|
Originally published In Press as doi:10.1074/jbc.M201372200 on June 24, 2002
J. Biol. Chem., Vol. 277, Issue 36, 32659-32667, September 6, 2002
Isolation and Analysis of Mutant Alleles of the Bacillus
subtilis HrcA Repressor with Reduced Dependency on GroE
Function*
Silke
Reischl,
Thomas
Wiegert , and
Wolfgang
Schumann
From the Institute of Genetics, University of Bayreuth,
Universitaetsstrasse 30, Bayreuth D-95440, Germany
Received for publication, February 11, 2002, and in revised form, June 20, 2002
 |
ABSTRACT |
The hrcA gene of Bacillus
subtilis codes for a transcriptional repressor protein that
negatively regulates expression of the heptacistronic dnaK
and the bicistronic groE operon by binding to an
operator-element called CIRCE. Recently, we have published data
suggesting that the activity of HrcA is modulated by the GroE
chaperonin system. Biochemical analyses of the HrcA protein have been
hampered so far by its strong tendency to aggregate. Here, a genetic
method was used to isolate mutant forms of HrcA with increased activity
under conditions of decreased GroE function. One of these mutant forms
(HrcA114) containing five amino acid replacements exhibited enhanced
solubility when overexpressed. HrcA114 purified under native conditions
produced two retarded CIRCE-containing DNA fragments in band shift
experiments. The amount of the larger fragment increased after addition
of GroEL, GroES, and ATP but decreased when ATP was replaced by the
nonhydrolyzable ATP analog ATP S. DNase I footprinting experiments
exhibited full protection of the CIRCE element and neighboring
nucleotides in an asymmetric way. An in vitro binding assay
using affinity chromatography showed direct and specific interaction
between HrcA114 and GroEL. All these experimental data are in full
agreement with our previously published model that HrcA needs the GroE
chaperonin system for activation.
 |
INTRODUCTION |
Bacteria encode genetic systems allowing them to adapt to many
stressful situations, including high and low temperature, hyperosmotic and oxidative stress, and severe DNA damage (1). The best-studied stress response is the so-called heat shock response, which is induced
after a sudden increase in temperature. This response is characterized
by the transiently enhanced synthesis of a group of proteins
collectively known as heat shock proteins encoded by heat shock genes.
Work carried out over the last 5 years has revealed that in most
eubacteria heat shock genes are organized in two and more regulons,
where each regulon is either under positive control of an alternative
sigma factor or under negative control of a transcriptional repressor
(2-5).
In Bacillus subtilis, three different regulons have been
identified so far, where Class I heat shock genes are under the
negative control of the HrcA transcriptional repressor. This protein
binds to an operator designated
CIRCE1
(Controlling Inverted Repeat of
Chaperone Expression) (6), which precedes the
heptacistronic dnaK and the bicistronic groE operon (7-9). Upon a heat shock, HrcA dissociates from its operators leading to a transient induction of the two operons followed by rebinding after about 10 min (7, 8, 10). The pertinent question
concerning all heat shock regulators is how the activity of these
proteins is modulated after a heat shock. In the present case, we have
presented data suggesting that the activity of HrcA is modulated by the
GroE chaperonin system (11). HrcA is maintained in an active
conformation able to bind to CIRCE through GroE. Under conditions of
increased formation of nonnative proteins in the cell, GroE is titrated
by these proteins and is no longer available to activate HrcA. This
titration model is strengthened by the fact that not only heat shock
but also ethanol stress, treatment with puromycin, and artificial
overproduction of GroE substrates induce the HrcA regulon (12).
Proof of our model at the molecular level has been hampered so far by
the fact that HrcA overproduced in Escherichia coli cells
forms inclusion bodies (11). These can be dissolved in the presence of
a chaotropic agent such as guanidinium hydrochloride, but upon its
removal HrcA molecules aggregate again. Therefore, the objective of the
present study was to obtain HrcA in a soluble and active form to
investigate the influence of the GroE system on its activity more
precisely. Although our attempts to refold and solubilize HrcA by a
method published most recently for Bacillus thermoglucosidasius HrcA (13) and by another biochemical method failed, we devised a genetic method to isolate mutant HrcA proteins that show increased repressor binding activity under conditions of
reduced GroE function, with the expectation that these proteins also
might be less prone to aggregation. Several of these mutants were
obtained, and one mutant could indeed be purified under native conditions. This protein was able to specifically retard a DNA fragment
containing the CIRCE element in a still GroE-dependent manner, leading to two different complexes. It specifically protected a
DNA fragment carrying the CIRCE element in DNase I footprint experiments. In addition, we could show a direct interaction between HrcA114 and GroEL in vitro.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains and Plasmids and Growth
Conditions--
E. coli strains JM109 (14) and XL1-Blue
(Stratagene) were used as recipients in all cloning experiments, and
strains MC4100 and its isogenic groES30,
groEL100, and dnaK756 derivatives were obtained
by P1 transduction of the mutant alleles from 392 derivative strains
described by Gragerov and coworkers (15). B. subtilis wild-type strains 1012 (16) and AS02 (17) have been published. Strain
SR15 contained a deletion of the chromosomal copy of hrcA and the groE operon is under control of the xylose-inducible
promoter PxylA (18). Plasmid pQE30 (Qiagen) was used for
the production of His-tagged HrcA. Plasmid pDN2 allowing insertion of
hrcA alleles and measurement of their activity by the
coupled reporter gene bgaB was constructed as follows.
Starting from pBgaB (19), the promoter region of the dnaK
operon, including the CIRCE operator was fused to the bgaB
reporter gene resulting in pAM100. Next, the lepA promoter
was inserted upstream of the dnaK promoter (pDN2). Insertion
of the hrcA gene yielded pDN3 (Fig.
1), and this recombinant plasmid was used
to replace the wild-type by mutant alleles. Plasmid pBlueSK-CIRCE has
been described previously (11). Cells were grown in LB medium in the
presence of antibiotics, as required.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of pDN3. This
vector is a derivative of pBR322, which does not replicate in
B. subtilis. All the DNA sequences located between
amyE3' and amyE5' can be integrated into the
chromosome of B. subtilis via a double-crossover event,
resulting in selection for neomycin (neo) resistance.
Expression of hrcA is driven by the constitutive promoter
lepA (PlepA), and the activity of the
HrcA repressor can be quantified by measuring the -galactosidase
activity encoded by the bgaB gene whose expression is
controlled by HrcA via the CIRCE containing dnaK promoter
(PdnaK), both in E. coli and B. subtilis.
|
|
Isolation of Mutant hrcA Alleles by Error-prone PCR--
Pools
of hrcA genes containing random base changes were created by
error-prone PCR with hrcA as template. The method used was
essentially that described by Fromant and coworkers (20) with primers
GGCCATGAGCTCATGTTAACAAATCGTCAGCTGCTGATCCTT and
GGCCATGTCGACTGCCAAAATTCCCTTATTCATCATACAG containing
SacI and SalI restriction sites (underlined)
facilitating cloning of the hrcA gene into pDN3 (replacement
of the wild-type hrcA allele). Each reaction mixture
contained 1 µg of template DNA, 1 µM of each primer,
200 µM of each dNTP but dATP at 80 µM, 3 mM MgCl2, 4 units of Taq DNA
polymerase, and 10 µl of 10× Taq buffer, in a total
volume of 100 µl. A 30-cycle program (94 °C for 60 s;
70 °C for 60 s; 72 °C for 90 s) was used, the resulting DNA was isolated from other components using the QIAquick PCR purification kit, digested with SacI and SalI,
and ligated into SacI/SalI-digested pDN3 thereby
replacing the wild-type copy of hrcA. The recombinant
plasmids were transformed either into E. coli
groES30 or groEL100, plated on LB medium
containing ampicillin and X-gal at 30 °C, and screened for white
colonies. The hrcA genes from candidate colonies were
isolated from the pDN3 plasmids by cleavage with SacI and
SalI, recloned into pDN2, and transformed into
groES30 and groEL100, respectively, to separate
true mutations within hrcA from those within the E. coli chromosome or the reporter gene bgaB.
Purification of His-tagged HrcA Proteins--
The
hrcA alleles were translationally fused to the His tag
present in pQE30, and the recombinant plasmids were transformed into
E. coli XL1-Blue. HrcA synthesis was induced during
mid-logarithmic growth by the addition of 1 mM
isopropyl-1-thio- -D-galactopyranoside. Cells
were lysed by sonification 180 min after addition of the inducer, and
the His6-HrcA protein was purified as described
(QIAexpressionist, Qiagen) under native conditions.
Transcriptional Analysis and Determination of -Galactosidase
Activities--
Preparation of total RNA of B. subtilis and
Northern blot analysis were performed as described before (9). To
easily monitor HrcA activity, the promoter region of the
dnaK operon, including the CIRCE operator, was
transcriptionally fused to the bgaB reporter gene coding for
a heat-stable -galactosidase (21). -Galactosidase activities were
determined as described previously (19).
Determination of the Amount of Soluble HrcA
Protein--
E. coli XL1-Blue cells expressing either
wild-type or mutant hrcA alleles were grown to the
mid-logarithmic growth phase (A578 = 0.6), and expression was induced by addition of 1 mM
isopropyl-1-thio- -D-galactopyranoside. After 120 min,
cells were lysed by sonification and centrifuged. Aliquots were taken
before (total cell lysate) and after a centrifugation step (supernatant
and resuspended pellet), and prepared for SDS-PAGE as described
previously (22). An equivalent of 1-ml cell suspension of an
A578 = 0.08 was applied for the total cell
lysate. For the soluble fraction (supernatant) 2.5 µg of total
proteins, and an equal volume of the resuspended pellet was loaded onto
a 12% SDS-PAGE. The gel was Coomassie Blue-stained.
To determine the amount of soluble HrcA protein in E. coli
MC4100 or its isogenic groES30 or groEL100
derivatives, cells containing the pDN3 or pDN3-114 plasmid were grown
at 30 °C. When A578 = 0.7 was reached, one
culture was transferred to 42 °C, whereas the other one was left at
30 °C. 30 min after the heat shock, 10 ml of each culture was
harvested, resuspended in 1 ml of lysis buffer, and lysed by
sonification. After the cells were broken, the cells were centrifuged
at 4 °C for 1 h at 45,000 rpm. The supernatant was removed, and
its protein content was determined. 1 µg of total protein was loaded
per lane.
Gel Retardation and DNase I Footprinting Experiments--
The
DNA fragments used in the gel retardation assays were obtained
by enzymatic hydrolysis of pBlueSK-CIRCE with Asp718 and BamHI (CIRCE-AB, 126 bp). Labeling of the DNA fragments with
[ -32P]dATP was performed by fill-in using Klenow
enzyme. In gel retardation assays, 10 µg of salmon sperm DNA were
added as unspecific competitor and 13 fmol (0.001 µg) of end-labeled
DNA fragment was used. When indicated the reaction mixture was
incubated for 15 min at ambient temperatures before addition of the DNA
fragment. DNA fragments used for DNase I footprinting were prepared by
cutting plasmid pBlueSK-CIRCE either with KpnI and
BamHI (resulting in the 122-bp CIRCE-KB non-coding strand)
or Asp718 and SacI (CIRCE-AS; 166-bp coding
strand). Labeling of the two fragments was carried out by a fill-in
reaction using the Klenow enzyme (BamHI and
Asp718) and [ -32P]dATP. Reactions
were performed in a 25-µl volume and consisted of a 1-µl labeled
DNA fragment (130 fmol), 0.8 µl of GroES (13 pmol), 1.3 µl of GroEL
(13 pmol, both prepared from E. coli and purchased from
Sigma), ATP (0.25 µmol), 1 µl of pUC18 (0.85 µg, unspecific
competitor), 5 µl of 5× gel shift buffer (50 mM Tris, pH
8.0, 50 mM MgCl2, 500 mM sodium
phosphate, pH 8.0, 10 mM dithiothreitol, 5% glycerol),
6.5-26 pmol of HrcA114, and H2O up to 25 µl. The reaction mixture was incubated at room temperature for 10 min, followed
by the addition of 0.5 µl of DNase I (1 unit/µl; Roche Diagnostics). After another incubation for 2 min at room temperature, the reaction was stopped by adding 4 µl of stop buffer (0.025% xylene cyanol, 0.025% bromphenol blue, 10 mM EDTA).
3 µl of the reaction mixture containing about 4 × 104 cpm was loaded onto 6% polyacrylamide/7 M
urea sequencing gels. A plus G Maxam and Gilbert reactions (23) were
carried out on the appropriate 32P-labeled DNA fragments
and loaded alongside the DNase I footprinting reactions. Gels were
analyzed by a PhosphorImager (SI, Amersham Biosciences).
Binding Assays Using Immobilized HrcA114--
To demonstrate
interactions between HrcA and GroEL, we analyzed binding of GroEL to
immobilized HrcA114 following the method described by Enz and coworkers
(24). Two Ni-NTA-agarose columns were prepared, one loaded with
His6-HrcA114 and the other left without protein. The
binding reactions were performed at 4 °C. 450 µl of crude extract
each prepared from B. subtilis strain AS02 (carries a
deletion of hrcA) was applied to each column, which was
subsequently washed twice with lysis buffer (50 mM
NaH2PO4, pH 8.0, 300 mM NaCl, 10 mM imidazole) followed by treatment with 200 µl of
elution buffer (identical with lysis buffer, but 250 mM
imidazole). Each fraction was mixed with 50 µl of sample buffer, incubated for 5 min at 95 °C, and applied to an SDS-PAGE. Crude extracts of AS02 were prepared by growing the strain to an
A578 of 0.7, centrifuging 10 ml of culture, and
resuspending the mixture into 1 ml of lysis buffer. Cells were broken
by sonification and centrifuged for 15 min at 4 °C at 12,000 rpm.
The resulting supernatant was used as a crude extract.
 |
RESULTS |
Isolation of hrcA Mutant Alleles Exhibiting Increased Activity in
E. coli Strains groES30 and groEL100--
It was described that the
two E. coli strains 392 groES30 and
groEL100 expressing hrcA and a reporter fusion of
the HrcA-controlled dnaK promoter to the gene of heat-stable
-galactosidase (BgaB) exhibited a high background -galactosidase
activity in the absence of heat stress as compared with wild-type
groE cells (11). The temperature-sensitive strains
groES30 and groEL100 encode a GroE chaperonin
system with reduced activity also under permissive temperature (25). It
was reasoned that the decreased repressor activity is due to the
failure of GroE to efficiently activate HrcA. This conclusion prompted
us to ask whether mutant hrcA alleles exhibiting increased
repressor activity can be isolated from groES30 and
groEL100 strains. Two classes of mutant alleles could be
expected: (i) class I, which results in the synthesis of HrcA protein
exhibiting increased activity in the absence of an intact GroE system
and (ii) class II mutants in HrcA, which are allele-specific for
groES30 or groEL100.
To obtain random point mutations within the hrcA gene, we
applied the method of error-prone PCR mutagenesis. PCR products of
hrcA were ligated to a plasmid that allows constitutive
expression of hrcA and contains a transcriptional fusion of
the HrcA/CIRCE-controlled dnaK promoter to bgaB
(pDN2) and subsequently transformed to E. coli strains
MC4100 groES30 and MC4100 groEL100. Eleven clones with a reproducible white phenotype on X-gal plates out of ~10,000 colonies with groES30 were collected. Plasmids of white
colonies were isolated. Respective hrcA genes were cut out
of these plasmids, individually recloned into pDN2, and transformed
again to MC4100 groES30 and MC4100 groEL100. Ten
clones still exhibited a white phenotype on X-gal plates and were
chosen for further DNA sequence analysis of respective hrcA
genes. All the ten hrcA genes obtained with the
groES30 screen contained base pair substitutions; seven carried single and three double point mutations (Table
I). Not a single white colony out of
~10,000 could be found using the groEL100 screen. To take
advantage of possible additive effects of single point mutations, one
mutant hrcA allele of the groES30 screening
(hrcA6) was arbitrarily chosen and subjected to a second round of error-prone mutagenesis, and the recombinant plasmids were
transformed into groEL100. This procedure resulted in one single mutant hrcA allele designated hrcA11,
containing three amino acid replacements altogether (Table I). In
summary, ten different alleles were obtained encoding amino acid
replacements at twelve different positions, scattered almost over the
complete polypeptide with some clustering between amino acid residues
99 and 132 (Fig. 2).
View this table:
[in this window]
[in a new window]
|
Table I
Mutations in hrcA obtained via random PCR mutagenesis and screening for
enhanced activity in temperature sensitive GroE background strains
with a -galactosidase reporter fusion
Positions of the point mutations within the DNA sequence (beginning
with the first base of the first codon) and resulting amino acid
replacements are listed. (See "Experimental Procedures.")
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 2.
Location of amino acid replacements within
the primary sequence of HrcA. The complete primary sequence of
HrcA is given. Amino acids that have been replaced are indicated within
the primary sequence by boldface letters, and the changes
are marked by arrows pointing to the new amino acids. The
dots above the replaced amino acids indicate how often this
replacement was found in independent experiments.
|
|
Analysis of the Mutant hrcA Alleles in Different E. coli Strains
and in a B. subtilis Wild-type Strain--
Repressor activity of the
isolated hrcA alleles was analyzed in more detail in
E. coli strains MC4100 groES30 and MC4100
groEL100, making use of the bgaB reporter fusion
as described above. -Galactosidase activities were measured 30 min
after a shift from 30 to 42 °C and from an unshifted control at the
same time point. It turned out that in the groES30 strain
the background -galactosidase activity in the absence of heat stress
was slightly reduced with all mutant hrcA alleles (Table
II). The mutant alleles hrcA1
and hrcA11 were defect in meditating heat induction of the
reporter fusion (Table II). A more distinct picture emerged from the
analysis of the E. coli groEL100 strain. With the exception
of hrcA8 the background level with all hrcA
mutant alleles was clearly reduced compared with the wild-type allele.
Again, hrcA11 was active as a repressor almost
independently from a heat shock.
View this table:
[in this window]
[in a new window]
|
Table II
hrcA mutant alleles exhibit activities in E. coli groES30 and groEL100
strains different from the wild-type allele
The -galactosidase activities were measured in E. coli
groES30 and groEL100 transformed with either the empty
vector pDN2 or pDN3 carrying the different hrcA mutant
alleles. Strains were grown in LB medium to mid-logarithmic phase at
30 °C, then shifted to 42 °C when indicated. Aliquots were
withdrawn from a heat-shocked (+) and unshocked ( ) culture 30 min
after the shift to the high temperature and assayed for their
-galactosidase activities.
|
|
It has to be mentioned that the amount of protein produced in the
strains of mutant alleles was the same, as judged by Western blotting
with anti-HrcA antibodies (data not shown).
In summary, quantification of the -galactosidase activities
confirmed the plate assays, although there seems to be a difference in
-galactosidase activities on solid plates compared with liquid cultures, because the difference on X-gal plates, with the blue phenotype of the wild-type and the white phenotype of mutant alleles, was more pronounced.
All the mutant alleles were also transformed into the wild-type strains
E. coli MC4100 and B. subtilis 1012, and the
-galactosidase activities were measured before and after heat shock.
It turned out that all ten mutant alleles did not differ from the
wild-type allele in both species (data not shown). We conclude from
these results that all point mutations belong to the predicted class I,
with an HrcA repressor exhibiting increased activity. This assumption
is based on the observation that the mutant alleles obtained in the
groES30 strain exhibit a comparable phenotype in the
groEL100 strain, thereby excluding allele-specific
suppressors. Why did we not see an effect in cells producing wild-type
GroE chaperonins? We assume that the amount of active HrcA is not
limiting in the presence of wild-type GroE proteins. If this conjecture is correct, reducing the amount of wild-type GroE chaperonins should
reveal a difference between wild-type and mutant HrcA protein. This was
indeed found to be the case (see below).
The Mutant hrcA114 Allele Directs the Synthesis of Soluble HrcA
Protein When Overproduced--
We observed that overexpression of
wild-type HrcA in E. coli cells resulted in the production
of inclusion bodies (11). We reasoned that the mutant HrcA proteins
might exhibit increased solubility. Therefore, three HrcA alleles
(hrcA+, hrcA4, and hrcA11)
were fused to a His tag, overproduced, and tested for solubility by a
centrifugation step as described under "Experimental Procedures".
Whereas hrcA4 was arbitrarily chosen, hrcA11 was
used because it codes for a protein exhibiting increased repressor
activity before and after heat shock both in the groES30 and
groEL100 strains. The mutant proteins HrcA4 and HrcA11
yielded a higher fraction of soluble protein compared with wild-type
HrcA, but the proteins remained inactive in a gel retardation assay (data not shown). As a consequence, it was tested whether a combination of the point mutations found in both alleles would further increase the
solubility and, above all, the activity of the protein in gel mobility
shifts with the CIRCE element. The respective hrcA allele in
the reporter plasmid pDN3 was constructed by standard cloning
technology (hrcA114). To test for activity of HrcA114, we
transformed pDN3-hrcA114 into the different E. coli strains and into B. subtilis AS02
( hrcA) wild-type as already described for the other
hrcA alleles. In the absence of hrcA, the
unregulated dnaK promoter directed high level expression of
the -galactosidase fusion in all the four strains analyzed, with
some slight increase 30 min after heat challenge (Table
III). Addition of the wild-type hrcA allele reduced the background activity in all strains
but E. coli groEL100 (Table III). Whereas a clear increase
in the -galactosidase activity after a heat shock was detected with
B. subtilis AS02 and E. coli groES30,
the increase with E. coli wild-type was low but significant
(Table III), probably due to a multicopy effect of the plasmid-encoded
gene and resulting high amounts of HrcA produced. The hrcA114
allele tested in the B. subtilis and E. coli groE
wild-type background resulted in -galactosidase activities comparable to wild-type hrcA. In both E. coli
groES30 and groEL100 it resulted in low
activities, also after heat shock (Table III).
View this table:
[in this window]
[in a new window]
|
Table III
-Galactosidase activities of B. subtilis 1012, E. coli MC4100, E. coli groES30, and E. coli groEL100 transformed with either the
empty vector pDN2 or pDN3 carrying either wild-type hrcA or hrcA114
Other details are as for Table II.
|
|
To test whether the high repressor activity of HrcA114 in the reporter
system was due to enhanced solubility of the protein, cell extracts of
samples with and without heat shock were spun in an
Ultracentrifuge to remove all protein aggregates and submitted to Western blotting with anti-HrcA antibodies and, as an internal control, with anti-trigger factor antibodies. It became apparent that
the amount of HrcA114 in unshocked cells remained constant, whereas the
amount of wild-type HrcA was reduced in the groES30 and even
more in the groEL100 strain (Fig.
3A). Furthermore, after heat
shock there was a clear reduction in the amount of soluble wild-type
HrcA in the groE wild-type background but not in the amount
of the HrcA114 protein.

View larger version (62K):
[in this window]
[in a new window]
|
Fig. 3.
HrcA114 exhibits increased solubility in
E. coli cells. E. coli MC4100
wild-type and groES30 and groEL100 derivatives
containing pDN3 (wild-type hrcA) and pDN3-114
(hrcA114) were grown in LB medium to mid-logarithmic phase
at 30 °C, then shifted to 42 °C. Aliquots were withdrawn 30 min
after the shift to the high temperature from the shocked culture and an
unshocked control at the same time point. Cells were disrupted by
ultrasonication and spun in an Ultracentrifuge to remove unsoluble
material. Supernatants were assayed for their content of HrcA by
Western blotting with anti-HrcA antibodies and antibodies against
trigger factor as an internal control (A). Total protein
extracts were prepared from E. coli cells overexpressing
His6-tagged wild-type HrcA and the mutant protein HrcA114.
For total cell lysate the cells were lysed by SDS/heat treatment, and
an equivalent of 0.08 A578 was loaded onto the
gel (lanes 1). For the supernatant (lanes 2) and
pellet fractions (lanes 3), the cells were lysed by
sonification and centrifuged. The supernatant was removed, and the
pellet was resuspended in a equal volume. 2.5 µg of protein was
applied for the supernatant and an equal volume for the pellet fraction
(B).
|
|
Next, hrcA114 was fused into the His-tagging vector pQE30 to
overproduce and purify His6-HrcA114 in E. coli.
Extracts of soluble proteins of the strain overexpressing
His6-HrcA114 submitted to SDS-PAGE and Coomassie Blue
staining indeed revealed that about 50% of the repressor protein
remained soluble (Fig. 3B). Furthermore, HrcA114 proved to
be active in gel mobility shift assays (see below). To conclude, the
point mutations within hrcA114 result in a repressor protein
exhibiting enhanced activity and solubility in both E. coli
groES30 and groEL100.
These results further suggest that HrcA114 is less dependent on the
GroE chaperonin machine than the two independent mutant proteins HrcA4
and HrcA11. It should be mentioned that hrcA114 carries a
total of five amino acid replacements (see Table I) and that we do not
know whether all five point mutations contribute to the observed characteristics.
HrcA114 Exhibits Enhanced Stability under GroE Depletion
Conditions--
As already mentioned, it is difficult to explain why
there is such a strong effect in the groES30 and
groEL100 strains expressing the hrcA114 allele,
but not in the wild-type groE situation in both E. coli and B. subtilis. A possible explanation is, that under groE wild-type conditions the amount of active HrcA in
the absence of heat shock is not limiting in contrast to the
groES30 and groEL100 background. Therefore,
higher amounts of active HrcA do not change the phenotype. This also
implies that after a heat shock the amount of the HrcA114 variant
becomes limiting and, as a consequence, must have a reduced but still
significant dependence on the GroE chaperonin system.
To investigate this possibility, hrcA and hrcA114
were expressed in a B. subtilis strain where the amount of
GroE can be controlled by xylose addition to the growth medium. Strain
SR15 with a deletion of the chromosomal copy of hrcA and the
groE operon expressed from a xylose-regulatable promoter was
transformed with the empty vector pDN2 and with pDN3 carrying either
the wild-type or the mutant hrcA114 allele. All three
strains were grown overnight in the presence of 1% xylose to ensure
expression of the groE operon. Each overnight culture was
first washed to remove the xylose and then used to inoculate fresh LB
medium with and without 1% xylose, respectively. Aliquots were
withdrawn after about 2 h of growth at an
A578 of 0.6 for -galactosidase measurements. Cultures without xylose stopped growing at an
A578 of about 1.
Although about 250 milliunits/mg were determined in the absence of
hrcA and xylose, addition of xylose reduced this activity to
~50%, indicating an effect of xylose on the enzyme activity itself,
most probably through GroE (Table IV).
Addition of HrcA led to a reduction of the -galactosidase activity
to a level comparable to what was found in the absence of
hrcA, but presence of xylose. Growth in the presence of
xylose and hrcA reduced the -galactosidase activity to
about 50 milliunits/mg (Table IV). When the hrcA114 allele
was tested, its activity in the absence and presence of xylose was
significantly reduced compared with its wild-type allele (Table IV).
These results clearly demonstrate that under GroE-limiting conditions
HrcA114 is more active than HrcA and thereby strengthen the hypothesis
that the effect of stabilizing amino acid replacements became apparent
only under conditions when the GroE chaperonin system becomes limiting.
These results further suggest that HrcA114 is not completely
independent of the GroE system, because it exhibits enhanced activity
in its presence.
View this table:
[in this window]
[in a new window]
|
Table IV
B. subtilis strains carrying the groE operon fused to
xylose-inducible promoters
B. subtilis strains carrying the groE operon
fused to a xylose-inducible promoter with either no hrcA
(B. subtilis SR15 with integrated pDN2), wild-type
hrcA (B. subtilis SR15 with integrated pDN3), or
the hrcA114 allele (B. subtilis SR15 with
integrated pDN3-114) and were first grown overnight in LB medium
containing 1% xylose to ensure expression of the groE
operon. The next morning, each culture was washed to remove residual
xylose and used to inoculate two fresh cultures one with and the other
without 1% xylose. All six cultures were grown until an
A578 = 0.6 was reached and samples were taken for
the determination of -galactosidase activities.
|
|
To confirm these results by an independent experiment, the amount of
chromosomally encoded dnaK-specific transcript was analyzed by a slot-blot (Fig. 4A) and
Northern blot (Fig. 4B) experiment. As a control in Northern
blots, the lepA-specific mRNA was also tested; this gene
is not subject to regulation through HrcA (22). In the negative control
experiment in the absence of HrcA the amount of
dnaK-specific transcript was high and independent of the
addition of xylose. With wild-type HrcA, the addition of the inducer
xylose reduced the amount of dnaK-specific transcript (Fig.
4). HrcA114 reduced the amount of dnaK transcript in the absence of xylose compared with wild-type HrcA, and addition of the
inducer further reduced it significantly (Fig. 4). The amount of the
lepA transcript remained unchanged in all six samples (Fig. 4B). These results fully confirm those obtained by measuring
-galactosidase activities.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 4.
HrcA114 exhibits increased activity under
conditions of GroESL depletion. B. subtilis strains
were cultured, and samples were taken as described in Table IV.
Total RNA was prepared followed by slot blot (0.25 µg of RNA)
analysis hybridized with a dnaK riboprobe (A) and
Northern blot (2 µg of RNA applied per lane) and probing against the
HrcA/CIRCE-controlled dnaK, and lepA as a
negative control (B). B. subtilis SR15
hrcA (lanes 1 and 2), B. subtilis SR15 hrcA wild-type (lanes 3 and
4), B. subtilis SR15 hrcA114
(lanes 5 and 6). Even numbers, with
addition of xylose to the medium; odd numbers, without
addition of xylose to the medium.
|
|
Purified HrcA114 Specifically Retards a DNA Fragment Containing the
CIRCE Element, and This Retardation Is Significantly Increased in the
Presence of the GroE Chaperonin System--
We already published that
purified HrcA is able to specifically retard migration of a CIRCE
containing DNA fragment, but this was performed with HrcA of
Bacillus stearothermophilus purified under denaturing
conditions and refolded (11). Based on all the data obtained with
HrcA114 so far, we expected that this mutant protein should exhibit
increased activity after purification from E. coli under
native conditions. Therefore, HrcA114 was purified as described under
"Experimental Procedures" and immediately used in gel retardation assays.
As shown in Fig. 5, addition of
GroES/GroEL and ATP alone did not lead to any retardation of the DNA
fragment (lane 2). Addition of HrcA114 alone retarded a
large portion of the DNA (about 50%) and led to the formation of two
different bands (lane 3). The amount of retarded DNA was not
altered when GroES and GroEL alone were added (lane 4). In
contrast, a significant increase in the upper band was
observed upon further addition of ATP (lane 5) but not in
the presence of the nonhydrolyzable ATP analog ATP S (lane
6). Addition of a 100-fold molar excess of competing unlabeled DNA
fragment completely prevented binding of HrcA114 to the labeled DNA
(lane 7). We also tested whether the incubation temperature influenced the retardation behavior. With HrcA114 alone, incubation of
all components at 25 °C produced the two bands (lane 9),
whereas incubation at 37 or 50 °C completely prevented its binding
(lanes 10 and 11). When the GroE proteins and ATP
were included into the incubation mixture, two bands were still
observed at 37 °C (lane 14) and the lower band even at
50 °C (lane 15).

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 5.
HrcA114 specifically retards a DNA fragment
carrying the CIRCE element in a GroE- and ATP-dependent
manner. DNA binding reactions were performed with a DNA fragment
carrying the CIRCE element of groE enzymatically hydrolyzed
from pBlueSK-CIRCE (from 45 to +82; 13 fmol per reaction) and
end-labeled with 32P. The components of the different
reaction mixtures are indicated below the lanes and include
13 pmol of HrcA114, 13 pmol of GroES, 13 pmol of GroEL, 0.25 pmol of
ATP, 0.25 pmol of ATP S, and 1.3 pmol of competing DNA fragment.
The reaction mixtures were incubated at the temperatures indicated for
15 min before addition of the CIRCE element. The position of the
retarded fragments is indicated by circles, and that of
unretarded DNA is indicated by an asterisk.
|
|
Purified HrcA114 Protects the CIRCE Element and Neighboring
Nucleotides--
To determine the location and sequence of the HrcA
binding site precisely, DNase I footprinting experiments were performed on a DNA fragment carrying the CIRCE element of the B. subtilis groE operon. When the template strand was labeled, HrcA114
protected a region extending from 31 to 15, from 5 to +36, and
from +39 to +43 (Fig. 6, A and
C) indicating that HrcA114 binding sites are located between
positions 31 and +43 of the groE promoter region excluding
the 10 box (Fig. 6, A and C). The nontemplate strand was protected from positions +3 to +67 (Fig. 6, B and
C). In summary, these results demonstrate that HrcA protects
the complete CIRCE element, including its spacer region and binds
asymmetrically to the DNA. There are no significant sequence
similarities within the flanking regions (Fig. 6C). In
conclusion, the DNase I footprinting data identify the CIRCE element as
the common binding site present on both DNA strands.

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 6.
DNase I footprinting analysis of HrcA114
binding to the CIRCE element. Lanes contain 4 × 104 cpm of labeled template strand (A) and
non-template strand (B). Fragments were incubated with
increasing amounts of purified HrcA114: lane 1, A plus G
Maxam and Gilbert reactions; lane 2, no HrcA114; added
HrcA114: lane 3, 6.5 pmol; lane 4, 13 pmol; and
lane 5, 26 pmol. Regions protected by HrcA114 are indicated
by brackets. DNase I-protected regions are drawn
schematically (C). The sequence of the hrcA
promoter region is shown, with the DNase I-protected areas shaded in
gray. Positions are relative to the
A-dependent promoter transcription start
point +1 as indicated by a vertical arrow.
Arrowheads: location of the CIRCE element; boldface
letters and asterisks above the nucleotides: potential
Shine-Dalgarno sequence. The 35 and 10 boxes are in boldface
letters and the start codon TTG is underlined.
|
|
Binding of GroEL to His6-HrcA114 Fixed to a
Ni-NTA-Agarose Column--
To ascertain physical interaction between
HrcA114 and GroEL, Ni-NTA-agarose was used as an affinity matrix for
His6-HrcA114 in an in vitro binding assay. This
method was chosen, because HrcA114 still tends to aggregate when
purified, a fact that also prohibited the estimation of the oligomeric
state of the protein (data not shown). Aggregation can be prevented by
immobilizing the protein to a gel matrix, which avoids local
concentrations that are too high. Two Ni-NTA-agarose columns were
prepared, one loaded with His6-HrcA114 and the other left
without protein. Crude extracts prepared from B. subtilis
strain AS02 (devoid of HrcA and, therefore, overexpressing
dnaK and groE operons) were applied onto both
Ni-NTA columns. After two washes, both columns were treated with
elution buffer, and aliquots of the eluates were analyzed by
immunoblotting and probed with different antibodies (Fig.
7). Although the crude extract contained
the three chaperones GroEL, DnaK, and HtpG, but no HrcA as expected
(lane 1), the eluate obtained from the Ni-NTA column not
loaded with HrcA114 only revealed trace amounts of GroEL (lane
2). In contrast, the eluate from the column loaded with HrcA114
contained the repressor protein and high amounts of GroEL. DnaK and
HtpG were not detectable (lane 3). This experiment nicely
proves that GroEL is able to physically interact with HrcA114, but
neither are DnaK nor HtpG.

View larger version (86K):
[in this window]
[in a new window]
|
Fig. 7.
GroEL binds specifically to immobilized
HrcA. Two Ni-NTA-agarose columns were prepared, and one was loaded
with natively purified His6-HrcA114, whereas the second was
left without protein. Next, both columns were treated with crude
extract prepared from B. subtilis strain AS02
( hrcA) and washed, and the bound proteins were eluted
with imidazole. The elution fraction was analyzed by immunoblotting
using antibodies against HrcA, GroEL, DnaK, or HtpG, respectively.
Lane 1, crude extract of strain AS02; lane 2,
eluate from the control-column without protein; lane 3,
column loaded with HrcA114.
|
|
 |
DISCUSSION |
Regulation of heat shock genes by the HrcA repressor protein
binding to the CIRCE operator is widespread within the eubacterial kingdom and occurs both in Gram-positive and Gram-negative species (5,
26-28). Common to all regulatory systems involved in the heat shock
response is the transient induction of the heat shock genes. This
implies that, in the case of positive regulation, the transcriptional
regulator has to be transiently activated, and, in the case of negative
regulation, to be transiently inactivated. For HrcA of B. subtilis, four lines of experimental data strongly suggest that
the activity of this repressor protein is modulated by the GroE
chaperonin system: (i) depletion of GroES/EL in B. subtilis
resulted in increased expression of the Class I heat shock genes
controlled by HrcA; (ii) overexpression of GroEL in B. subtilis reduced both the basal and the induced level of Class I
heat shock proteins after a heat shock; (iii) purified GroEL significantly enhanced binding of HrcA to the CIRCE element in gel
retardation assays; (iv) the basal level of expression of an
HrcA-controlled reporter gene was greatly augmented in both E. coli groES30 and groEL100 strains (11).
These data led us to suggest a titration model where the amount of
active HrcA, which is able to bind to the CIRCE operator is directly
correlated to the amount of available GroE system. Upon a sudden heat
shock, denatured proteins titrate the GroE chaperonins, thereby
increasing the amount of inactive HrcA repressor, which is unable to
interact with the CIRCE element. The more denatured proteins are
removed from the cell, the more GroE chaperonins are available to
convert inactive HrcA into its active form (12). This in turn leads to
the shut off of the Class I heat shock genes under constantly high
temperature conditions (7-9). This direct HrcA-GroE interaction model
has been challenged by Minder et al. (29) whom did not see a
more efficient retardation of target DNA by HrcA of
Bradyrhizobium japonicum in the presence of added GroEL.
Furthermore, researchers performing experiments with HrcA of
Clostridium acetobutylicum and Lactococcus lactis
detected an influence of DnaK on the activity of HrcA (30, 31).
Therefore, it is of particular importance first to demonstrate a direct
interaction between HrcA and the GroE system and second to define the
active and inactive forms of HrcA.
The observation that HrcA synthesized in the temperature-sensitive
E. coli groES30 and groEL100 mutant
strains is inactive suggested a screening system to obtain
hrcA mutant alleles exhibiting increased repressor activity.
The groES30 and groEL100 mutations reduce the
overall activity of the GroE system, and HrcA seems to be specifically
sensitive to this reduced activity. Whereas the GroES30 protein carries
an amino acid replacement within the mobile loop (A31V) (32), which is
involved in the interaction with GroEL, that in GroEL100 (S201F) (33)
is located in the apical domain involved in the binding of nonnative
proteins (34, 35). Error-prone PCR mutagenesis produced a total of ten
mutant hrcA alleles using E. coli
groES30 as a recipient. No mutants were directly found in
E. coli groEL100. This could indicate that single
and even double point mutations are not enough or too rare to produce
the desired phenotype. This possibility is strengthened by the finding
that hrcA6 carrying one point mutation when going through a
second round of error-prone mutagenesis resulted in the mutant allele
hrcA11, now carrying three point mutations and exhibiting
reduced basal activity in the E. coli groEL100
strain. That these mutant hrcA alleles display increased
independence from the GroE chaperonin machine rather than being
allele-specific suppressors is emphasized by the finding that they
display comparable activities in both E. coli
groES30 and groEL100.
Amino acid residues that were replaced in the mutant forms of HrcA were
not clustered in a hot spot. They do not reveal a specific conservation
among the various HrcAs of different species, taken into account that
there is only little sequence conservation between the different HrcA
proteins. Stabilization of proteins is often encountered with a change
in charge distribution of surface-exposed amino acid residues (36). For
example, the point mutation D302G that was found after a second
mutagenesis cycle in the groEL100 screen possibly causes
such a stabilizing effect, which may be underlined by the fact that the
two HrcAs from thermophilic Bacillus species (B. stearothermophilus and B. thermoglucosidasius) possess a glycine residue at the respective position. Nevertheless, because the
three-dimensional structure has yet not been resolved and there is
little sequence homology, the nature of the point mutations remains speculative.
It is of special interest that the reduced dependence on GroE of at
least three mutant forms of HrcA tested (HrcA4, HrcA11, and HrcA114)
correlated with enhanced solubility of the overexpressed proteins (data
not shown and Fig. 3). Nevertheless, HrcA4 and HrcA11 purified under
native conditions were inactive in gel retardation assays with a
CIRCE-containing DNA fragment. HrcA114 was active, but the high molar
ratio of DNA:protein (1:2000) for a complete retardation of the DNA
fragment reveals that the soluble protein is also mainly present in an
inactive form, what has already been shown for the B. japonicum HrcA purified under native conditions (29). This
underlines that solubility of HrcA is not tantamount to full activity
of the repressor. Recently, a method has been published allowing
effective renaturation and solubilization of B. thermoglucosidasius HrcA with added DNA, leading to a fully active
HrcA (13). This technique failed to work with wild-type HrcA of
B. subtilis. Furthermore, we could detect only a slight increase of DNA-binding activity of renatured HrcA protein, when CIRCE-containing DNA was added (data not shown).
Mutant HrcA114 with five amino acid replacements is of crucial
importance, because its enhanced solubility allowed further biochemical
characterization of B. subtilis HrcA in general. When expressed in B. subtilis, it behaved like wild-type HrcA
with respect to basal activity and induction of a Class I promoter (Table III). Differences could only be seen under conditions of GroE
limitation, with a reduced but still measurable dependence on GroE in a
depletion assay (Table IV and Fig. 4). Addition of GroE together with
ATP increased the DNA binding activity of HrcA114 (Fig. 5, lanes
3-5). Furthermore, what could be shown for the first time for an
HrcA repressor, HrcA114 displayed a high binding affinity for GroEL
compared with DnaK and HtpG as a control (Fig. 7). On the basis of the
titration model, this means that HrcA114 is indeed more independent on
GroE function but still binds to the chaperonin and needs at least some
of its activity. In vivo substrates of the E. coli GroE system have been identified (37). They are characterized
by a molecular mass of 20-60 kDa and  domains that have
-helices and -sheets with extensive hydrophobic surfaces. HrcA
has a molecular mass of 39 kDa and, according to secondary structure
predictions, possesses several -helices and -sheets (data not
shown). The HrcA114 mutant protein should be characterized by a more
stable folding and thereby be less dependent on the GroE chaperonin system.
There have been several publications demonstrating specific interaction
between purified HrcA and a CIRCE element containing DNA fragment in
gel retardation assays, including HrcA from Streptococcus pneumoniae, Streptococcus thermophilus, Bacillus
japonicum, B. thermoglucosidasius, and B. stearothermophilus (13, 29, 38-40), but all groups reported only
one retarded complex. We cannot exclude that the two forms we see in
retardation assays represent two different oligomeric states of
HrcA114, but the still high tendency of HrcA114 to aggregate prevented
further biochemical characterization. The DNase I footprint shows
protection of the leading and lagging strand in an asymmetric way,
suggesting that HrcA like most repressors acts at least as a dimer, as
it was reported for HrcA from S. thermophilus and B. thermoglucosidasius (13, 39).
It has been described that HrcA of B. thermoglucosidasius
may directly act as a thermosensor. Based on the fact that GroE had
only a minor effect on preventing HrcA aggregation at different temperatures compared with DNA, it was suggested that GroE is mainly
needed for the activation of newly synthesized repressor (13). Our band
shift experiments also demonstrate that the activity of HrcA is
influenced by the incubation temperature, but this effect could be
largely suppressed by adding the complete GroE system (Fig. 5,
lanes 8-15). Although HrcA seems to exhibit an intrinsic
thermolability, the fact that the heat shock response is shut off after
about 10 min under retention of the heat shock conditions (17) supports
the titration model. Therefore, we propose a combined model where HrcA
exhibits intrinsic thermolability, but the main modulating system is
the titration of the GroE chaperonin machine.
In summary, we have succeeded for the first time to obtain purified
soluble HrcA protein of B. subtilis specifically retarding a
DNA fragment containing the CIRCE element. Two different complexes were
produced never reported so far in band shift experiments with HrcA, and
further work has to elucidate the stoichiometry within these complexes
and their biological function. We also succeeded for the first time to
obtain a footprint with HrcA showing that it completely protected the
CIRCE element and neighboring sequences in an asymmetric way. Further
work has to reveal whether this footprint correlates with the faster or
slower migrating complex seen in the band shift assay. Finally, we
succeeded in demonstrating that immobilized HrcA specifically interacts
with GroEL from crude extracts. All these results are fully in
compliance with our model that HrcA of B. subtilis needs the
complete GroE machine for activation. Definition of the active and the
inactive state of HrcA awaits further extensive experimentation, which is underway in our laboratory.
 |
ACKNOWLEDGEMENTS |
We thank Karin Angermann and Claudia Oettel
for technical assistance and Elke Deuerling for providing anti-trigger
factor antibodies.
 |
FOOTNOTES |
*
This work was supported in part by the Deutsche
Forschungsgemeinschaft and the Fonds der Chemischen Industrie.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 49-921-554305;
Fax: 49-921-552710; E-mail: thomas.wiegert@uni-bayreuth.de.
Published, JBC Papers in Press, June 24, 2002, DOI 10.1074/jbc.M201372200
 |
ABBREVIATIONS |
The abbreviations used are:
CIRCE, controlling
inverted repeat of chaperone expression;
X-gal, 5-bromo-4-chloro-3-indolyl- -D-galactopyranoside;
Ni-NTA, nickel-nitrilotriacetic acid;
ATP S, adenosine
5'-O-(thiotriphosphate);
wt, wild-type.
 |
REFERENCES |
| 1.
|
Storz, G.,
and Hengge-Aronis, R.
(2000)
Bacterial Stress Responses
, American Society for Microbiology, Washington, D. C.
|
| 2.
|
Narberhaus, F.
(1999)
Mol. Microbiol.
31,
1-8[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Yura, T.,
Kanemori, M.,
and Morita, M.
(2000)
in
Bacterial Stress Response
(Storz, G.
, and Hengge-Aronis, R., eds)
, pp. 3-18, American Society for Microbiology, Washington, D. C.
|
| 4.
|
Servant, P.,
and Mazodier, P.
(2001)
Arch. Microbiol.
176,
237-242[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Schumann, W.,
Hecker, M.,
and Msadek, T.
(2001)
in
Bacillus Subtilis and Its Closest Relatives: From Genes to Cells
(Sonenshein, A. L.
, Hoch, J. A.
, and Losick, R., eds)
, American Society for Microbiology, Washington, D. C.
|
| 6.
|
Zuber, U.,
and Schumann, W.
(1994)
J. Bacteriol.
176,
1359-1363[Abstract/Free Full Text]
|
| 7.
|
Wetzstein, M.,
Völker, U.,
Dedio, J.,
Löbau, S.,
Zuber, U.,
Schiesswohl, M.,
Herget, C.,
Hecker, M.,
and Schumann, W.
(1992)
J. Bacteriol.
174,
3300-3310[Abstract/Free Full Text]
|
| 8.
|
Schmidt, A.,
Schiesswohl, M.,
Völker, U.,
Hecker, M.,
and Schumann, W.
(1992)
J. Bacteriol.
174,
3993-3999[Abstract/Free Full Text]
|
| 9.
|
Homuth, G.,
Masuda, S.,
Mogk, A.,
Kobayashi, Y.,
and Schumann, W.
(1997)
J. Bacteriol.
179,
1153-1164[Abstract/Free Full Text]
|
| 10.
|
Homuth, G.,
Mogk, A.,
and Schumann, W.
(1999)
Mol. Microbiol.
32,
1183-1197[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Mogk, A.,
Homuth, G.,
Scholz, C.,
Kim, L.,
Schmid, F. X.,
and Schumann, W.
(1997)
EMBO J.
16,
4579-4590[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Mogk, A.,
Völker, A.,
Engelmann, S.,
Hecker, M.,
Schumann, W.,
and Völker, U.
(1998)
J. Bacteriol.
180,
2895-2900[Abstract/Free Full Text]
|
| 13.
|
Watanabe, K.,
Yamamoto, T.,
and Suzuki, Y.
(2001)
J. Bacteriol.
183,
155-161[Abstract/Free Full Text]
|
| 14.
|
Yanish-Perron, C.,
Vieira, J.,
and Messing, J.
(1985)
Gene (Amst.)
33,
103-119[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Gragerov, A.,
Nudler, E.,
Komissarova, N.,
Gaitanaris, G. A.,
Gottesman, M. E.,
and Nikiforov, V.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10341-10344[Abstract/Free Full Text]
|
| 16.
|
Saito, H.,
Shibata, T.,
and Ando, T.
(1979)
Mol. Gen. Genet.
170,
117-122[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Schulz, A.,
Tzschaschel, B.,
and Schumann, W.
(1995)
Mol. Microbiol.
15,
421-429[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Kim, L.,
Mogk, A.,
and Schumann, W.
(1996)
Gene (Amst.)
181,
71-76[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Mogk, A.,
Hayward, R.,
and Schumann, W.
(1996)
Gene (Amst.)
182,
33-36[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Fromant, M.,
Blanquet, S.,
and Plateau, P.
(1995)
Anal. Biochem.
224,
347-353[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Hirata, H.,
Fukazawa, T.,
Negoro, S.,
and Okada, H.
(1986)
J. Bacteriol.
166,
722-727[Abstract/Free Full Text]
|
| 22.
|
Homuth, G.,
Heinemann, M.,
Zuber, U.,
and Schumann, W.
(1996)
Microbiology
142,
1641-1649[Abstract/Free Full Text]
|
| 23.
|
Maxam, A. M.,
and Gilbert, W.
(1980)
Methods Enzymol.
65,
499-560[Medline]
[Order article via Infotrieve]
|
| 24.
|
Enz, S.,
Mahren, S.,
Stroeher, U. H.,
and Braun, V.
(2000)
J. Bacteriol.
182,
637-646[Abstract/Free Full Text]
|
| 25.
|
Carrillo, N.,
Ceccarelli, E. A.,
Krapp, A. R.,
Boggio, S.,
Ferreyra, R. G.,
and Viale, A. M.
(1992)
J. Biol. Chem.
267,
15537-15541[Abstract/Free Full Text]
|
| 26.
|
Hecker, M.,
Schumann, W.,
and Völker, U.
(1996)
Mol. Microbiol.
19,
417-428[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Segal, G.,
and Ron, E. Z.
(1996)
FEMS Microbiol. Lett.
138,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Ahmad, S.,
Selvapandiyan, A.,
and Bhatnagar, R. K.
(2001)
Int. J. Syst. Bacteriol.
49,
1387-1394
|
| 29.
|
Minder, A. C.,
Fischer, H. M.,
Hennecke, H.,
and Narberhaus, F.
(2000)
J. Bacteriol.
182,
14-22[Abstract/Free Full Text]
|
| 30.
|
Rüngeling, E.,
Laufen, T.,
and Bahl, H.
(1999)
FEMS Microbiol. Lett.
170,
119-123[Medline]
[Order article via Infotrieve]
|
| 31.
|
Koch, B.,
Kilstrup, M.,
Vogensen, F. K.,
and Hammer, K.
(1998)
J. Bacteriol.
180,
3873-3881[Abstract/Free Full Text]
|
| 32.
|
Landry, S. J.,
Zeilstra-Ryalls, J.,
Fayet, O.,
Georgopoulos, C.,
and Gierasch, L. M.
(1993)
Nature
364,
255-258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Zeilstra-Ryalls, J.,
Fayet, O.,
Baird, L.,
and Georgopoulos, C.
(1993)
J. Bacteriol.
175,
1134-1143[Abstract/Free Full Text]
|
| 34.
|
Braig, K.,
Otwinowski, Z.,
Hegde, R.,
Boisvert, D. C.,
Joachimiak, A.,
Horwich, A. L.,
and Sigler, P. B.
(1994)
Nature
371,
578-586[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Fenton, W. A.,
Kashi, Y.,
Furtak, K.,
and Horwich, A. L.
(1994)
Nature
371,
614-619[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Martin, A.,
Sieber, V.,
and Schmid, F. X.
(2001)
J. Mol. Biol.
309,
717-726[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Houry, W. A.,
Frishman, D.,
Eckerskorn, C.,
Lottspeich, F.,
and Hartl, F. U.
(1999)
Nature
402,
147-154[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Kim, S.-N.,
Kim, S.-W.,
Pyo, S.-N.,
and Rhee, D.-K.
(2001)
Mol. Cells
11,
360-368[Medline]
[Order article via Infotrieve]
|
| 39.
|
Martirani, L.,
Raniello, R.,
Naclerio, G.,
Ricca, E.,
and De Felice, M.
(2001)
FEMS Microbiol. Lett.
198,
177-182[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Banuett, F.,
Hoyt, M. A.,
McFarlane, L.,
Eochols, E.,
and Herskowith, I.
(1986)
J. Mol. Biol.
187,
213-224[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
A. N. Reid, R. Pandey, K. Palyada, H. Naikare, and A. Stintzi
Identification of Campylobacter jejuni Genes Involved in the Response to Acidic pH and Stomach Transit
Appl. Envir. Microbiol.,
March 1, 2008;
74(5):
1583 - 1597.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Roncarati, A. Danielli, G. Spohn, I. Delany, and V. Scarlato
Transcriptional Regulation of Stress Response and Motility Functions in Helicobacter pylori Is Mediated by HspR and HrcA
J. Bacteriol.,
October 15, 2007;
189(20):
7234 - 7243.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Wilson, C. C. Wu, J. R. Yates III, and M. Tan
Chlamydial GroEL Autoregulates Its Own Expression through Direct Interactions with the HrcA Repressor Protein
J. Bacteriol.,
November 1, 2005;
187(21):
7535 - 7542.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Andersen, L. Brondsted, B. M. Pearson, F. Mulholland, M. Parker, C. Pin, J. M. Wells, and H. Ingmer
Diverse roles for HspR in Campylobacter jejuni revealed by the proteome, transcriptome and phenotypic characterization of an hspR mutant
Microbiology,
March 1, 2005;
151(3):
905 - 915.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Guisbert, C. Herman, C. Z. Lu, and C. A. Gross
A chaperone network controls the heat shock response in E. coli
Genes & Dev.,
November 15, 2004;
18(22):
2812 - 2821.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Susin, H. R. Perez, R. L. Baldini, and S. L. Gomes
Functional and Structural Analysis of HrcA Repressor Protein from Caulobacter crescentus
J. Bacteriol.,
October 15, 2004;
186(20):
6759 - 6767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. C. Wilson and M. Tan
Stress Response Gene Regulation in Chlamydia Is Dependent on HrcA-CIRCE Interactions
J. Bacteriol.,
June 1, 2004;
186(11):
3384 - 3391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bougdour, C. Lelong, and J. Geiselmann
Crl, a Low Temperature-induced Protein in Escherichia coli That Binds Directly to the Stationary Phase {sigma} Subunit of RNA Polymerase
J. Biol. Chem.,
May 7, 2004;
279(19):
19540 - 19550.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Tomas, N. E. Welker, and E. T. Papoutsakis
Overexpression of groESL in Clostridium acetobutylicum Results in Increased Solvent Production and Tolerance, Prolonged Metabolism, and Changes in the Cell's Transcriptional Program
Appl. Envir. Microbiol.,
August 1, 2003;
69(8):
4951 - 4965.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Versteeg, A. Escher, A. Wende, T. Wiegert, and W. Schumann
Regulation of the Bacillus subtilis Heat Shock Gene htpG Is under Positive Control
J. Bacteriol.,
January 15, 2003;
185(2):
466 - 474.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Hitomi, H. Nishimura, Y. Tsujimoto, H. Matsui, and K. Watanabe
Identification of a Helix-Turn-Helix Motif of Bacillus thermoglucosidasius HrcA Essential for Binding to the CIRCE Element and Thermostability of the HrcA-CIRCE Complex, Indicating a Role as a Thermosensor
J. Bacteriol.,
January 1, 2003;
185(1):
381 - 385.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|