JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M204081200 on May 31, 2002

J. Biol. Chem., Vol. 277, Issue 36, 32923-32929, September 6, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/36/32923    most recent
M204081200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Norambuena, L.
Right arrow Articles by Orellana, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Norambuena, L.
Right arrow Articles by Orellana, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Transport of UDP-galactose in Plants

IDENTIFICATION AND FUNCTIONAL CHARACTERIZATION OF AtUTr1, AN ARABIDOPSIS THALIANA UDP-GALACTOSE/UDP-GLUCOSE TRANSPORTER*

Lorena NorambuenaDagger §, Lorena MarchantDagger §, Patricia Berninsone||, Carlos B. Hirschberg||, Herman SilvaDagger , and Ariel OrellanaDagger §**

From the Dagger  Department of Biology, Faculty of Sciences and the § Millenium Institute in Cell Biology and Biotechnology, University of Chile, Las Palmeras 3425, Ñuñoa, Casilla 653, Santiago, Chile and the || Department of Molecular and Cell Biology, Boston University, School of Dental Medicine, Boston, Massachusetts 02118

Received for publication, April 26, 2002, and in revised form, May 31, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The synthesis of non-cellulosic polysaccharides and glycoproteins in the plant cell Golgi apparatus requires UDP-galactose as substrate. The topology of these reactions is not known, although the orientation of a plant galactosyltransferase involved in the biosynthesis of galactomannans in fenugreek is consistent with a requirement for UDP-galactose in the lumen of the Golgi cisternae. Here we provide evidence that sealed, right-side-out Golgi vesicles isolated from pea stems transport UDP-galactose into their lumen and transfer galactose, likely to polysaccharides and other acceptors. In addition, we identified and cloned AtUTr1, a gene from Arabidopsis thaliana that encodes a multitransmembrane hydrophobic protein similar to nucleotide sugar transporters. Northern analysis showed that AtUTr1 is indeed expressed in Arabidopsis. AtUTr1 is able to complement the phenotype of MDCK ricin-resistant cells; a mammalian cell line deficient in transport of UDP-galactose into the Golgi. In vitro assays using a Golgi-enriched vesicle fraction obtained from Saccharomyces cerevisiae expressing AtUTr1-MycHis is able to transport UDP-galactose but also UDP-glucose. AtUTr1- MycHis does not transport GDP-mannose, GDP-fucose, CMP-sialic acid, UDP-glucuronic acid, or UDP-xylose when expressed in S. cerevisiae. AtUTr1 is the first transporter described that is able to transport UDP-galactose and UDP-glucose. Thus AtUTr1 may play an important role in the synthesis of glycoconjugates in Arabidopsis that contain galactose and glucose.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

UDP-galactose is a substrate used in the synthesis of non-cellulosic polysaccharides and glycoproteins. The incorporation of galactose into these macromolecules is catalyzed by galactosyltransferases, which are thought to be localized in the Golgi apparatus (1). A galactosyltransferase from fenugreek involved in the synthesis of galactomannans has been recently cloned (2). The information derived from the primary sequence of this protein suggests that this enzyme is a membrane-bound protein with its catalytic site facing the lumen of the Golgi cisternae. This orientation is similar to galactosyltransferases involved in protein glycosylation of animal cells. Because it is likely that transfer of galactose to non-cellulosic polysaccharides and glycoproteins takes place in the lumen of the Golgi apparatus, transport of UDP-galactose should be required to fulfill this process.

UDP-galactose transporters have been described in animal cells, Drosophila, and yeast (3-7). Studies in MDCK1 cells and yeast mutants deficient in transport of UDP-galactose into the Golgi lumen have shown that they play important roles in galactosylation of proteins, proteoglycans, and sphingolipids (8-10). Complementation of mutants allowed the cloning of putative UDP-galactose transporter genes from human and Schizosaccharomyces pombe (6, 10). Through PCR-based approaches and screening of libraries, murine, hamster, and Drosophila cDNAs were also isolated (6, 7, 11). Expression of these genes in Saccharomyces cerevisiae followed by in vitro transport assays into Golgi vesicles confirmed that the gene products actually transport UDP-galactose (12). These genes encode proteins with a molecular mass of around 35 kDa; their hydrophobicity plots predict that they have 8-10 transmembrane domains.

Despite the potential importance of UDP-galactose transporter in the synthesis of cell wall components, a UDP-galactose transport activity has not been characterized in the plant Golgi apparatus, and a gene encoding for a UDP-galactose transporter has not yet been identified. Here we report that sealed Golgi vesicles isolated from pea stems transport UDP-galactose and transfer galactose to endogenous acceptors. In addition, we cloned a cDNA from A. thaliana, named AtUTr1 for Arabidopsis thaliana UDP-galactose Transporter 1 that was functionally characterized by complementing a Golgi UDP-galactose transporter mutant, expressing it in S. cerevisiae, and measuring transport in vitro of nucleotide sugars in Golgi-enriched vesicles. The results show that AtUTr1 encodes a nucleotide sugar transporter able to transport both UDP-galactose and UDP-glucose, although it does not use other nucleotide sugars tested. Transport of UDP-galactose into plant Golgi vesicles supports a model in which galactosylation of polysaccharides and other acceptors such as lipids occurs in the lumen of the Golgi apparatus, and the AtUTr1 gene product from Arabidopsis could be involved in that process.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Radiolabeled Substrates-- UDP-[3H]galactose (12 Ci/mmol), UDP-[3H]glucose (21 Ci/mmol) GDP-[3H]fucose (17.3 Ci/mmol), UDP-[3H]xylose (10 Ci/mmol), CMP-[3H]N-acetylneuraminic acid (32.8 Ci/mmol), GDP-[3H]mannose (18.9 Ci/mmol), sodium [3H]acetate (4.1 Ci/mmol), and [3H]deoxyglucose (29.8 Ci/mmol) were purchased from PerkinElmer Life Sciences. [3H]UDP-glucuronic acid was enzymatically prepared as described by Orellana and Mohnen (13).

Isolation of Golgi Vesicles from Pea Stems-- A Golgi-enriched vesicle fraction was isolated from the third internode of 7-day-old etiolated pea seedlings as described previously by Muñoz et al. (14). The orientation and integrity of these vesicles was confirmed measuring latency of the luminal enzymes UDPase and xyloglucan alpha -(1-2)-fucosyltransferase (15).

Proteolysis of the Golgi Vesicles-- Proteolysis was carried out as described by Wulff et al. (15). Briefly, vesicles were treated with proteinase K (40 ng per 1 µg of Golgi vesicles protein) for 30 min at 30 °C. The reaction was stopped by adding 1 mM phenylmethylsulfonyl fluoride, and the samples were kept on ice until they were used in the UDP-galactose uptake assays.

Measurements of UDPase using Native Gels-- The luminal UDPase activity was determined as described by Orellana et al. (16). Briefly, Golgi vesicles were solubilized using 1.5% Triton X-100. Samples were separated in a 10% polyacrylamide gel, and the activity was measured in the presence of 3 mM UDP and 1.5 mM Pb(NO3)2. The inorganic phosphate released during the reaction formed an insoluble complex with lead, which is then visualized with 1% (NH4)2S.

UDP-galactose Uptake Assays in Pea Stem Golgi Vesicles-- Golgi vesicles were incubated with 1 µM UDP-[3H]galactose in a medium containing 0.25 M sucrose, 10 mM Tris-HCl, pH 7.5, and 1 mM MgCl2 (STM buffer). To stop the reaction, the vesicles were diluted in cold STM buffer and filtered through 0.7-µm glass fiber filters. Subsequently the filters were washed with an additional 10 volumes of cold STM buffer and dried, and the radioactivity was determined by liquid scintillation counting.

Transport of UDP-galactose in Pea Stem Golgi Vesicles-- Transport of UDP-galactose was measured using a modification of the method described by Perez and Hirschberg (17). Golgi vesicles (1 mg of protein) were incubated in STM buffer at 25 °C with 1 µM UDP-[3H]galactose (specific activity, 788 cpm/pmol). The final volume was 0.4 ml. After 5 min the reaction was stopped by dilution using 4 ml of cold STM buffer, and the vesicles were immediately separated from the incubation medium by centrifugation at 100,000 × g for 40 min. The vesicle pellet was surface-washed and resuspended in 500 µl of water. The sample was brought to 70% ethanol and kept on ice for 30 min. After centrifugation at 10,000 × g for 15 min, the radioactivity associated with the 70% ethanol-insoluble material was determined by liquid scintillation spectrometry (TPs). The 70% ethanol-soluble material was dried, resuspended in 100 µl of water, and extracted with 100 µl of chloroform/methanol (5:1). The water-soluble UDP-[3H]galactose (St) and the radioactivity present at the organic phase plus the insoluble fraction that remained at the interface were determined (TP+L). The amount of UDP-galactose within the vesicles (Si) was calculated by subtracting the estimated amount of radioactive UDP-[3H]galactose outside the vesicles (So) from St as described by Perez and Hirschberg (17). To calculate the amount of substrate outside the vesicles (So), the concentration of substrate in the medium was multiplied by the volume outside the vesicles in the pellet (Vo), which was calculated using the non-penetrator [3H]acetate. The total volume in the pellet (Vt) was calculated using [3H]deoxyglucose, which penetrates the vesicles. Thus the internal volume (Vi), required to estimate the internal concentrations of substrates, was determined by subtracting Vo from Vt.

Cloning of AtUTr1-- AtUTr1 cDNA was amplified from the A. thaliana cDNA library pFL61 (American Type Culture Collection) using Platinum Pfx polymerase (Invitrogen) and primers flanking the coding region, designed from the genomic sequence. The upstream primer was TCTAGGATCCTAATGGAGGTCCATGGCTCC and contained a BamHI restriction site (underlined sequence). The downstream primer was ATGAGCGGCCGCCTTCCACTCTTTTGCTTC and contained a NotI site (underlined sequence). A single amplification product of the expected size (1 kb) was obtained. After verification by sequencing, the product was digested with BamHI and NotI and cloned in the mammalian expression vector pcDNA3.1-MycHis version A (Invitrogen) to generate pcDNA-AtUTr1-MycHis. For expression in S. cerevisiae, a vector derived from p426GPD (18) was engineered to contain a MycHis tag as follows. A 237-bp fragment containing the MycHis tag was amplified from pcDNA3.1-MycHis using the reverse and T7 primer, digested with BamHI and ligated to BamHI/SmaI-digested p426GPD to generate p426GPD-MycHis. The 1-kb PCR product containing AtUTr1 cDNA was digested with BamHI and NotI and ligated to BamHI/NotI-digested p426GPD-MycHis vector to generate p426GPD-AtUTr1-MycHis.

Yeast Transformation and Subcellular Fractionation-- S. cerevisiae strain RSY255 (MATa, ura3-52, 112) transformed with the URA plasmids p426GPD-MycHis and p426GPD-AtUTr1-MycHis were grown at 30 °C in liquid medium containing 0.67% yeast nitrogen base, 2% glucose, and SCM-URA. Transformation with the plasmids was performed using lithium acetate and followed standard procedures. S. cerevisiae transformed with the p426GPD-MycHis and p426GPD-AtUTr1-MycHis plasmids were grown, and spheroplasts were prepared using Zymolyase100T as described by Berninsone et al. (19). Cells were then disrupted by pipetting the cell suspension up and down and then centrifuged successively at 450 × g, 10,000 × g, and 100,000 × g to obtain pellet fractions P1, P2, and P3. The last fraction, P3, was enriched in Golgi apparatus-derived vesicles (20).

Expression in Yeast of AtUTr1-MycHis Determined by Western Blot Analysis-- The expression of AtUTr1 in microsomal membranes was monitored by Western blotting using polyvinylidene difluoride membranes and a c-Myc monoclonal antibody (Santa Cruz Biotechnology).

Nucleotide Sugar Transport Assays in Yeast Golgi-enriched Vesicles-- Transport assays were performed as described by Berninsone et al. (19). Yeast Golgi-enriched vesicles (1 mg of protein from fraction P3) were incubated at 30 °C in the presence of the radioactive nucleotide sugar to be tested. After 3 min the vesicles were separated from the incubation medium by centrifugation at 100,000 × g for 50 min. The pellet was washed and resuspended in 4% perchloric acid, and the total acid-soluble radioactive nucleotide sugar (St) was determined. The amount of radioactivity inside the vesicles (Si) was calculated by subtracting the estimated amount of radioactive nucleotide sugar outside the vesicles (So) from the standards.

Stable Transfection of MDCK Cells and Ricin Sensitivity Assay-- MDCK and MDCK-RCAr (21) cells were grown in complete medium (minimal essential medium, 10% fetal calf serum, and antibiotics) at 37 °C. MDCK-RCAr cells were transfected with pcDNA3-MycHis and pcDNA-AtUTr1-MycHis using LipofectAMINE (Invitrogen). Transfectants were selected using complete medium containing 0.8 mg/ml geneticin (G418). Geneticin-resistant colonies were cloned, and resistance to ricin was determined by plating 2000 cells/well in 24-well plates using complete medium containing 0.1 µg/ml RCAII (EY Laboratories, San Mateo, CA). After 7 days of exposure to RCAII at 37 °C, surviving cells were determined by staining with 1% methylene blue in 50% methanol.

RNA Isolation and Northern Blots-- Total RNA was extracted from 2-week-old Arabidopsis seedlings using Trizol (Invitrogen) and poly(A)+ RNA was isolated using oligo(dT) cellulose (MessageMaker mRNA Isolation System; Invitrogen). Total RNA (40 µg) and poly(A)+ RNA (2.5 µg) were fractionated by electrophoresis in an agarose gel containing formaldehyde and capillary transferred to nylon membranes (Hybond N+; Amersham Biosciences) using 10× SSC. A 32P-radiolabeled DNA probe was prepared from the AtUTr1 cDNA fragment using a random priming oligolabeling kit (Amersham Biosciences). Hybridization and all the other procedures were done as described by Orellana et al. (22).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Topology of Galactosylation and Transport of UDP-galactose into Golgi Vesicles-- To investigate the topology of galactosylation and transport of UDP-galactose into the plant Golgi apparatus we analyzed the uptake of UDP-[3H]galactose into sealed, right-side-out pea stem Golgi vesicles using a filtration assay. Uptake of UDP-[3H]galactose was higher at 25 than at 0 °C and decreased close to background levels when vesicles were heat-inactivated before the assay (Fig. 1). These results suggest that a protein-mediated process was involved in the uptake of UDP-galactose. Permeabilization of the vesicles prior to the assay using low concentrations of Triton X-100 did not significantly change the uptake of UDP-[3H]galactose, suggesting that little UDP-[3H]galactose was free in the lumen, and likely [3H]galactose was transferred to endogenous acceptors that remained associated to the permeabilized vesicles. Treatment of the vesicles with proteinase K caused a decrease in the uptake of UDP-galactose (Fig. 2). This treatment did not affect the activity of a luminal Golgi UDPase (16) measured in native gels. As seen in Fig. 2B, the activity band detected in Golgi vesicles was still present in proteinase K-treated vesicles, whereas this activity band disappeared when Triton X-100-permeabilized Golgi vesicles were treated with the protease. These results suggest that proteinase K treatment did not alter the integrity of Golgi vesicles; therefore, a protein (or proteins) located in the cytosolic face of the Golgi membrane would be required for the uptake and/or the transfer to acceptors. Permeabilization of the proteinase-K treated vesicles led to an increase in the incorporation of radioactive substrate into the Golgi vesicles, indicating that galactosyltransferases were still active and suggesting that, like the UDPase, these galactosyltransferases were located in the lumen. Proteinase K treatment of vesicles already permeabilized decreased the uptake of UDP-[3H]galactose under all conditions, suggesting that proteolysis affected the luminal galactosyltransferases. These results suggested that galactosyltransferases are located in the lumen of the Golgi apparatus, and UDP-galactose should be transported into Golgi vesicles. The addition of DIDS (4,4'-diisothiocyanatostilbene-2-2'-disulfonic acid), a known inhibitor of nucleotide sugar and anionic transporters (23), decreased the uptake of UDP-galactose supporting the idea that transport of UDP-galactose takes place in the plant Golgi apparatus (Fig. 1).


View larger version (11K):
[in this window]
[in a new window]
  		Fig. 1.   Uptake of UDP-galactose by pea stem Golgi vesicles. Golgi vesicles (100 µg of protein) were incubated with 1 µM UDP-[3H]galactose for 5 min under different conditions: 0 °C, incubation in an ice bath; 25 °C, incubation at 25 °C; +Tx-100, incubation at 25 °C in the presence of 0.1% Triton X-100; 100 °C, vesicles boiled for 5 min prior to the assay; DIDS, incubation in the presence of 20 µM DIDS. The reaction was stopped by a 10-fold dilution with STM buffer and filtering immediately. Filters were dried, and the radioactivity was counted using liquid scintillation. Results are presented as mean ± S.D.


View larger version (33K):
[in this window]
[in a new window]
  		Fig. 2.   UDP-galactose uptake into Golgi vesicles is sensitive to protease treatment. A, Golgi vesicles were incubated with (+) and without (-) proteinase K in the presence (+) and absence (-) of 0.1% Triton X-100 as described under "Materials and Methods." These vesicles were immediately used in UDP-[3H]galactose uptake experiments, performed in the absence (white bars, intact vesicles) or presence (black bars, permeabilized vesicles) of 0.1% Triton X-100. B, the activity of a luminal UDPase using native gels. Upon electrophoresis in a 10% polyacrylamide gel the UDPase activity was detected using 3 mM UDP. The arrowheads indicate the position of the luminal Golgi UDPase. Proteinase K treatment in Triton X-100-permeabilized Golgi vesicles produced proteolytic fragments still active, which are shown with a bracket. Treatment with Triton X-100 alone had no effect on the mobility of the UDPase activity (not shown).

To provide additional evidence that pea stem Golgi vesicles are able to transport UDP-galactose we used the method described by Perez and Hirschberg (17) that allows the estimation of the amount of UDP-galactose located inside the vesicles (Si) as well as its concentration ([Si]) within the vesicles upon incubation of Golgi vesicles with UDP-[3H]galactose. Table I shows that the content of UDP-[3H]galactose within the pea vesicles (Si) was higher at 25 than at 0 °C, suggesting that transport of UDP-[3H]galactose was temperature-dependent. Incubation of Golgi vesicles with UDP-[3H]galactose resulted in a significant transfer of radioactivity into 70% ethanol-insoluble material, suggesting that [3H]galactose was transferred to polysaccharides. The 70% ethanol-soluble material was subjected to chloroform/methanol partitioning, where part of the radioactive material became insoluble, and the other part became soluble in the organic phase, suggesting that [3H]galactose was transferred to glycolipids and glycoproteins. Transfer to acceptors was also temperature-dependent (Table I).

                              
View this table:
[in this window]
[in a new window]
 
Table I
Transport of UDP-galactose into pea stem Golgi vesicles
Golgi vesicles (1 mg) were incubated with 1 µM UDP-[3H]galactose for 5 min in a final volume of 0.4 ml. The reaction was stopped by diluting with 4 ml of cold STM (0.25 M sucrose, 10 mM Tris-HCl, pH 7.5, 1 mM MgCl2) and immediately centrifuged at 100,000 × g. The amount of UDP-[3H]galactose transported into the lumen of the vesicles (Si), the amount of [3H]galactose transferred into 70% ethanol-insoluble acceptors (TPs) and to acceptors at the organic phase plus the aqueous/organic interface (TP+L) are shown. To estimate the concentration of UDP-galactose in the vesicles [Si] the volumes Vo and Vi were determined as described under "Materials and Methods." [Sm] corresponds to the concentration of UDP-galactose in the medium once the reaction is finished.

Identification of a Putative UDP-galactose Transporter Gene in A. thaliana-- The results shown above, suggest that UDP-galactose transporters are present in the plant Golgi apparatus. Thus, to identify plant genes encoding for a putative UDP-galactose transporter we searched the A. thaliana data base for sequences similar to UDP-galactose transporter genes already described in animal cells and yeast (3, 4, 24). When we began this work the Arabidopsis genome was not completely sequenced and at that time, using the TBLASTN algorithm, we identified a gene (currently annotated as At2g02810) that showed high sequence similarity (54% similarity at the protein level) to the human UDP-galactose transporter-related l gene (hUGTrel1) (24). Subsequently, when the Arabidopsis genome was completely sequenced, we found other sequences (shown below) that have similarity to UDP-galactose transporter genes; however, the first gene identified remained the most similar to hUGTrel1. We named this gene AtUTr1 for Arabidopsis thaliana UDP-galactose Transporter 1 (Fig. 3A). The predicted protein has an estimated molecular mass of 36,942 daltons, and hydropathy analyses predict eight putative transmembrane domains. Interestingly, comparison of the hydrophobicity plots of the AtUTr1 and hUGTrel1 proteins showed that they are highly similar (Fig. 3B).


View larger version (42K):
[in this window]
[in a new window]
  		Fig. 3.   Comparison of the primary sequence and hydrophobicity plot of AtUTr1 and hUGTrel1. A, primary sequence of the protein predicted for AtUTr1 and hUGTrel1 were compared using Clustal and then depicted using Shadebox. B, Kyte-Doolittle hydropathy plots of AtUTr1 and hUGTrel1. The accession number for AtUTr1 is AY115566.

To confirm that AtUTr1 is indeed expressed in Arabidopsis we performed Northern analysis using total RNA and poly(A)+ RNA obtained from 2-week-old seedlings. A single band of 1.58 kb was detected in all cases (Fig. 4).


View larger version (57K):
[in this window]
[in a new window]
  		Fig. 4.   AtUTr1 is expressed in A. thaliana. Total RNA and poly(A)+ RNA isolated from 2-week-old seedlings were fractionated in a 1.5% agarose-formaldehyde gel, blotted to a nylon membrane as described under "Materials and Methods," and hybridized with the AtUTr1 cDNA labeled with 32P. Lane 1 contains 40 µg of total RNA. Lane 2 contains 2.5 µg of purified poly(A)+.

AtUTr1 Complements a MDCK Mutant Cell Line Deficient in UDP-galactose Transport into the Golgi-- To test the ability of AtUTr1 to transport UDP-gal, we cloned AtUTr1 in the pcDNA3-Myc mammalian expression vector and then we stably transfected it in the mutant cell line MDCK-RCAr. The primary defect observed in this mutant is impaired transport of UDP-galactose into the Golgi apparatus, which results in reduced availability of UDP-galactose for the luminal galactosyltransferases. This mutant cell line tolerates a 10× higher concentration of the lectin ricin (RCA) than do wild type cells (8, 21). Ricin has a cytotoxic effect that depends on the binding to galactosyl residues and the ricin-resistant phenotype of the mutant correlates with a pleitropic deficiency in galactosylation of glycoproteins and sphingolipids. Transfection with AtUTr1 resulted in changes in the morphology and rate of growth of the transfectant, resembling the wild type cells instead of the mutant (not shown). Addition of ricin at 0.1 µg/ml for 7 days had toxic effects both on the mutants transfected with AtUTr1 and the wild type cells (Fig. 5); however, this concentration of ricin showed no visible toxicity on the non-transfected mutant nor the mutant transfected with the vector alone. These results suggest that expression of AtUTr1 in MDCK-RCAr cells restores galactose addition into glycoconjugates by complementing the deficiency of transport of UDP-galactose into the Golgi.


View larger version (83K):
[in this window]
[in a new window]
  		Fig. 5.   AtUTr1 makes MDCK-RCAr cells sensitive to the lectin ricin. Cells were grown at 37 °C for 7 days in the presence (+) or absence (-) of 0.1 µg/ml of ricin (RCA II). Then the culture medium was removed, and the surviving cells were stained using 1% methylene blue in 50% methanol. MDCK, wild type cells; RCAr, MDCK cell line mutant deficient in transport of UDP-galactose transport into the Golgi; Control, MDCK-RCAr cells stably transfected with the vector pcDNA.3-MycHis; AtUTr1, MDCK-RCAr cells stably transfected with pcDNA3-AtUTr1-MycHis.

AtUTr1 Encodes a Protein That Transports UDP-galactose and UDP-glucose-- To confirm that AtUTr1 encodes for a nucleotide sugar transporter and also to study the specificity of the transporter, we expressed a MycHis epitope-tagged version of the protein in the yeast S. cerevisiae, an organism that has been used for the heterologous expression and functional analysis of other nucleotide sugar transporters genes such as the CMP-sialic acid and UDP-galactose transporters (12, 25). Western blot analysis using antibodies against the Myc epitope showed that the microsomal fraction obtained from yeast transformed with an expression vector containing AtUTr1-MycHis expressed a protein of 32 kDa (Fig. 6). This molecular mass was lower than the expected molecular mass predicted from the primary sequence of the protein plus the MycHis epitope (41 kDa). However, a difference between the predicted molecular mass and the apparent one was also found in other cases of heterologous expression of nucleotide sugar transporters in yeast (25).


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 6.   AtUTr1-MycHis is expressed in S. cerevisiae and found in a microsomal fraction. Microsomes were prepared from yeast transformed both with the vector alone (p426GPD-MycHis) (lane 1) or the vector containing AtUTr1 (lane 2). Proteins were detected by Western blot using an anti-Myc monoclonal antibody.

To determine the substrate specificity of AtUTr1-MycHis using an independent approach, we expressed AtUTr1-MycHis in S. cerevisiae and obtained Golgi vesicle enriched-fractions from yeast expressing AtUTr1-MycHis and from cells transformed with the empty vector. The latency of GDPase activity in both of these vesicles preparations (26) was above 85% indicating that vesicles were right-side-out and sealed. Transport of UDP-galactose was significantly higher into Golgi vesicles isolated from yeast expressing AtUTr1-MycHis than in vesicles isolated from yeast transformed with the vector alone (Fig. 7). In contrast, transport of CMP-sialic acid, GDP-mannose, GDP-fucose, UDP-glucuronic acid, and UDP-xylose was not significantly different in vesicles obtained from the yeast expressing AtUTr1-MycHis and the control. We also found that expression of AtUTr1-MycHis significantly increased transport of UDP-glucose into the vesicles, indicating that AtUtr1 is also able to transport UDP-glucose. No UDP-glucose epimerase activity was detected in the yeast Golgi vesicles expressing AtUTr1 (not shown), ruling out the possibility that UDP-glucose transport activity resulted from UDP-galactose formation. The increase in the transport of UDP-galactose and UDP-glucose by vesicles isolated from yeast expressing AtUTr1 was 4- and 2.3-fold over the control, respectively. However, when the absolute values (fmol/mg/3 min) transported into the vesicles were compared, the amount of UDP-glucose was higher than the amount of UDP-galactose. This result suggests that AtUTr1 prefers UDP-glucose as a substrate; however, the presence in yeast Golgi vesicles of an endogenous mechanism involved in transport of UDP-glucose, and not UDP-galactose (19, 27), may contribute to obtain a higher increment in transport of UDP-glucose when AtUTr1 is expressed in yeast. This would not allow us to establish a direct comparison of the net amount of UDP-galactose and UDP-glucose transported by AtUTr1. Therefore, these results indicate that AtUTr1 encodes a nucleotide sugar transporter that uses both UDP-galactose and UDP-glucose as substrates.


View larger version (14K):
[in this window]
[in a new window]
  		Fig. 7.   AtUTr1 expressed in yeast transport UDP-galactose and UDP-glucose. A subcellular fraction enriched in Golgi vesicles was isolated from both yeast transformed with the vector alone (open bars) or the vector containing AtUTr1 (black bars). Vesicles were incubated with 0.1 µM of different radiolabeled nucleotide sugar for 3 min at 30 °C, and the amount of nucleotide sugars transported (Si) was determined as described under "Materials and Methods." Determinations were done in triplicate and the S.E. is depicted. A, transport of UDP-galactose, UDP-glucuronic acid, UDP-xylose, GDP-fucose, and CMP-sialic acid. B, transport of GDP-mannose and UDP-glucose.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Different lines of evidence suggest that Golgi vesicles isolated from pea stems are able to transport UDP-galactose. Studies of UDP-galactose uptake, along with controlled proteolysis of Golgi vesicles, indicated that a protease-sensitive factor is required for galactosylation. The use of DIDS, a known inhibitor of nucleotide sugar and anionic transporters, caused a decreased in UDP-galactose uptake. Finally, UDP-galactose transport studies, using a well standardized procedure, indicated that UDP-galactose is transported into the lumen of Golgi vesicles. On the other hand, incubation of Golgi vesicles with UDP-galactose resulted in a significant transfer of galactose into endogenous acceptors and a significant portion was likely to be polysaccharides. It is known that UDP-galactose is a substrate for the synthesis of different non-cellulosic polysaccharides (xyloglucan, galactomannans, rhamnogalacturonan I and II), proteoglycans such as arabinogalactans, and glycoproteins (28). However, until now only one galactosyltransferase involved in polysaccharide biosynthesis has been cloned. This enzyme from Trigonella foenum-graecum L, participates in galactomannan biosynthesis, and its coding sequence predicts a type II membrane-bound protein, with its catalytic domain oriented toward the lumen of the Golgi apparatus (2). Mammalian galactosyltransferases are also membrane-bound proteins with their catalytic domains facing the lumen of the Golgi apparatus (29). Then, to have a normal galactosylation process, the topological arrangement of the galactosyltransferases made necessary the transport of UDP-galactose from the cytosol into the Golgi lumen. Therefore, it is likely that synthesis of galactose-containing cell wall polysaccharides as well as the galactosylation of other acceptors (i.e. glycoproteins and lipids) that takes place in the plant Golgi lumen would depend on the transport of UDP-galactose.

Studies in mammalian cells, Drosophila, and yeast indicate that multiple transmembrane proteins are responsible for the transport of UDP-galactose in the Golgi apparatus. To identify UDP-galactose transporters in plants, we searched the A. thaliana data base for sequences homologous to UDP-galactose transporters from other organisms. This analysis led us to identify AtUTr1, a gene that in Northern analysis of RNA from Arabidopsis seedlings appears as a single band and whose sequence predicts a multitransmembrane domain protein. Two lines of evidence indicate that AtUTr1 is able to transport UDP-gal. First, a MDCK mutant cell line deficient in transport of UDP-galactose into the Golgi, which is highly tolerant to the cytotoxic effect of the lectin ricin, becomes sensitive to ricin when AtUTr1 is stably transfected in these cells. This result suggests that AtUTr1 is able to restore UDP-galactose transport into the Golgi apparatus of these cells. Berninsone et al. (19) have recently shown that SQV7, a Caenorhabditis elegans protein that transports UDP-galactose as well as UDP-glucuronic acid and UDP-N-acetylgalactosamine, was also able to complement the MDCK-RCAr cell line. Therefore, to evaluate directly both the ability to transport UDP-galactose and the specificity of AtUTr1, our second approach was to express the gene in the yeast S. cerevisiae and to measure transport of nucleotide sugars into a Golgi-enriched fraction. In this heterologous expression system, AtUTr1 was able to transport UDP-galactose and UDP-glucose but not other nucleotide sugars such as CMP-sialic acid, GDP-mannose, GDP-fucose, UDP-glucuronic acid, and UDP-xylose. Although the net amount of UDP-glucose transported into vesicles expressing AtUTr1 was higher than the amount of UDP-galactose, the presence of an endogenous transport activity for UDP-glucose, and not UDP-galactose, makes it difficult to establish a direct comparison in the substrate preference of AtUTr1. The reason is that nucleotide sugar transporters are antiporters that exchange nucleotide sugars with nucleoside monophosphate (30). Because UDP-glucose is endogenously transported (19, 27), it is likely that UMP formed in the vesicles from UDP-glucose, may stimulate the transport of UDP-glucose by AtUTr1. In contrast, under normal conditions UDP-galactose is not transported, so that it is unlikely that UMP may be formed. Therefore, despite the ability of AtUTr1 to transport UDP-galactose, the lack of UMP, may affect the efficiency of AtUTr1 to transport UDP-galactose in yeast Golgi vesicles. In summary, our results confirm that AtUTr1 is a nucleotide sugar transporter that uses both UDP-galactose and UDP-glucose as substrates indicating that is a nucleotide sugar transporter with a dual specificity.

Recently, Kainuma et al. (5) showed that HUT1, a gene from S. cerevisiae, homologous to AtUTr1 and hUGTrel1, is able to transport UDP-galactose but not UDP-glucose. Moreover, the overexpression of HUT1 in yeast stimulated the galactosylation of cell surface molecules synthesized at the Golgi apparatus, suggesting that HUT1 is able to transport UDP-galactose into the Golgi lumen. However, immunofluorescence studies and genetic analysis suggest that HUT1 is located at the endoplasmic reticulum in yeast (31). Although AtUTr1 is able to transport UDP-galactose, its actual subcellular localization is not yet known. The fact that AtUTr1 complements a mutant mammalian cell line deficient in transport of UDP-galactose into the Golgi suggests that at least some of the expressed protein is localized in the Golgi apparatus of the transfected cells. Moreover, upon heterologous expression in yeast we measured UDP-galactose/UDP-glucose transport in a membrane fraction enriched in Golgi vesicles, suggesting that some of the transporter may be located at the Golgi apparatus in yeast. Future studies using specific antibodies against AtUTr1 and immunoelectron microscopy will help to determine the actual localization of AtUTr1 in Arabidopsis.

UDP-galactose transporters from humans, S. pombe, hamster, and mice show high conservation in their sequences. Moreover, they share some consensus sequences where key amino acid residues have been shown to be essential for the transport of UDP-galactose (6). Although AtUTr1 also transports UDP-Gal, we do not find these conserved sequences in the protein. SQV7, a C. elegans nucleotide sugar transporter that transports UDP-galactose as well as UDP-N-acetylgalactosamine and UDP-glucuronic acid as substrates, does not have the primary sequence motifs found in the mammalian UDP-galactose transporters either (32). AtUTr1 is the first gene found in the Arabidopsis data base to show homology to UDP-galactose transporters already described in other organisms. The completion of the genome sequence of Arabidopsis allowed the identification, using TBLASTN analysis, of at least five other genes present in the Arabidopsis genome that encode for putative UDP-galactose transporters (Fig. 8). These genes have different degrees of sequence similarity to UDP-galactose transporter genes from other species. However, the level of amino acid identity is not an indicator of their substrate specificity (33); therefore, functional expression of these genes will be necessary to test whether they encode for UDP-galactose transporters or they have other specificities.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 8.   The A. thaliana genome has several putative UDP-galactose transporters. A search using TBLASTN, reveals that six Arabidopsis genes encode for proteins that belong to a family of proteins (AtUTr) that have sequence similarity to UDP-galactose transporters from human (huUGalT1, huGalT2, and huGTrel1), S. pombe (spGms, spHUT1), S. cerevisiae (scHUT1), and C. elegans (SQV7). A, a tree based on the amino acid sequence of UDP-galactose transporters obtained with the ClustalW program. B, structural characteristics of the different AtUTr genes and the deduced proteins is shown. A comparison of amino acid identity (&) among AtUTr1 (At2g02810) and the other sequences was performed using the program SIM at www.expasy.org. Accession numbers (*) are defined by the Arabidopsis Genome Initiative.

The physiological relevance of nucleotide sugar transport into the Golgi has been demonstrated in yeast, nematodes, protozoa, Drosophila, mammalian cell lines, and humans. In each of these organisms, impairment of nucleotide sugar transport into the Golgi apparatus results in a deficiency of the corresponding sugar in glycoconjugates, which can in turn produce dramatic phenotypes (3, 32, 34-37). In plants, the transport of UDP-galactose into the Golgi apparatus is likely to be a critical step to ensure the proper synthesis of galactose-containing polysaccharides such as xyloglucan, galactomannans, rhamnogalacturonans, as well as glycoproteins. Thus, impairment of a transporter such as AtUTr1 may decrease the transport of UDP-galactose into the Golgi apparatus and affect their synthesis, leading to phenotypic changes in cell wall architecture. AtUTr1 is also able to transport UDP-glucose, and it has been already shown that UDP-glucose is transported into the lumen of the Golgi apparatus in plants (14). Therefore mutations in AtUTr1 may also affect the synthesis of glucose-containing polysaccharides.

This is the first description of a UDP-galactose/UDP-glucose transporter. Along with the recent description of an Arabidopsis GDP-mannose transporter (38), this is the first step in attaining deeper insights into the molecular mechanism and function of nucleotide sugar transporters in plants. The identification of these genes will now allow us to generate and analyze mutants to determine the role of nucleotide sugar transporters in cell wall biosynthesis in planta.

    ACKNOWLEDGEMENTS

We thank Irina Zemtseva for assistance with the yeast studies; Enrique Rodriguez-Boulan for wild type and RCAr MDCK; Marco Tulio Nuñez for access to the cell culture facility; and Paul Dupree and the Plant Molecular Genetics Laboratory at the University of Chile for helpful discussions.

    FOOTNOTES

* This work was supported by Fondecyt 1000675 and ICM P 99-031-F (to A. O.), Fondecyt 2010066 (to L. N.), Fondecyt 2010038 (to L. M.), and National Institutes of Health Grant GM 30365 (to C. B. H.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY115566.

Recipient of a doctoral fellowship from Fundación Andes (Chile).

** To whom correspondence should be addressed: Dept. of Biology, Faculty of Sciences, University of Chile, Las Palmeras 3425, Ñuñoa, Casilla 653, Santiago, Chile. Tel.: 56-2-6787361; Fax: 56-2-2712983; E-mail: aorellan@uchile.cl.

Published, JBC Papers in Press, May 31, 2002, DOI 10.1074/jbc.M204081200

    ABBREVIATIONS

The abbreviations used are: MDCK, Madin-Darby canine kidney cells; RCA, ricin; DIDS, 4,4'-diisothiocyanatostilbene-2-2'-disulfonic acid.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Reid, J. S. G. (2000) Curr. Opin. Plant Biol. 3, 512-516[CrossRef][Medline] [Order article via Infotrieve]
2. Edwards, M. E., Dickson, C. A., Chengappa, S., Sidebottom, C., Gidley, M. J., and Reid, J. S. G. (1999) Plant J. 19, 691-697[CrossRef][Medline] [Order article via Infotrieve]
3. Miura, N., Ishida, N., Hoshino, M., Yamauchi, M., Hara, T., Ayusawa, D., and Kawakita, M. (1996) J. Biochem. (Tokyo) 120, 236-241[Abstract/Free Full Text]
4. Segawa, H., Ishida, N., Takegawa, K., and Kawakita, M. (1999) FEBS Lett. 451, 295-298[CrossRef][Medline] [Order article via Infotrieve]
5. Kainuma, M., Chiba, Y., Takeuchi, M., and Jigami, Y. (2001) Yeast 18, 533-541[CrossRef][Medline] [Order article via Infotrieve]
6. Oelmann, S., Stanley, P., and Gerardy-Schahn, R. (2001) J. Biol. Chem. 276, 26291-26300[Abstract/Free Full Text]
7. Segawa, H., Kawakita, M., and Ishida, N. (2002) Eur. J. Biochem. 269, 128-138[Medline] [Order article via Infotrieve]
8. Brandli, A., Hansson, G., Rodriguez-Boulan, E., and Simons, K. (1988) J. Biol. Chem. 263, 16283-16290[Abstract/Free Full Text]
9. Toma, L., Pinhal, M., Dietrich, C., Nader, H., and Hirschberg, C. (1996) J. Biol. Chem. 271, 3897-3901[Abstract/Free Full Text]
10. Tabuchi, M., Tanaka, N., Iwahara, S., and Takegawa, K. (1997) Biochem. Biophys. Res. Commun. 232, 121-125[CrossRef][Medline] [Order article via Infotrieve]
11. Ishida, N., Yoshioka, S., Iida, M., Sudo, K., Miura, N., Aoki, K., and Kawakita, M. (1999) J. Biochem. (Tokyo) 126, 1107-1117[Abstract/Free Full Text]
12. Sun-Wada, G-H., Yoshioka, S., Ishida, N., and Kawakita, M. (1998) J. Biochem. (Tokyo) 123, 912-917[Abstract/Free Full Text]
13. Orellana, A., and Mohnen, D. (1999) Anal. Biochem. 272, 224-231[CrossRef][Medline] [Order article via Infotrieve]
14. Muñoz, P., Norambuena, L., and Orellana, A. (1996) Plant Physiol. 112, 1585-1594[Abstract]
15. Wulff, C., Norambuena, L., and Orellana, A. (2000) Plant Physiol. 122, 867-877[Abstract/Free Full Text]
16. Orellana, A., Neckelmann, G., and Norambuena, L. (1997) Plant Physiol. 114, 99-107[Abstract]
17. Perez, M., and Hirschberg, C. B. (1987) Methods Enzymol. 138, 709-715[Medline] [Order article via Infotrieve]
18. Mumberg, D., Müller, R., and Funk, M. (1995) Gene 156, 119-122[CrossRef][Medline] [Order article via Infotrieve]
19. Berninsone, P., Hwang, H. Y., Zemtseva, I., Horvitz, H. R., and Hirschberg, C. B. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3738-3743[Abstract/Free Full Text]
20. Goud, B., Salminen, A., Walworth, N. C., and Novick, P. J. (1988) Cell 53, 753-768[CrossRef][Medline] [Order article via Infotrieve]
21. Meiss, H. K., Green, R. F., and Rodriguez-Boulan, E. J. (1982) Mol. Cell. Biol. 2, 1287-1294[Abstract/Free Full Text]
22. Orellana, A., Hirschberg, C. B., Wei, Z., Swiedler, S. J., and Ishihara, M. (1994) J. Biol. Chem. 269, 2270-2276[Abstract/Free Full Text]
23. Capasso, J. M., and Hirschberg, C. B. (1984) J. Biol. Chem. 259, 4263-4266[Abstract/Free Full Text]
24. Ishida, N., Miura, N., Yoshioka, S., and Kawakita, M. (1996) J. Biochem. 120, 1074-1078[Abstract/Free Full Text]
25. Berninsone, P., Eckardt, M., Gerardy-Schahn, R., and Hirschberg, C. (1997) J. Biol. Chem. 272, 12616-12619[Abstract/Free Full Text]
26. Abeijon, C., Orlean, P., Robbins, P., and Hirschberg, C. B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 6935-6939[Abstract/Free Full Text]
27. Muraoka, M., Kawakita, M., and Ishida, N. (2001) FEBS Lett. 495, 87-93[CrossRef][Medline] [Order article via Infotrieve]
28. Carpita, N., and McCann, M. (2000) in Biochemistry & Molecular Biology of Plants (Buchanan, B. , Gruissem, W. , and Jones, R., eds) , pp. 52-108, American Society of Plant Physiologists, Rockville, MD
29. Paulson, J. C., and Colley, K. J. (1989) J. Biol. Chem. 264, 17615-17618[Free Full Text]
30. Capasso, J. M., and Hirschberg, C. B. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 7051-7055[Abstract/Free Full Text]
31. Nakanishi, H., Nakayama, K., Yokota, A., Tachikawi, H., Takahashi, N, and Jigami, Y. (2001) Yeast 18, 543-554[CrossRef][Medline] [Order article via Infotrieve]
32. Herman, T., and Horvitz, H. R. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 974-979[Abstract/Free Full Text]
33. Berninsone, P., and Hirschberg, C. B. (2000) Curr. Opin. Struct. Biol. 10, 542-547[CrossRef][Medline] [Order article via Infotrieve]
34. Descoteaux, A., Luo, Y., Turco, S. J., and Beverley, S. M. (1995) Science 269, 1869-1872[Abstract/Free Full Text]
35. Poster, J. B., and Dean, N. (1996) J. Biol. Chem. 271, 3837-3845[Abstract/Free Full Text]
36. Lübke, T., Marquardt, T., Etzloni, A., Hartmann, E., von Figura, E., and Körner, C. (2001) Nat. Genet. 28, 73-76[CrossRef][Medline] [Order article via Infotrieve]
37. Goto, S., Taniguchi, M., Muraoka, M., Toyoda, H., Sado, Y., Kawakita, M., and Hayashi, S. (2001) Nat. Cell Biol. 3, 816-822[CrossRef][Medline] [Order article via Infotrieve]
38. Baldwin, T., Handford, M., Yuseff, M. I., Orellana, A., and Dupree, P. (2001) Plant Cell 13, 2283-2295[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
C. E. Caffaro, C. B. Hirschberg, and P. M. Berninsone
Functional Redundancy between Two Caenorhabditis elegans Nucleotide Sugar Transporters with a Novel Transport Mechanism
J. Biol. Chem., September 21, 2007; 282(38): 27970 - 27975.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
T. R. Cottrell, C. L. Griffith, H. Liu, A. A. Nenninger, and T. L. Doering
The Pathogenic Fungus Cryptococcus neoformans Expresses Two Functional GDP-Mannose Transporters with Distinct Expression Patterns and Roles in Capsule Synthesis
Eukaryot. Cell, May 1, 2007; 6(5): 776 - 785.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. E. Caffaro, C. B. Hirschberg, and P. M. Berninsone
Independent and simultaneous translocation of two substrates by a nucleotide sugar transporter
PNAS, October 31, 2006; 103(44): 16176 - 16181.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Blume, J. Angulo, T. Biet, H. Peters, A. J. Benie, M. Palcic, and T. Peters
Fragment-based Screening of the Donor Substrate Specificity of Human Blood Group B Galactosyltransferase Using Saturation Transfer Difference NMR
J. Biol. Chem., October 27, 2006; 281(43): 32728 - 32740.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Reyes, L. Marchant, L. Norambuena, R. Nilo, H. Silva, and A. Orellana
AtUTr1, a UDP-glucose/UDP-galactose Transporter from Arabidopsis thaliana, Is Located in the Endoplasmic Reticulum and Up-regulated by the Unfolded Protein Response
J. Biol. Chem., April 7, 2006; 281(14): 9145 - 9151.
[Abstract] [Full Text] [PDF]

Home page
 GlycobiologyHome page
H. Bakker, F. Routier, S. Oelmann, W. Jordi, A. Lommen, R. Gerardy-Schahn, and D. Bosch
Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line
Glycobiology, February 1, 2005; 15(2): 193 - 201.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Segawa, R. P. Soares, M. Kawakita, S. M. Beverley, and S. J. Turco
Reconstitution of GDP-mannose Transport Activity with Purified Leishmania LPG2 Protein in Liposomes
J. Biol. Chem., January 21, 2005; 280(3): 2028 - 2035.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
S. Knappe, U.-I. Flugge, and K. Fischer
Analysis of the Plastidic phosphate translocator Gene Family in Arabidopsis and Identification of New phosphate translocator-Homologous Transporters, Classified by Their Putative Substrate-Binding Site
Plant Physiology, March 1, 2003; 131(3): 1178 - 1190.
[Abstract] [Full Text]