using 4 µl of LipofectAMINE or 2 µl of FuGENE-6 per dish, 0.2 µg of each
cDNA was used for IP studies and 1 µg of cDNA for flow cytometry analysis. In binding assays, 2 µg of cDNA were used to
transfect 1.2 × 106 cells plated in Petri dishes.
Experiments were performed 48 h after transfection. Total
transfected cDNA quantities were adjusted, for each experiment,
with the pcDNA3 vector DNA.
counter. Nonspecific
binding represented less than 10% of total binding with 500 nM nonradioactive LTB4.
-PMA or the inactive form 4-PMA)) or
inhibitors (staurosporine, GF109203X) at the indicated concentrations
and times or with CK1 or CK2 inhibitors (N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide, 50 µM, 30 min;
5,6-dichloro-1--D-ribofuranosylbenzimidazole, 10 µM, 30 min).
-mercaptoethanol, and 0.1% bromphenol blue).
Phosphorylated proteins were separated by SDS-PAGE and visualized by
autoradiography, and receptor phosphorylation was analyzed using NIH
Image software (obtained from the National Institutes of Health Web
site: rsb.info.nih.gov/nih-image). Gel image was scanned and imported
into NIH Image from Adobe Photodeluxe (Adobe Systems, San Jose, CA).
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
View larger version (22K):
[in a new window]
Fig. 1.
Schematic representation of the predicted
secondary structure of WT and truncated BLT1 mutants. Each
open circle represents an amino acid residue identified by a
single letter. White-on-black letters indicate potential
phosphorylation sites (Ser/Thr residues); arrows and
asterisks identify putative PKC and CK2 phosphorylation
sites, respectively, whereas the remaining Ser/Thr residues have not
yet been linked to any known consensus sequence. Sites of truncation
are marked by solid bars, and the corresponding truncated
mutants (G291stop, G319stop) were constructed as described under
"Materials and Methods."
Binding characteristics of WT and modified BLT1 receptors
16. Since BLT1
contains six potential phosphorylation sites for PKC and two potential
sites for CK2, we first confirmed previous studies on the involvement
of a second messenger-activated kinase in the heterologous
desensitization of BLT1 signaling.
-PMA (Table II)
indicated that the effect was mediated by PKC but was not dependent on
the phorbol moiety. These results suggested a partial role for PKC in
regulating BLT1 signal transduction and suggested that other kinases
would participate to a greater extent. Recently, protein kinase CK1 was shown to be involved in the phosphorylation and regulation of the
m3-muscarinic receptor (27, 28). We therefore assessed the involvement
of CK in BLT1 signal transduction; treatment of cells with the CK2
inhibitor
5,6-dichloro-1--D-ribofuranosylbenzimidazole or
the CK1 inhibitor
N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide before
stimulation with LTB4 failed to modify the IP response (data not shown).
View larger version (24K):
[in a new window]
Fig. 2.
Effects of PKC activator mezerein on
LTB4-induced IP accumulation. COS-7 cells transiently
coexpressing WT BLT1 and G 16 were pretreated with
mezerein or Me2SO (DMSO) as vehicle, followed by
a stimulation with 100 nM LTB4 for 30 min at
30 °C. A, time course inhibition using 1 µM
of mezerein; B, concentration-dependent
inhibition by mezerein during a 60-min treatment; C, effect
of the addition of staurosporine (1 µM) immediately
before mezerein (1 µM) or Me2SO. IP were
extracted and measured as described under "Materials and Methods."
Data represent IP accumulation following LTB4 stimulation,
above basal (nonstimulated) levels and are relative to levels obtained
in cells pretreated with vehicle and stimulated with LTB4
(defined as 100%). Values are the means ± S.E. of three
independent experiments, each done in duplicate. Treatments in
A and B were significant (p < 0.05) as determined using analysis of variance. *, p < 0.05; ***, p < 0.001 compared with control values
(A and B) or Me2SO-treated cells
(C).
Effects of PMA treatment on LTB4-induced IP accumulation
16 were pretreated with 4-PMA (100 nM) or its inactive form 4-PMA (as a control) and then
stimulated with 100 nM LTB4 for the indicated time.
Total IP were extracted as described under "Materials and Methods."
Data represent IP accumulation over basal (nonstimulated) levels and
are relative to those obtained in cells pretreated with 4-PMA
(defined as 100%). The results are the means ± S.E. of at least
three independent experiments, each done in duplicate except for the
G319stop, which was done once in triplicate. ***,
p < 0.001. ND, not determined.
16,
LTB4-mediated IP accumulation was markedly inhibited in a
time- and concentration-dependent manner (Fig. 3,
B-D). A maximal inhibition of 72% was observed in
GRK6-overexpressing cells stimulated with 100 nM
LTB4. The inhibition of IP accumulation by GRK6 (Fig.
4B) was directly related to
the amount of cDNA transfected (Fig. 4A).
View larger version (27K):
[in a new window]
Fig. 3.
Effects of GRK overexpression on
LTB4-induced IP accumulation in COS-7 cells.
A, representative Western blot of GRKs overexpression in
COS-7 cells. B, cells transiently coexpressing WT BLT1
together with G 16 and either GRK2, -3, -5, -6, or
pcDNA3 (as control) were tested for IP production in response to
100 nM LTB4 for 30 min. C, IP
accumulation measured in COS-7 cells coexpressing WT BLT1 and
expressing G16 with either GRK6 or pcDNA3 in a time
course study. D, a concentration-response study using graded
concentrations of LTB4. Values are means ± S.E. of
3-6 independent experiments, each done in duplicate. They are
expressed as percentage of IP accumulation in WT BLT1-expressing cells
stimulated with 1 µM LTB4, defined as 100%.
*, p < 0.05; **, p < 0.01; ***,
p < 0.001 versus pcDNA3-transfected
cells.
View larger version (35K):
[in a new window]
Fig. 4.
Effects of increasing amounts of GRK6 protein
on LTB4-induced IP accumulation in COS-7 cells. Cells
transiently coexpressing WT BLT1 and G 16 together with
increasing amounts of transfected GRK6 cDNA or pcDNA3 (as
control) were subjected to Western blot analysis (A) or
tested for IP production in response to 100 nM
LTB4 for 30 min (B). Data represent IP
accumulation following LTB4 stimulation, above basal
(nonstimulated) levels and are relative to levels obtained in cells
pretreated with vehicle and stimulated with LTB4 (defined
as 100%). Values are means ± S.E. of three independent
experiments, each done in duplicate. *, p < 0.05.
16, G14, or
PLC2 cDNAs (Fig. 5B).
View larger version (18K):
[in a new window]
Fig. 5.
Effects of complete truncation of the
cytoplasmic tail of BLT1 on LTB4-induced IP accumulation,
G-protein coupling, and receptor desensitization. A,
concentration-dependent IP accumulation in COS-7 cells
transiently expressing the WT or G291stop BLT1 in presence of
G 
16 subunit. B, IP accumulation in COS-7
cells transiently cotransfected with WT or G291stop BLT1 in combination
with G16, G14, or PLC2
cDNA. C, concentration-dependent IP
accumulation in COS-7 cells transiently expressing G291stop BLT1 in the
presence of G16 subunit, in addition to either GRK6 or
pcDNA3. Total IP were measured following a 30-min stimulation with
LTB4. IP quantification was as described under "Materials
and Methods." Values in A and C are expressed
as percentage of IP accumulation in WT BLT1-expressing cells stimulated
with 1 µM LTB4, defined as 100%. The results
are representative of three or more independent experiments, each point
done in duplicate. *, p < 0.05; **, p < 0.01 versus WT BLT1-transfected cells.
View larger version (18K):
[in a new window]
Fig. 6.
Effects of partial truncation of cytoplasmic
tail of BLT1 on LTB4-induced phosphorylation and IP
accumulation. IP accumulation in COS-7 cells transiently
expressing WT (A and B) or G319stop BLT1
(B and C) in presence of G 16
subunit and GRK6 or pcDNA3 (C) was determined following
a 30-min stimulation with 100 nM LTB4
(A) or in response to increasing concentrations of
LTB4 (B and C). IP quantification was
done as described under "Materials and Methods." Values are
expressed relative to IP accumulation in WT BLT1-expressing cells
stimulated with 1 µM LTB4, defined as 100%.
The results are representative of at least three independent
experiments, each point done in duplicate.
View larger version (55K):
[in a new window]
Fig. 7.
Effects of GRK6 on LTB4-induced
IP accumulation in cells expressing point mutant BLT1. IP
accumulation in COS-7 cells transiently coexpressing WT, T308A, S310A,
T308P, or T308P/S310A, and G 16, in addition to either
GRK6 or pcDNA3, was measured following a 30-min stimulation with
100 nM LTB4. Total IP were extracted and
quantified as described under "Materials and Methods." Values are
means ± S.E. of at least three independent experiments, each done
in duplicate. They are expressed relative to IP accumulation in
pcDNA3-transfected cells, stimulated with 100 nM
LTB4, defined as 100%. Values expressed relative to IP
accumulation in WT BLT1-expressing cells are as follows: T308P
(140.5 ± 14.8%), T308P/S310A (115.7 ± 10.9%), S310A
(126.8 ± 19.7%), and T308A (104.4 ± 10.8%). *,
p < 0.05; **, p < 0.01; ***,
p < 0.001 versus pcDNA3-transfected
cells.
View larger version (57K):
[in a new window]
Fig. 8.
LTB4-induced phosphorylation of
BLT1. COS-7 cells were transiently transfected with pcDNA3 or
the epitope-tagged WT or T308A BLT1 and G 16 in addition
to either GRK6 or pcDNA3; were metabolically labeled with
[32P]orthophosphate; and then were stimulated for 15 min
with 100 nM LTB4 in presence of the phosphatase
inhibitor calyculin A (10 nM). Reactions were stopped by
placing samples on ice. Receptors were immunoprecipitated as described
under "Materials and Methods" and analyzed by SDS-PAGE and
autoradiography. Shown are a representative autoradiogram
(A) and quantification of results by densitometry
(B) representing phosphorylation levels of
LTB4-stimulated cells over nonstimulated, expressed as
means ± S.E. of four independent experiments.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
via pertussis toxin-sensitive (Gi/Go)
and resistant (G16) G-proteins (6, 13). Hydrolysis
of phosphatidylinositol 4,5-bisphosphate to IP and
diacylglycerol with subsequent increase of intracellular Ca2+ concentrations is a major signaling pathway of BLT1
(6, 14-17). Ligand-induced desensitization of this signaling pathway
as well as the associated responses (chemotaxis, secretory, and
respiratory burst) has been extensively studied in inflammatory cells
(32-34, 46, 48, 49). For instance, Goldman and Goetzl (46) showed that
leukocyte deactivation by prior exposure to LTB4 led to a loss of high affinity binding sites associated with a decrease in the
chemotactic response to LTB4. In addition, in
vivo deactivation of BLT1 signaling was achieved in rabbits under
prolonged infusion of LTB4, which completely prevented
subsequent neutrophil migration induced by a bolus injection of
LTB4 (49). Nevertheless, little is known regarding which
regulators mediate the desensitization of BLT1 and which structural
determinant(s) of the receptor are involved.
pathway does not require any of the structural determinants found in
the C terminus tail of BLT1. On the other hand, structural elements
important for regulation of this BLT1 signaling pathway are present in
the C terminus.
isoforms (23, 26). This multilevel regulation of signaling confers to
the cross-desensitization of chemoattractant receptors all of its
complexity (reviewed in Ref. 24).
-opioid, calcitonin gene-related peptide, and
follicle-stimulating hormone receptors (55-58). Observations that
LTB4 induced only low levels of BLT1 phosphorylation in
COS-7 cells transiently expressing the receptor could also be
attributed to the low level of endogenous GRKs (52).
Overexpression of GRK6 further increased BLT1 phosphorylation,
which was dependent on LTB4 stimulation. This suggested
that GRK6 affected BLT1 both through inhibition of ligand-induced IP
response and through ligand-activated phosphorylation of the receptor.
has been proposed to influence m3-muscarinic receptor
signaling (28). In our system, however, selective inhibitors of CK1 and
CK2 had no detectable effect on IP accumulation, suggesting that these kinases are not implicated in modulation of BLT1 signaling. The eventual importance of the CK2 sites in the C-tail and in the third
intracellular loop of BLT1 remains to be determined.
phosphorylates the m3-muscarinic receptor as well as rhodopsin in a
stimulus-dependent manner. Recently, another paper has
highlighted a potential role for CK in regulation of GPCR signaling.
Internalization of a fusion protein of GnRH and TRH receptors was based
on the presence of CK2 sites located within its intracellular
C-terminal domain promoting arrestin-2-dependent sequestration of the chimera (29).
-helix and
can induce a kink in the helix backbone by 26° and thus impact the
global structure of the protein. This finding further supports the
proposition of Oppermann and collaborators (62), in that conformation
strongly influences desensitization of GPCRs.
1B-adrenergic receptor by GRK6 did not correlate
with attenuation of receptor signaling in COS-7 cells (63). However, in
several cases, clusters of serine and threonine residues have been
mapped for their contribution to desensitization (64, 65). As with the
2-adrenergic receptor (65), BLT1 desensitization may not be dependent on a single residue. Our findings suggest that
Thr308 is not the only site targeted by GRK6
phosphorylation, whereas it appears to be the major site for
GRK6-mediated desensitization of BLT1 signaling.
FOOTNOTES
To whom correspondence should be addressed: Immunology Division,
Dept. of Pediatrics, Faculty of Medicine, Université de Sherbrooke, 3001 N. 12th Ave., Sherbrooke, Quebec J1H 5N4, Canada. Tel.: 819-346-1110 (ext. 14851); Fax: 819-564-5215; E-mail:
mrolaple@courrier.usherb.ca.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
1.
Borgeat, P.,
and Samuelsson, B.
(1979)
J. Biol. Chem.
254,
2643-2646 2.
Rola-Pleszczynski, M.
(1985)
Immunol. Today
10,
302-307[CrossRef]
3.
Stankova, J.,
Gagnon, N.,
and Rola-Pleszczynski, M.
(1992)
Immunology
76,
258-263[Medline]
[Order article via Infotrieve]
4.
Rola-Pleszczynski, M.,
and Stankova, J.
(1992)
Blood
80,
1004-1011 5.
Stankova, J.,
Dupuis, G.,
Gagnon, N.,
Thivierge, M.,
Turcotte, S.,
and Rola-Pleszczynski, M.
(1993)
J. Immunol.
150,
4041-4051[Abstract]
6.
Yokomizo, T.,
Izumi, T.,
Chang, K.,
Takuwa, Y.,
and Shimizu, T.
(1997)
Nature
387,
620-624[CrossRef][Medline]
[Order article via Infotrieve]
7.
Owman, C.,
Sabirsh, A.,
Boketoft, A.,
and Olde, B.
(1997)
Biochem. Biophys. Res. Commun.
240,
162-166[CrossRef][Medline]
[Order article via Infotrieve]
8.
Yokomizo, T.,
Kato, K.,
Terawaki, K.,
Izumi, T.,
and Shimizu, T.
(2000)
J. Exp. Med.
192,
421-432 9.
Kamohara, M.,
Takasaki, J.,
Matsumoto, M.,
Saito, T.,
Ohishi, T.,
Ishii, H.,
and Furuichi, K.
(2000)
J. Biol. Chem.
275,
27000-27004 10.
Haribabu, B.,
Verghese, M. W.,
Steeber, D. A.,
Sellars, D. D.,
Bock, C. B.,
and Snyderman, R.
(2000)
J. Exp. Med.
192,
433-438 11.
Tager, A. M.,
Dufour, J. H.,
Goodarzi, K.,
Bercury, S. D.,
von Andrian, U. H.,
and Luster, A. D.
(2000)
J. Exp. Med.
192,
439-446 12.
Devchand, P. R.,
Keller, H.,
Peters, J. M.,
Vazquez, M.,
Gonzalez, F. J.,
and Wahli, W.
(1996)
Nature
384,
39-43[CrossRef][Medline]
[Order article via Infotrieve]
13.
Gaudreau, R., Le,
Gouill, C.,
Metaoui, S.,
Lemire, S.,
Stankova, J.,
and Rola-Pleszczynski, M.
(1998)
Biochem. J.
335,
15-18[Medline]
[Order article via Infotrieve]
14.
Lew, P. D.,
Dayer, J. M.,
Wollheim, C. B.,
and Pozzan, T.
(1984)
FEBS Lett.
166,
44-48[CrossRef][Medline]
[Order article via Infotrieve]
15.
Shefcyk, J.,
Yassin, R.,
Volpi, M.,
Molski, T. F.,
Naccache, P. H.,
Munoz, J. J.,
Becker, E. L.,
Feinstein, M. B.,
and Sha'afi, R. I.
(1985)
Biochem. Biophys. Res. Commun.
126,
1174-1181[CrossRef][Medline]
[Order article via Infotrieve]
16.
Goldman, D. W.,
Chang, F. H.,
Gifford, L. A.,
Goetzl, E. J.,
and Bourne, H. R.
(1985)
J. Exp. Med.
162,
145-156 17.
Andersson, T.,
Schlegel, W.,
Monod, A.,
Krause, K. H.,
Stendahl, O.,
and Lew, D. P.
(1986)
Biochem. J.
240,
333-340[Medline]
[Order article via Infotrieve]
18.
Pitcher, J. A.,
Freedman, N. J.,
and Lefkowitz, R. J.
(1998)
Annu. Rev. Biochem.
67,
653-692[CrossRef][Medline]
[Order article via Infotrieve]
19.
Lohse, M. J.,
Andexinger, S.,
Pitcher, J.,
Trukawinski, S.,
Codina, J.,
Faure, J. P.,
Caron, M. G.,
and Lefkowitz, R. J.
(1992)
J. Biol. Chem.
267,
8558-8564 20.
Gurevich, V. V.,
Dion, S. B.,
Onorato, J. J.,
Ptasienski, J.,
Kim, C. M.,
Sterne-Marr, R.,
Hosey, M. M.,
and Benovic, J. L.
(1995)
J. Biol. Chem.
270,
720-731 21.
Tsao, P.,
Cao, T.,
and von Zastrow, M.
(2001)
Trends Pharmacol. Sci.
22,
91-96[Medline]
[Order article via Infotrieve]
22.
Fields, T. A.,
and Casey, P. J.
(1995)
J. Biol. Chem.
270,
23119-23125 23.
Ali, H.,
Fisher, I.,
Haribabu, B.,
Richardson, R. M.,
and Snyderman, R.
(1997)
J. Biol. Chem.
272,
11706-11709 24.
Ali, H.,
Richardson, R. M.,
Haribabu, B.,
and Snyderman, R.
(1999)
J. Biol. Chem.
274,
6027-6030 25.
Cunningham, M. L.,
Filtz, T. M.,
and Harden, T. K.
(1999)
Mol. Pharmacol.
56,
265-271 26.
Richardson, R. M.,
Pridgen, B. C.,
Haribabu, B.,
and Snyderman, R.
(2000)
J. Biol. Chem.
275,
9201-9208 27.
Tobin, A. B.,
Totty, N. F.,
Sterlin, A. E.,
and Nahorski, S. R.
(1997)
J. Biol. Chem.
272,
20844-20849 28.
Budd, D. C.,
McDonald, J. E.,
and Tobin, A. B.
(2000)
J. Biol. Chem.
275,
19667-19675 29.
Hanyaloglu, A. C.,
Vrecl, M.,
Kroeger, K. M.,
Miles, L. E.,
Qian, H.,
Thomas, W. G.,
and Eidne, K. A.
(2001)
J. Biol. Chem.
276,
18066-18074 30.
O'Flaherty, J. T.,
Redman, J. F.,
and Jacobson, D. P.
(1990)
J. Cell. Physiol.
142,
299-308[CrossRef][Medline]
[Order article via Infotrieve]
31.
O'Flaherty, J. T.,
Redman, J. F.,
and Jacobson, D. P.
(1986)
FEBS Lett.
206,
279-282[CrossRef][Medline]
[Order article via Infotrieve]
32.
Showell, H. J.,
Naccache, P. H.,
Borgeat, P.,
Picard, S.,
Vallerand, P.,
Becker, E. L.,
and Sha'afi, R. I.
(1982)
J. Immunol.
128,
811-816[Abstract]
33.
Dryden, P.,
Allen, B.,
Wong, S.,
Reaney, A.,
Merali, T.,
and Salari, H.
(1992)
Prostaglandins
44,
11-24[CrossRef][Medline]
[Order article via Infotrieve]
34.
Chung-a-on, K. O.,
Soyombo, O.,
Spur, B. W.,
and Lee, T. H.
(1996)
Br. J. Pharmacol.
117,
1334-1340[Medline]
[Order article via Infotrieve]
35.
Allende, J. E.,
and Allende, C. C.
(1995)
FASEB J.
9,
313-323 36.
Sells, M. A.,
and Chernoff, J.
(1995)
Gene (Amst.)
152,
187-189[CrossRef][Medline]
[Order article via Infotrieve]
37.
Benovic, J. L.,
DeBlasi, A.,
Stone, W. C.,
Caron, M. G.,
and Lefkowitz, R. J.
(1989)
Science
246,
235-240 38.
Benovic, J. L.,
Onorato, J. J.,
Arriza, J. L.,
Stone, W. C.,
Lohse, M.,
Jenkins, N. A.,
Gilbert, D. J.,
Copeland, N. G.,
Caron, M. G.,
and Lefkowitz, R. J.
(1991)
J. Biol. Chem.
266,
14939-14946 39.
Kunapuli, P.,
and Benovic, J. L.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5588-5592 40.
Premont, R. T.,
Koch, W. J.,
Inglese, J.,
and Lefkowitz, R. J.
(1994)
J. Biol. Chem.
269,
6832-6841 41.
Benovic, J. L.,
and Gomez, J.
(1993)
J. Biol. Chem.
268,
19521-19527 42.
Amatruda, T. T., III,
Steele, D. A.,
Slepak, V. Z.,
and Simon, M. I.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
5587-5591 43.
Wilkie, T. M.,
Scherle, P. A.,
Strathmann, M. P.,
Slepak, V. Z.,
and Simon, M. I.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10049-10053 44.
Strathmann, M.,
and Simon, M. I.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
9113-9117 45.
Honda, Z.,
Takano, T.,
Gotoh, Y.,
Nishida, E.,
Ito, K.,
and Shimizu, T.
(1994)
J. Biol. Chem.
269,
2307-2315 46.
Goldman, D. W.,
and Goetzl, E. J.
(1984)
J. Exp. Med.
59,
1027-1041
47.
Patry, C.,
Müller, E.,
Laporte, J.,
Rola-Pleszczynski, M.,
Sirois, P.,
and Brum-Fernandes, A. J.
(1996)
Prostaglandins Leukotrienes Essent. Fatty Acids
54,
361-370[CrossRef][Medline]
[Order article via Infotrieve]
48.
Wrinkler, J. D.,
Sarau, H. M.,
Foley, J. J.,
Mong, S.,
and Crooke, S. T.
(1988)
J. Pharmacol. Exp. Ther.
246,
204-210 49.
Marleau, S.,
Fortin, C.,
Poubelle, P. E.,
and Borgeat, P.
(1993)
J. Immunol.
150,
206-213[Abstract]
50.
Kennelly, P. J.,
and Krebs, E. G.
(1991)
J. Biol. Chem.
266,
15555-15558 51.
Montero, M.,
Garcia-Sancho, J.,
and Alvarez, J.
(1994)
Biochem. J.
303,
559-566[Medline]
[Order article via Infotrieve]
52.
Tsuga, H.,
Okuno, E.,
Kameyama, K.,
and Haga, T.
(1998)
J. Pharmacol. Exp. Ther.
284,
1218-1226 53.
Goldman, D. W.,
Olson, D. M.,
Payan, D. G.,
Gifford, L. A.,
and Goetzl, E. J.
(1986)
J. Immunol.
136,
4631-4636[Abstract]
54.
Loudon, R. P.,
Perussia, B.,
and Benovic, J. L.
(1996)
Blood
88,
4547-4557 55.
Neill, J. D.,
Duck, L. W.,
Musgrove, L. C.,
and Sellers, J. C.
(1998)
Endocrinology
139,
1781-1788 56.
Willet, J.,
and Kelly, E.
(2001)
Eur. J. Pharmacol.
431,
133-144[CrossRef][Medline]
[Order article via Infotrieve]
57.
Aiyar, N.,
Disa, J.,
Dang, K.,
Pronin, A. N.,
Benovic, J. L.,
and Nambi, P.
(2000)
Eur. J. Pharmacol.
403,
1-7[CrossRef][Medline]
[Order article via Infotrieve]
58.
Troispoux, C.,
Guillou, F.,
Elalouf, J. M.,
Firsov, D.,
Iacovelli, L., De,
Blasi, A.,
Combarnous, Y.,
and Reiter, E.
(1999)
Mol. Endocrinol.
13,
1599-1614 59.
Onorato, J. J.,
Palczewski, K.,
Regan, J. W.,
Caron, M. G.,
Lefkowitz, R. J.,
and Benovic, J. L.
(1991)
Biochemistry
30,
5118-5125[CrossRef][Medline]
[Order article via Infotrieve]
60.
Loudon, R. P.,
and Benovic, J. L.
(1994)
J. Biol. Chem.
269,
22691-22697 61.
Hall, R. A.,
Spurney, R. F.,
Premont, R. T.,
Rahman, N.,
Blitzer, J. T.,
Pitcher, J. A.,
and Lefkowitz, R. J.
(1999)
J. Biol. Chem.
274,
24328-24334 62.
Oppermann, M.,
Mack, M.,
Proudfoot, A. E. I.,
and Olbrich, H.
(1999)
J. Biol. Chem.
274,
8875-8885 63.
Diviani, D.,
Lattion, A. L.,
Larbi, N.,
Kanapuli, P.,
Pronin, A.,
Benovic, J. L.,
and Cotecchia, S.
(1996)
J. Biol. Chem.
271,
5049-5058 64.
Diviani, D.,
Lattion, A. L.,
and Cotecchia, S.
(1997)
J. Biol. Chem.
272,
28712-28719 65.
Seibold, A.,
Williams, B.,
Huang, Z. F.,
Friedman, J.,
Moore, R. H.,
Knoll, B. J.,
and Clark, R. B.
(2001)
Mol. Pharmacol.
58,
1162-1173
66.
Lamey, M.,
Thompson, M.,
Varghese, G.,
Chi, H.,
Sawzdargo, M.,
George, S. R.,
and O'Dowd, B. F.
(2001)
J. Biol. Chem.
277,
9415-9421[Medline]
[Order article via Infotrieve]
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Eijkelkamp, C. J Heijnen, A. Lucas, R. T Premont, S. Elsenbruch, M. Schedlowski, and A. Kavelaars G protein-coupled receptor kinase 6 controls chronicity and severity of dextran sodium sulphate-induced colitis in mice Gut, June 1, 2007; 56(6): 847 - 854. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. L. Sanchez-Laorden, C. Jimenez-Cervantes, and J. C. Garcia-Borron Regulation of Human Melanocortin 1 Receptor Signaling and Trafficking by Thr-308 and Ser-316 and Its Alteration in Variant Alleles Associated with Red Hair and Skin Cancer J. Biol. Chem., February 2, 2007; 282(5): 3241 - 3251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Vroon, C. J. Heijnen, and A. Kavelaars GRKs and arrestins: regulators of migration and inflammation J. Leukoc. Biol., December 1, 2006; 80(6): 1214 - 1221. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Back, D.-x. Bu, R. Branstrom, Y. Sheikine, Z.-Q. Yan, and G. K. Hansson Leukotriene B4 signaling through NF-{kappa}B-dependent BLT1 receptors on vascular smooth muscle cells in atherosclerosis and intimal hyperplasia PNAS, November 29, 2005; 102(48): 17501 - 17506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Okuno, T. Yokomizo, T. Hori, M. Miyano, and T. Shimizu Leukotriene B4 Receptor and the Function of Its Helix 8 J. Biol. Chem., September 16, 2005; 280(37): 32049 - 32052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. O. Ibe, A. M. Portugal, S. Chaturvedi, and J. U. Raj Oxygen-dependent PAF receptor binding and intracellular signaling in ovine fetal pulmonary vascular smooth muscle Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L879 - L886. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Gaudreault, C. Thompson, J. Stankova, and M. Rola-Pleszczynski Involvement of BLT1 Endocytosis and Yes Kinase Activation in Leukotriene B4-Induced Neutrophil Degranulation J. Immunol., March 15, 2005; 174(6): 3617 - 3625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. R. Jala, W.-H. Shao, and B. Haribabu Phosphorylation-independent {beta}-Arrestin Translocation and Internalization of Leukotriene B4 Receptors J. Biol. Chem., February 11, 2005; 280(6): 4880 - 4887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. van Koppen and K. H. Jakobs Arrestin-Independent Internalization of G Protein-Coupled Receptors Mol. Pharmacol., September 1, 2004; 66(3): 365 - 367. [Full Text] [PDF]
|
|
|
|
|
|
Z. Chen, R. Gaudreau, C. Le Gouill, M. Rola-Pleszczynski, and J. Stankova Agonist-Induced Internalization of Leukotriene B4 Receptor 1 Requires G-Protein-Coupled Receptor Kinase 2 but Not Arrestins Mol. Pharmacol., September 1, 2004; 66(3): 377 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Back, H. Qiu, J. Z. Haeggstrom, and K. Sakata Leukotriene B4 is an indirectly acting vasoconstrictor in guinea pig aorta via an inducible type of BLT receptor Am J Physiol Heart Circ Physiol, July 1, 2004; 287(1): H419 - H424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Vroon, C. J. Heijnen, M. S. Lombardi, P. M. Cobelens, F. Mayor Jr, M. G. Caron, and A. Kavelaars Reduced GRK2 level in T cells potentiates chemotaxis and signaling in response to CCL4 J. Leukoc. Biol., May 1, 2004; 75(5): 901 - 909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Gaudreau, M.-E. Beaulieu, Z. Chen, C. Le Gouill, P. Lavigne, J. Stankova, and M. Rola-Pleszczynski Structural Determinants Regulating Expression of the High Affinity Leukotriene B4 Receptor: INVOLVEMENT OF DILEUCINE MOTIFS AND {alpha}-HELIX VIII J. Biol. Chem., March 12, 2004; 279(11): 10338 - 10345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kavelaars, A. Vroon, R. P. Raatgever, A. M. Fong, R. T. Premont, D. D. Patel, R. J. Lefkowitz, and C. J. Heijnen Increased Acute Inflammation, Leukotriene B4-Induced Chemotaxis, and Signaling in Mice Deficient for G Protein-Coupled Receptor Kinase 6 J. Immunol., December 1, 2003; 171(11): 6128 - 6134. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Okuno, H. Ago, K. Terawaki, M. Miyano, T. Shimizu, and T. Yokomizo Helix 8 of the Leukotriene B4 Receptor Is Required for the Conformational Change to the Low Affinity State after G-protein Activation J. Biol. Chem., October 17, 2003; 278(42): 41500 - 41509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Brink, S.-E. Dahlen, J. Drazen, J. F. Evans, D. W. P. Hay, S. Nicosia, C. N. Serhan, T. Shimizu, and T. Yokomizo International Union of Pharmacology XXXVII. Nomenclature for Leukotriene and Lipoxin Receptors Pharmacol. Rev., March 1, 2003; 55(1): 195 - 227. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |